A picrorhiza small rna, a picrorhiza small rna composition, a preparation method and use thereof for preventing and / or treating liver fibrosis

Abstract

The application provides a small RNA of Pien Tze Huang, a small RNA composition, a preparation method and use for preventing and / or treating liver fibrosis, and belongs to the technical field of biological medicine. The small RNA composition is composed of nucleotide sequences shown as SEQ ID NO. 1-6. The six small RNA molecules can be effectively absorbed by ingestion, and stably exist in the body. The composition obtained by combining the six small RNA molecules can be used for preventing and / or treating liver fibrosis. The application finds small RNA in Pien Tze Huang which is beneficial to preventing and treating liver fibrosis, and this is of great significance to further research and quality control of Pien Tze Huang.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a Pien Tze Huang small RNA for preventing and / or treating liver fibrosis, a small RNA composition, and a preparation method and use thereof. Background Art

[0002] Liver fibrosis is a progressive pathological process characterized by abnormal proliferation of connective tissue within the liver, triggered by various pathogenic factors, leading to excessive deposition of extracellular matrix within the liver. Liver fibrosis is a common and reversible pathological process in various chronic liver diseases, and reversing liver fibrosis is crucial for preventing and treating chronic liver disease and cirrhosis. Currently, antiviral treatments such as interferon and lamivudine are commonly used clinically, but they are prone to drug resistance, have significant side effects with long-term use, and can cause rebound symptoms upon discontinuation, leading to death in severe cases.

[0003] The traditional Chinese medicine Pien Tze Huang has long been used in the clinical treatment of liver diseases. Numerous studies have demonstrated that Pien Tze Huang has significant therapeutic effects on liver fibrosis. Mechanistic studies have revealed that several of the medicinal components in Pien Tze Huang have therapeutic value in liver fibrosis, but these findings do not fully explain its pharmacological and pharmacodynamic mechanisms in this condition.

[0004] In recent years, numerous studies have demonstrated that exogenous small RNAs derived from foods and herbs can be absorbed by the human body through the digestive tract, enter human cells, and regulate target genes and exert their functions. For example, small RNAs found in the traditional Chinese medicine honeysuckle have the ability to directly inhibit the replication of H5N1 and SARS-CoV-2 viruses. After taking a decoction of honeysuckle, small RNAs from the honeysuckle can be effective in treating viral infections. Another example is small RNAs found in sedum, which have therapeutic effects on pulmonary fibrosis. These findings suggest that small RNAs from traditional Chinese medicines may represent a new, long-overlooked active ingredient in traditional Chinese medicine. Orally administered, they can be absorbed through the digestive tract and reach target organs to exert their therapeutic value. Summary of the Invention

[0005] The purpose of the present invention is to provide a Pien Tze Huang small RNA, a small RNA composition, a preparation method and use thereof for preventing and / or treating liver fibrosis.

[0006] The present invention provides a small RNA for preventing and / or treating liver fibrosis, which has a nucleotide sequence as shown in any one of SEQ ID NO.1 and SEQ ID NO.3-6.

[0007] The present invention also provides the use of the small RNA nucleotide sequence shown in any one of SEQ ID NOs. 1 to 6 in the preparation of a drug for preventing and / or treating liver fibrosis.

[0008] Furthermore, the drug is a drug that inhibits the expression of AKT1, TGFB1, and UQCRC2 genes;

[0009] Preferably, the drug is a drug that reduces the levels of ALT and AST in serum;

[0010] and / or, the drug is a drug that reduces the collagen fiber content in liver tissue;

[0011] And / or, the drug is a drug that inhibits the expression of Collagen 1 and α-SMA protein.

[0012] The present invention also provides a small RNA composition for preventing and / or treating liver fibrosis, which is composed of nucleotide sequences as shown in SEQ ID NOs. 1 to 6.

[0013] Furthermore, the molar percentage of the nucleotide sequence shown in SEQ ID NO.1 is 30-50%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.2 is 15-30%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.3 is 10-25%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.4 is 5-20%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.5 is 5-15%, and the molar percentage of the nucleotide sequence shown in SEQ ID NO.6 is 3-10%.

[0014] Furthermore, the molar percentage of the nucleotide sequence shown in SEQ ID NO.1 is 35-36%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.2 is 17-18%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.3 is 15-16%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.4 is 11-12%, the molar percentage of the nucleotide sequence shown in SEQ ID NO.5 is 10-11%, and the molar percentage of the nucleotide sequence shown in SEQ ID NO.6 is 8-9%.

