A leucine dehydrogenase mutant and its application in the preparation of L-phenylglycine

Abstract

The present invention discloses a leucine dehydrogenase mutant and its application in the preparation of L-phenylglycine. The leucine dehydrogenase mutant is: using the wild-type leucine dehydrogenase MsLDH shown in SEQ ID NO.1 as a template, aspartic acid D at the 332nd position is mutated to glutamic acid E, glycine G at the 333rd position is mutated to glutamic acid E, and leucine L at the 334th position is mutated to arginine R to obtain the mutant MsLDH-EER, and the amino acid sequence is as shown in SEQ ID NO.2. The present invention obtains a leucine dehydrogenase mutant MsLeuDH with improved catalytic activity and pH stability through molecular modification. Compared with the wild-type MsLeuDH, the conversion rate is 68.0% at 4 h under a substrate concentration of 200 mM. According to the mutant MsLDH-EER provided by the present invention, the conversion rate reaches 99.5% at 3 h, and the e.e. value of the product is greater than 99%.

Description

Technical Field

[0001] The present invention relates to the field of protein engineering technology, and more particularly to a leucine dehydrogenase mutant and its encoding gene, genetically engineered bacteria, and application in the preparation of L-phenylglycine. Background Art

[0002] L-phenylglycine, a non-natural aromatic amino acid, is a crucial intermediate in pharmaceuticals and agrochemicals. L-phenylglycine and its derivatives are commonly used in the production of important antibiotics and β-lactam antibiotics, such as ampicillin, cephradine, cefadroxil, amoxicillin, and ampicillin sodium. It is also an important intermediate in the synthesis of protease inhibitors, the anti-tumor drug paclitaxel, the antiplatelet inhibitor clopidogrel, and peptide drugs. Furthermore, as a food additive, it is widely used in the food industry. Therefore, L-phenylglycine has a significant market both domestically and internationally, and the development of efficient and high-quality production processes for L-phenylglycine is gaining increasing attention.

[0003] Currently, chemical methods are widely used to prepare L-phenylglycine. The process uses a large amount of petrochemical raw materials, and the production raw materials and processes are toxic to the environment and human body. In comparison, the use of microorganisms and optically selective enzymatic asymmetric catalysis is a more reasonable production method. The enzymatic process has many advantages, such as low catalyst loading, high specificity, high enantioselectivity, mild processing of complex and chemically unstable compounds, the ability to reduce or eliminate reaction by-products, overall reusability and cost-effectiveness through immobilization, and the potential for traditional multi-stage processes through one-pot reactions, which are more suitable for the production of unnatural chiral amino acids.

[0004] Amino acid dehydrogenases or aminotransferases use ketoacids as substrates for the asymmetric synthesis of various L-amino acids. The asymmetric synthesis of L-phenylglycine using leucine dehydrogenase (LeuDH, EC 1.4.1.9) is an ideal synthetic pathway. This process offers significant advantages, including the use of ammonium ions as amine donors, high atom economy, and a low-cost NADH coenzyme regeneration system.

[0005] However, the leucine dehydrogenases discovered so far have problems with low catalytic activity and low substrate conversion rate in the asymmetric catalytic reductive amination of benzoylformate. Summary of the Invention

[0006] The present invention aims to provide a leucine dehydrogenase mutant and its encoding gene, a genetically engineered bacterium, and its use in the preparation of L-phenylglycine, thereby solving the problems of low catalytic activity and low substrate conversion rate of leucine dehydrogenase in the asymmetric catalytic reductive amination of benzoylformic acid in the prior art.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] According to a first aspect of the present invention, a leucine dehydrogenase mutant with enhanced activity is provided. The leucine dehydrogenase mutant is: using the wild-type leucine dehydrogenase MsLDH shown in SEQ ID NO.1 as a template, aspartic acid D at position 332 is mutated to glutamic acid E, glycine G at position 333 is mutated to glutamic acid E, and leucine L at position 334 is mutated to arginine R to obtain a mutant MsLDH-EER, whose amino acid sequence is shown in SEQ ID NO.2.

[0009] According to the present invention, the wild-type leucine dehydrogenase MsLDH is derived from Marinobacter sp.

[0010] According to a second aspect of the present invention, a gene encoding the leucine dehydrogenase mutant as described above is provided.

[0011] According to a third aspect of the present invention, a recombinant vector and a genetically engineered bacterium containing the gene encoding the leucine dehydrogenase mutant described above are provided. According to a preferred embodiment of the present invention, the host bacterium can be E. coli BL21 (DE3).

[0012] According to a fourth aspect of the present invention, there is provided a use of the leucine dehydrogenase mutant as described above in catalyzing the preparation of L-phenylglycine from benzoylformate.