[0015] Furthermore, the molar ratio of the nucleotide sequences shown in SEQ ID NOs. 1 to 6 is 1:0.5:0.44:0.33:0.28:0.23.

[0016] The present invention also provides a method for preparing the aforementioned small RNA composition, which comprises the following steps:

[0017] The nucleotide sequences shown in SEQ ID NO. 1 to 6 are mixed to obtain the product.

[0018] The present invention also provides the use of the aforementioned small RNA composition in the preparation of a drug for preventing and / or treating liver fibrosis;

[0019] Preferably, the drug is a drug that inhibits the expression of AKT1, TGFB1, and UQCRC2 genes.

[0020] Furthermore, the drug is a drug that reduces the levels of ALT and AST in serum;

[0021] and / or, the drug is a drug that reduces the collagen fiber content in liver tissue;

[0022] And / or, the drug is a drug that inhibits the expression of Collagen 1 and α-SMA protein.

[0023] The present invention also provides a drug for preventing and / or treating liver fibrosis, which is a preparation prepared with the aforementioned small RNA or the aforementioned small RNA combination as an active ingredient and pharmaceutically acceptable excipients or auxiliary ingredients.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention extracts six small RNAs from the traditional Chinese medicine Pien Tze Huang. These six small RNAs can inhibit the expression of three genes, AKT1, TGFB1, and UQCRC2, and play a role in preventing and / or treating liver fibrosis. In addition, the composition obtained by combining these six small RNAs can also be used to prevent and / or treat liver fibrosis. At the same time, the six sRNAs of the present invention can be effectively absorbed through ingestion and are stable, easy to use, and effective. The six sRNAs of the present invention can also be used as markers to control the quality of Pien Tze Huang. Pien Tze Huang with high levels of these six sRNAs is more effective in preventing and treating liver fibrosis. The present invention has discovered small RNAs in Pien Tze Huang that are beneficial for preventing and treating liver fibrosis, which is of great significance for the further development and quality control of Pien Tze Huang. Based on the small RNA molecular indicators screened out, product quality control can be carried out on each batch of Pien Tze Huang.

[0026] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0027] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Flowchart of small RNA high-throughput sequencing experiment.

[0029] Figure 2The copy number of the Pien Tze Huang small RNA of the present invention was obtained by Solexa sequencing.

[0030] Figure 3 is the concentration of the Pien Tze Huang small RNA of the present invention in serum.

[0031] Figure 4 is the concentration of the Pien Tze Huang small RNA of the present invention in the liver.

[0032] Figure 5 This is the result of the binding of PTH-sRNA-1 and AKT1 gene.

[0033] Figure 6 This is the result of the binding of PTH-sRNA-5 and AKT1 gene.

[0034] Figure 7 This is the result of the binding of PTH-sRNA-7 and AKT1 gene.

[0035] Figure 8 This is the result of the binding of PTH-sRNA-12 and AKT1 gene.

[0036] Figure 9 This is the result of the binding of PTH-sRNA-14 to AKT1 gene.

[0037] Figure 10 This is the result of the binding of PTH-sRNA-18 to AKT1 gene.

[0038] Figure 11 This is the result of the binding of PTH-sRNA-1 and TGFB1 gene.

[0039] Figure 12 This is the result of the binding of PTH-sRNA-5 and TGFB1 gene.

[0040] Figure 13 This is the result of the binding of PTH-sRNA-7 and TGFB1 gene.

[0041] Figure 14 This is the result of the binding of PTH-sRNA-12 and TGFB1 gene.

[0042] Figure 15 This is the result of the binding of PTH-sRNA-14 to TGFB1 gene.

[0043] Figure 16 This is the result of the binding of PTH-sRNA-18 to TGFB1 gene.

[0044] Figure 17 This is the result of the combination of PTH-sRNA-1 and UQCRC2 gene.

[0045] Figure 18 This is the result of the binding of PTH-sRNA-5 and UQCRC2 gene.

[0046] Figure 19 This is the result of the binding of PTH-sRNA-7 and UQCRC2 gene.

[0047] Figure 20 This is the result of the binding of PTH-sRNA-12 and UQCRC2 gene.

[0048] Figure 21 This is the result of the binding of PTH-sRNA-14 and UQCRC2 gene.

[0049] Figure 22 This is the result of the binding of PTH-sRNA-18 to UQCRC2 gene.

[0050] Figure 23 The luciferase reporter experiment was used to verify the binding ability of Pien Tze Huang small RNA to the target site.

[0051] Figure 24 For the detection of ALT and AST in mouse serum.

[0052] Figure 25 Representative images of mouse liver tissue stained with HE, Masson, and picrosirius red.

[0053] Figure 26 The expression levels of α-SMA and Collagen1 in mouse liver tissue.

[0054] Figure 27 Representative images of immunohistochemical staining of Collagen1 and α-SMA proteins in liver tissue (scale bar: 100 μm). DETAILED DESCRIPTION

[0055] The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercial products.

[0056] The Pien Tze Huang used in the present invention is provided by Zhangzhou Pien Tze Huang Pharmaceutical Co., Ltd.

[0057] In the preliminary study, the present invention first extracted total RNA from Pien Tze Huang and performed small RNA high-throughput sequencing on it; then, mice were gavaged with Pien Tze Huang, RNA was extracted from the mouse serum and small RNA high-throughput sequencing was performed, the Pien Tze Huang drug-derived small RNAs were screened, and small RNAs with a copy number greater than 100 were selected for research, ultimately finding that six small RNAs of the present invention were associated with liver fibrosis.

[0058] Example 1: Verification of the six small RNAs of the present invention in Pien Tze Huang

[0059] 1. Extraction of total RNA from Pien Tze Huang

[0060] Take an appropriate amount of Pien Tze Huang, grind it into 100 mesh powder at room temperature or low temperature, and use Trizol reagent to extract total RNA from the sample. The specific method is as follows:

[0061] 1) Grind Pien Tze Huang into powder using a cryogenic grinder. Weigh 50 mg into a 1.5 ml centrifuge tube, add 1 ml of trizol, vortex, and let stand on ice for 10 min.

[0062] 2) Add 200 μl of chloroform, shake vigorously to mix, and then let it stand for 5 minutes;

[0063] 3) Centrifugation at 14,000 g for 20 min at 4°C;

[0064] 4) Pipette the supernatant into a new 1.5 ml centrifuge tube, add 1-2 times the volume of isopropanol, mix well, and place in -20°C for precipitation for at least 1 hour;

[0065] 5) Centrifuge at 14,000 g for 20 min at 4°C;

[0066] 6) Discard the supernatant and retain the precipitate. Add 1 ml of 75% alcohol prepared with DEPC water and pipette thoroughly.

[0067] 7) Centrifuge at 14,000 g for 20 min at 4°C;

[0068] 8) Discard the supernatant and invert the 1.5 ml centrifuge tube to allow the alcohol to dry for approximately 5-10 minutes.

[0069] 9) Dissolve in DEPC water and store at -80°C to obtain Pien Tze Huang total RNA.

[0070] 2. Detection of the contents of the six small RNAs of the present invention

[0071] After total RNA is extracted from Pien Tze Huang, it can be detected using high-throughput sequencing technology, reverse transcription PCR (RT-PCR), real-time fluorescence quantitative PCR (qPCR), RNA chip, Northern Blotting, in situ hybridization and other technologies. The specific method of this embodiment is as follows:

[0072] After extracting the total RNA from Pien Tze Huang, PAGE electrophoresis was performed to recover 18-45nt RNA molecules. After adding a 3' linker, the RT primer with UMI was added to the system for reverse transcription and extension to synthesize cDNA chains. Figure 1 The sequences and contents of the six small RNAs of the present invention were obtained (Table 1). The RT primers with UMIs were provided by a sequencing company (Shenzhen BGI Genomics Co., Ltd.).

[0073] Table 1. Names and sequences of small RNAs

[0074]

[0075]

[0076] The copy numbers of the above six small RNAs are as follows Figure 2 As shown in Table 1 and Figure 2 It can be seen that the six small RNAs of the present invention are present in relatively high levels in Pien Tze Huang, among which PTH-sRNA-1 has the highest content.

[0077] The beneficial effects of the present invention are demonstrated below through specific test examples.