[0013] The application comprises: in the presence of an enzyme catalytic system, causing benzoylformic acid to undergo a reduction reaction to generate L-phenylglycine, wherein the enzyme catalytic system comprises a leucine dehydrogenase mutant MsLDH-EER for converting benzoylformic acid into L-phenylglycine.

[0014] The present invention utilized a laboratory bacterial strain library to mine multiple LeuDHs and tested their enzyme activity in vitro. The resulting leucine dehydrogenase, MsLeuDH, from Marinobacter sp., exhibited the highest enzyme activity and catalytic efficiency toward the substrate benzoylformate. To date, there have been no reports on the mutation of leucine dehydrogenase (LeuDH) from the microorganism Marinobacter sp.

[0015] Under optimal conditions, MsLeuDH was coupled to formate dehydrogenase for coenzyme regeneration and its catalytic ability in the reductive amination of BFA to produce L-phenylglycine was determined. The results showed that MsLeuDH achieved a 68.0% conversion of 200 mM BFA in 4 hours, emphasizing the need for further modification to increase conversion efficiency and substrate loading.

[0016] The tertiary structure of a protein is often a high-level spatial structure maintained by secondary structures such as α-helices, β-sheets, and random coiled loops through interactions between side chains. The random coiled portion is also called the loop region. The loops present on the protein surface play an important role in maintaining the structural stability of the enzyme. In the presence of high concentrations of substrates or organic reagents, it may be the first to disintegrate. At the same time, leucine dehydrogenase has an octameric structure, so slight changes in the loop region structure may have a significant impact on the catalytic function and stability of the octameric structure. The present invention is based on the analysis of the three-dimensional structure of the protein MsLeuDH and multiple sequence alignment to identify hot spot loop regions that affect the catalytic activity of the enzyme.

[0017] According to the present invention, a leucine dehydrogenase mutant with improved catalytic activity and pH stability is provided based on a strain library. The mutant is obtained by a semi-rational design technique targeting amino acids in the protein loop region. The specific method is as follows:

[0018] Step 1: Establish the three-dimensional structure of MsLeuDH protein and determine the loop regions of the enzyme in Pymol.

[0019] In the second step, MsLeuDH was aligned with the reported leucine dehydrogenases capable of catalyzing the production of L-phenylglycine from benzoylformate (TsLDH from Thauera sp., EsLDH from Exiguobacterium sibiricum, BcAADH from Bacillus clausii, and BcLDH from Bacillus cereus). A small single-point mutant library was constructed based on the conservation of amino acids in each loop region, and the ability of each mutant to catalyze the reductive amination of the substrate benzoylformate to produce L-phenylglycine was analyzed by HPLC.

[0020] In the third step, based on the analysis results from the second step, a hotspot loop region affecting MsLeuDH activity was identified. This sequence was replaced with the corresponding sequence of TsLDH, which has been reported to have the highest substrate catalytic activity. This resulted in the triple-point mutant MsLDH-EER (D332E / G333E / L334R). Using the wild-type leucine dehydrogenase MsLeuDH shown in SEQ ID NO. 1 as a template, the mutant was generated by mutating aspartic acid (D) at position 332 to glutamic acid (E); glycine (G) at position 333 to glutamic acid (E); and leucine (L) at position 334 to arginine (R). The amino acid sequence of this mutant is shown in SEQ ID NO. 2.

[0021] In some embodiments, the enzyme catalysis system further comprises a coenzyme recycling system, wherein the coenzyme recycling system is selected from one of the following systems: 1) a formate dehydrogenase coenzyme recycling system, 2) a glucose dehydrogenase coenzyme recycling system, and 3) an alcohol dehydrogenase coenzyme recycling system. The present invention uses benzoylformate as a substrate and utilizes a coupled reaction between recombinant cells expressing a mutant MsLDH-EER and recombinant cells expressing formate dehydrogenase to synthesize L-phenylglycine.

[0022] According to the present invention, a leucine dehydrogenase mutant, its encoding gene, genetically engineered bacteria, and its use in the preparation of L-phenylglycine have the following beneficial effects:

[0023] 1) Compared with the wild-type MsLeuDH with a conversion rate of 68.0% at 200 mM substrate concentration after 4 h, the triple-point mutant MsLDH-EER provided by the present invention achieved a conversion rate of 99.5% at 3 h, and the product ee value was greater than 99%.

[0024] 2) The results of kinetic parameter determination and enzymatic property characterization of the triple-point mutant MsLDH-EER showed that the catalytic efficiency (kcat / Km) of the triple-point mutant MsLDH-EER was 5.1 times higher than that of the wild type, and its pH adaptability and stability were also improved to a certain extent, indicating that it has a wider application value.