[0078] Test Example 1: Study on the stability of Pien Tze Huang small RNA after ingestion

[0079] 1. Experimental methods

[0080] RT-qPCR was used to detect the Pien Tze Huang small RNA that entered the animal body through feeding and was stably present. Male C57 mice were taken and randomly divided into a normal control group (PBS control group), a Pien Tze Huang single-dose group, and a Pien Tze Huang multiple-dose group. After fasting for 12 hours, Pien Tze Huang was ground into a 100-mesh powder and then configured into a suspension with PBS for oral administration. The single-dose group was only gavage-administered once, and the multiple-dose group was gavage-administered once every 3 hours for a total of three doses. The Pien Tze Huang dosage for each oral administration was 0.1 g / 100 g. The PBS control group was gavaged with the same dose of PBS. Six hours after the last gavage, mouse blood was taken to separate serum, and liver tissue was taken. The RT-qPCR method was used to detect the content of the six Pien Tze Huang small RNAs of the present invention in serum and liver tissue. The primers used for reverse transcription PCR and qPCR detection of Pien Tze Huang small RNAs are shown in Table 2.

[0081] Table 2. List of reverse transcription PCR and qPCR detection primers

[0082]

[0083]

[0084] Pien Tze Huang sRNA was reverse transcribed using the system shown in Table 3 (10 μl).

[0085] Table 3. sRNA reverse transcription reaction system

[0086]

[0087] After the system is configured, mix well and place in a PCR instrument for reaction. The reaction program is shown in Table 4.

[0088] Table 4. sRNA reverse transcription procedures

[0089]

[0090] After reverse transcription is complete, qPCR primers are used for quantitative detection. The qPCR system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0091] Table 5. sRNA fluorescence quantitative PCR reaction system

[0092]

[0093]

[0094] Table 6. Fluorescence quantitative PCR reaction program

[0095]

[0096] 2. Experimental results

[0097] The experimental results are as follows Figure 3 and Figure 4 As shown: The results show that the six Pien Tze Huang small RNAs of the present invention can be absorbed through the digestive tract and reach the serum and liver tissue. The experimental results show that the six Pien Tze Huang sRNAs of the present invention can enter the animal body through ingestion and exist stably.

[0098] Experimental Example 2: Bioinformatics Analysis of the Binding of Pien Tze Huang Small RNA to Target Genes

[0099] 1. Experimental methods

[0100] The study aimed to investigate whether the Pien Tze Huang small RNAs of the present invention could bind to a series of target genes associated with liver fibrosis and exert their therapeutic value for liver fibrosis by inhibiting the expression of the target genes. Bioinformatics methods (RNAhybrid) were used to analyze the binding of the six Pien Tze Huang small RNAs to the target genes AKT1, TGFB1, and UQCRC2.

[0101] 2. Experimental results

[0102] The binding ability of PTH-sRNA-1 to AKT1 gene mRNA is as follows Figure 5 As shown in the figure, the binding mode, binding site and binding free energy of PTH-sRNA-1 and AKT1 gene mRNA are explained. Among them, PTH-sRNA-1 has two binding modes with AKT1.

[0103] The binding ability of PTH-sRNA-5 to AKT1 gene mRNA is as follows Figure 6The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-5 and AKT1 gene mRNA. PTH-sRNA-5 has one binding mode with AKT1.

[0104] The binding ability of PTH-sRNA-7 to AKT1 gene mRNA is as follows Figure 7 The figure shows the binding mode, binding site and binding free energy of PTH-sRNA-7 and AKT1 gene mRNA. There are three binding modes between PTH-sRNA-7 and AKT1.

[0105] The binding ability of PTH-sRNA-12 to AKT1 gene mRNA is as follows Figure 8 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-12 and AKT1 gene mRNA. PTH-sRNA-12 has three binding modes with AKT1.

[0106] The binding ability of PTH-sRNA-14 to AKT1 gene mRNA is as follows Figure 9 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-14 and AKT1 gene mRNA. PTH-sRNA-14 has one binding mode with AKT1.

[0107] The binding ability of PTH-sRNA-18 to AKT1 gene mRNA is as follows Figure 10 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-18 and AKT1 gene mRNA. PTH-sRNA-18 has one binding mode with AKT1.

[0108] The binding ability of PTH-sRNA-1 to TGFB1 gene mRNA is as follows Figure 11 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-1 and TGFB1 gene mRNA. PTH-sRNA-1 has two binding modes with TGFB1.

[0109] The binding ability of PTH-sRNA-5 to TGFB1 gene mRNA is as follows Figure 12 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-5 and TGFB1 gene mRNA. PTH-sRNA-5 has two binding modes with TGFB1.

[0110] The binding ability of PTH-sRNA-7 to TGFB1 gene mRNA is as follows Figure 13The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-7 and TGFB1 gene mRNA. PTH-sRNA-7 has two binding modes with TGFB1.

[0111] The binding ability of PTH-sRNA-12 to TGFB1 gene mRNA is as follows Figure 14 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-12 and TGFB1 gene mRNA. PTH-sRNA-12 has two binding modes with TGFB1.

[0112] The binding ability of PTH-sRNA-14 to TGFB1 gene mRNA is as follows Figure 15 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-14 and TGFB1 gene mRNA. PTH-sRNA-14 has two binding modes with TGFB1.

[0113] The binding ability of PTH-sRNA-18 to TGFB1 gene mRNA is as follows Figure 16 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-18 and TGFB1 gene mRNA. PTH-sRNA-18 has two binding modes with TGFB1.

[0114] The binding ability of PTH-sRNA-1 to UQCRC2 gene mRNA is as follows Figure 17 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-1 and UQCRC2 gene mRNA. PTH-sRNA-1 and UQCRC2 have two binding modes.

[0115] The binding ability of PTH-sRNA-5 to UQCRC2 gene mRNA is as follows Figure 18 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-5 and UQCRC2 gene mRNA. PTH-sRNA-5 has two binding modes with UQCRC2.

[0116] The binding ability of PTH-sRNA-7 to UQCRC2 gene mRNA is as follows Figure 19 Figure 2: The figure illustrates the binding mode, binding site, and binding free energy of PTH-sRNA-7 and UQCRC2 gene mRNA. PTH-sRNA-7 binds to UQCRC2 in two ways.

[0117] The binding ability of PTH-sRNA-12 to UQCRC2 gene mRNA is as follows Figure 20 Figure 1: This figure illustrates the binding mode, binding site, and binding free energy of PTH-sRNA-12 and UQCRC2 gene mRNA. PTH-sRNA-12 binds to UQCRC2 in two ways.

[0118] The binding ability of PTH-sRNA-14 to UQCRC2 gene mRNA is as follows Figure 21 Figure 1: This figure illustrates the binding mode, binding site, and binding free energy of PTH-sRNA-14 to UQCRC2 gene mRNA. There are two binding modes between PTH-sRNA-14 and UQCRC2.

[0119] The binding ability of PTH-sRNA-18 to UQCRC2 gene mRNA is as follows Figure 22 The figure shows the binding mode, binding site, and binding free energy of PTH-sRNA-18 and UQCRC2 gene mRNA. PTH-sRNA-18 has two binding modes with UQCRC2.

[0120] It is generally believed that a minimum free energy (mfe) less than -20 has an inhibitory effect. Therefore, according to the above analysis results, the six small RNAs of the present invention all have the function of specifically binding to the mRNA of the target genes AKT1, TGFB1, and UQCRC2 and inhibiting gene expression.

[0121] AKT1, TGFB1, and UQCRC2 are all recognized as contributing to the development and progression of liver fibrosis. During liver fibrosis, AKT1 mediates mitochondrial autophagy through the production of ROS, promoting the secretion of TGFB1. TGFB1 is a key cytokine that promotes liver fibrosis, inducing the transformation of hepatic stellate cells into myofibroblasts, thereby contributing to the formation of liver fibrosis. Furthermore, inhibition of UQCRC2 can suppress mitochondrial function in hepatic stellate cells.

[0122] Therefore, inhibition of AKT1, TGFB1, and UQCRC2 genes can prevent and / or treat liver fibrosis, indicating that the six small RNAs of the present invention can prevent and / or treat liver fibrosis.

[0123] Experimental Example 3: Inhibitory Effect of Pien Tze Huang Small RNA on Target Genes

[0124] 1. Experimental methods

[0125] The six Pien Tze Huang small RNAs, PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18, were obtained from Pien Tze Huang using the method described in Example 1, and can also be directly synthesized using conventional techniques.

[0126] The luciferase reporter assay demonstrated the inhibitory effect of Pien Tze Huang small RNA on target genes:

[0127] The target genes AKT1, TGFB1, and UQCRC2 were combined with six Pien Tze Huang small RNAs (PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14, and PTH-sRNA-18 at a molar ratio of 1:0.5:0.44:0.33:0.28:0.23) and the segment sequence fragments were inserted into the pMIR-REPORT Luciferase plasmid to construct luciferase reporter plasmids for each gene. Positive clones were screened and sequenced for verification, and the clones were amplified and the plasmids were purified.

[0128] The cells were cultured and inoculated in 24-well plates. After 12-16 hours, the cells were co-transfected with a luciferase expression plasmid carrying the predicted target gene and a Pien Tze Huang small RNA plasmid. After 24 hours, the cells were collected and lysed, and a luciferase substrate was added. The luciferase reacted with the substrate to produce luciferin. By detecting the intensity of the fluorescence, the activity of the luciferase could be measured. Compared with the transfection nonsense small RNA group, it was determined whether the predicted target could be inhibited by the Pien Tze Huang small RNA.

[0129] AKT1 target gene and small RNA binding segment sequence fragment:

[0130] GGTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCCCCTTCTGTGT

[0131] CACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCTCCAGATGATCT

[0132] CTCCACGGTAGCACTTGACCTTTTTCGACGCTTAACCTTTCCGCTGTCGC

[0133] CCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCACGCCTCCTGGCCAG(SEQID NO.25)

[0134] Sequence fragment of the region where TGFB1 target gene binds to small RNA:

[0135] CACCAGCCCTGTTCGCGCTCTCGGCAGTGCCGGGGGGCGCCGCCTCCC

[0136] CCATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCT

[0137] GTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGGGACTATCCAC

[0138] CTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGA(SEQ IDNO.26)

[0139] The sequence fragment of the segment where the UQCRC2 target gene binds to the small RNA: GATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCA (SEQ ID NO.27)

[0140] Nonsense small RNA sequence: GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 28). Nonsense small RNA is a meaningless small RNA sequence that will not bind to the target gene.

[0141] 2. Experimental results

[0142] The target genes AKT1, TGFB1, and UQCRC2 that bind to Pien Tze Huang small RNA were inserted into the pMIR-REPORT Luciferase plasmid to construct the luciferase reporter plasmids for each gene. The results of the luciferase reporter experiment showed that ( Figure 23 ), the six Pien Tze Huang small RNAs of the present invention have an inhibitory effect on the three target genes AKT1, TGFB1, and UQCRC2 after binding. However, nonsense small RNAs have no inhibitory effect on the three target genes AKT1, TGFB1, and UQCRC2.

[0143] Experimental Example 4: Preventive and Protective Effects of Pien Tze Huang Small RNA on Liver Fibrosis

[0144] 1. Experimental methods

[0145] The six Pien Tze Huang small RNAs, PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18, were directly synthesized using conventional techniques.

[0146] A liver fibrosis model was constructed to demonstrate the preventive and protective effect of the Pien Tze Huang sRNA composition of the present invention on liver fibrosis:

[0147] CCl4 and olive oil were prepared in a volume ratio of 1:4, and CCl4 and olive oil diluted in olive oil were injected intraperitoneally into 8-week-old C57 mice, 100 μL per mouse, once every three days, for 10 injections. After the last injection, the mice were killed one day later. During modeling, mice were randomly divided into a control group (control), a Pien Tze Huang sRNA group (PTH sRNA) and a nonsense small RNA group (scramble RNA). The control group was gavaged with PBS. The Pien Tze Huang sRNA group mixed 6 small RNAs and then gavaged with PBS (the mol ratio of PTH-sRNA-1, PTH-sRNA-5, PTH-sRNA-7, PTH-sRNA-12, PTH-sRNA-14 and PTH-sRNA-18 was 1:0.5:0.44:0.33:0.28:0.23). The total amount of sRNA was 0.16nmol / g and gavage was performed once a day. The nonsense small RNA group also gavaged with PBS and gavage with PBS. The total amount of nonsense small RNA was 0.16nmol / g and gavage was performed once a day. Simultaneously, wild-type mice (WT) without modeling were used as controls.

[0148] The nonsense small RNA sequence is shown as SEQ ID NO.28.

[0149] 2. Experimental results

[0150] After the model was established, blood was collected and serum was separated to detect the levels of ALT and AST in the serum of mice in each group. The results were as follows: Figure 24 As shown, the ALT and AST levels in the serum of the control mice were significantly higher than those of the healthy mice, while the levels of ALT and AST in the serum of the mice given Pien Tze Huang sRNA for prevention were significantly reduced and significantly lower than those of the control mice.

[0151] Then, HE, Masson and Sirius red staining were used to evaluate the disease progression of liver fibrosis in each group of mice. The results also showed that ( Figure 25), the content of collagen fibers in the liver tissue of mice given preventive administration of Pien Tze Huang sRNA was significantly lower than that of the control group.

[0152] Then the expression levels of Collagen1 and α-SMA proteins were detected by Western Blot. The results showed that ( Figure 26 ), preventive administration of the drug to model mice can significantly inhibit the expression of Collagen1 and α-SMA proteins in the liver tissue of mice.

[0153] The results of immunohistochemistry showed that ( Figure 27 ), after CCl4 induction, the levels of α-SMA and Collagen1 in the liver tissue of mice were significantly increased. In comparison, the accumulation of α-SMA and Collagen1 in the liver tissue of mice given preventive administration of Pien Tze Huang sRNA was significantly inhibited.

[0154] The above results indicate that the microRNA composition of the present invention can prevent liver fibrosis.

[0155] In summary, the present invention extracts 6 small RNAs from the traditional Chinese patent medicine Pien Tze Huang. These 6 small RNAs can inhibit the expression of three genes, AKT1, TGFB1, and UQCRC2, and play a role in preventing and / or treating liver fibrosis. In addition, the composition obtained after combining these 6 small RNAs can also be used to prevent and / or treat liver fibrosis. At the same time, the 6 sRNAs of the present invention can be effectively absorbed by ingestion and are stably present, easy to use and effective. The 6 sRNAs of the present invention can also be used as markers to control the quality of Pien Tze Huang. Pien Tze Huang with high levels of these 6 sRNAs is more effective in preventing and treating liver fibrosis. The present invention has discovered small RNAs in Pien Tze Huang that are beneficial for preventing and treating liver fibrosis, which is of great significance for the further development and quality control of Pien Tze Huang. Based on the small RNA molecular indicators screened out, product quality control can be carried out on each batch of Pien Tze Huang.

Claims

1. A small RNA composition for preventing and / or treating liver fibrosis, characterized in that: The small RNA composition is composed of six small RNA components with nucleotide sequences as shown in SEQ ID NOs. 1 to 6.

2. The small RNA composition according to claim 1, characterized in that: The molar percentage of the small RNA shown in SEQ ID NO.1 is 30-50%, the molar percentage of the small RNA shown in SEQ ID NO.2 is 15-30%, the molar percentage of the small RNA shown in SEQ ID NO.3 is 10-25%, the molar percentage of the small RNA shown in SEQ ID NO.4 is 5-20%, the molar percentage of the small RNA shown in SEQ ID NO.5 is 5-15%, and the molar percentage of the small RNA shown in SEQ ID NO.6 is 3-10%.

3. The small RNA composition according to claim 2, characterized in that: The molar percentage of the small RNA shown in SEQ ID NO.1 is 35-36%, the molar percentage of the small RNA shown in SEQ ID NO.2 is 17-18%, the molar percentage of the small RNA shown in SEQ ID NO.3 is 15-16%, the molar percentage of the small RNA shown in SEQ ID NO.4 is 11-12%, the molar percentage of the small RNA shown in SEQ ID NO.5 is 10-11%, and the molar percentage of the small RNA shown in SEQ ID NO.6 is 8-9%.

4. The small RNA composition according to any one of claims 1 to 3, characterized in that: The molar ratio of the six small RNAs whose nucleotide sequences are shown in SEQ ID NOs. 1 to 6 is 1:0.5:0.44:0.33:0.28:0.

23.

5. The method for preparing the small RNA composition according to any one of claims 1 to 4, characterized in that: The steps include: The nucleotide sequences of the six small RNAs shown in SEQ ID NOs. 1 to 6 are mixed to obtain the product.

6. Use of the small RNA composition according to any one of claims 1 to 4 in the preparation of a medicament for preventing and / or treating liver fibrosis.

7. The use according to claim 6, characterized in that: The drug is a drug that inhibits the expression of AKT1, TGFB1 and UQCRC2 genes.

8. The use according to claim 6, characterized in that: The drug is a drug that reduces the levels of ALT and AST in serum; and / or, the drug is a drug that reduces the collagen fiber content in liver tissue; And / or, the drug is a drug that inhibits the expression of Collagen 1 and α-SMA protein.

9. A drug for preventing and / or treating liver fibrosis, characterized in that: The drug is a preparation prepared by using the small RNA composition according to any one of claims 1 to 4 as an active ingredient and adding pharmaceutically acceptable excipients.

Images