[0025] It should be understood that the capital letters herein represent amino acids as are well known to those skilled in the art, and according to the present invention, they represent the corresponding amino acid residues.

[0026] The experimental methods in the present invention are conventional methods unless otherwise specified. For details of gene cloning operations, please refer to "Molecular Cloning Experiment Guide" edited by J. Sambrook et al.

[0027] Description of some sequences in the sequence listing:

[0028] SEQ ID NO. 1 is the amino acid sequence of leucine dehydrogenase (MsLeuDH) from Marinobacter sp.;

[0029] SEQ ID NO. 2 is the amino acid sequence of the triple-point mutant MsLDH-EER (D332E / G333E / L334R);

[0030] SEQ ID NO.3 is the nucleotide sequence annotated as leucine dehydrogenase (MsLeuDH) from Marinobacter sp.;

[0031] SEQ ID NO.4 is the nucleotide sequence of the triple-point mutant MsLDH-EER (D332E / G333E / L334R);

[0032] SEQ ID NO. 5 is the amino acid sequence of annotated leucine dehydrogenase (TsLeuDH) from Thauera sp.;

[0033] SEQ ID NO.6 is the amino acid sequence of an annotated leucine dehydrogenase (EsLDH) from Exiguobacterium sibiricum;

[0034] SEQ ID NO. 7 is the amino acid sequence of an annotated leucine dehydrogenase (BcAADH) from Bacillus clausii;

[0035] SEQ ID NO. 8 is the amino acid sequence of an annotated leucine dehydrogenase (BcLDH) derived from Bacillus cereus. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The reaction formula for asymmetric synthesis of L-phenylglycine by a formate dehydrogenase coenzyme cycle system provided by the present invention is shown;

[0037] Figure 2 The results of in vitro enzyme activity assays of 23 potential amino acid dehydrogenases constructed in Examples of the present invention are shown;

[0038] Figure 3 Shown are SDS-PAGE protein gel electrophoresis images of wild-type leucine dehydrogenase MsLeuDH and triple-point mutant MsLDH-EER, wherein lanes 1 and 2 are crude protein and purified protein of wild-type MsLeuDH, respectively, and lanes 3 and 4 are crude protein and purified protein of MsLDH-EER, respectively;

[0039] Figure 4 The figure shows the reaction progress curve of the recombinant strain pET28a-PseFDH-EER co-expressing two enzymes to synthesize L-phenylglycine through reductive amination of benzoylformate. DETAILED DESCRIPTION

[0040] The present invention will be further described below with reference to specific examples. It should be understood that the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the techniques used in the examples are conventional operations in the art.

[0041] Materials and methods

[0042] Reagents used in upstream genetic engineering: The genome extraction kit, plasmid extraction kit, DNA purification and recovery kit, and one-step cloning kit used in the examples were all purchased from Novozymes Co., Ltd.; E. coli BL21 (DE3), plasmid pET-28a (+), etc. were collected from the laboratory; protein gel was purchased from Yazyme Co., Ltd.; ClonExpress II OneStep Cloning Kit seamless cloning kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; Dpn I endonuclease was purchased from Thermo Fisher Scientific; primer synthesis and sequencing were completed by Beijing Qingke Biotechnology Co., Ltd. The use of the above reagents is described in the product instructions.

[0043] Benzoylformic acid, a reagent used in the downstream catalytic process, was purchased from Shanghai Dibai Biotechnology Co., Ltd., L-phenylglycine, D-phenylglycine, and ammonium formate were from Shanghai MacLean Biochemical Technology Co., Ltd., and other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0044] In the examples, the reaction progress was monitored by high-performance liquid chromatography (HPLC), and benzoylformic acid was analyzed. The HPLC analysis method was as follows: HPLC 1260 Infinity II (Agilent Technologies, USA), PBR column, column temperature 30°C, flow rate 0.8 mL / min, detection wavelength 210 nm, mobile phase: 5 mM NH₄H₂PO₄. For chiral analysis, the sample was heated at 95°C for 10 minutes for inactivation, centrifuged at 14,000 rpm for 10 minutes, diluted 10-fold with purified water, and filtered through a 0.22 μm aqueous filter. 500 μL of the aliquot was injected into a liquid phase vial for analysis. The high performance liquid chromatograph model was 1260 Infinity II (Agilent Technologies, USA), the analytical column was Sumichiral OA-5000 (L) (4.6 mm ID×150 mm. Agilent / Varian), the UV detection wavelength was 210 nm, the flow rate was 0.8 mL / min, the mobile phase was 2 mM copper sulfate solution: acetonitrile = 99.7:0.3, the retention time of D-phenylglycine was 20 min, and the retention time of L-phenylglycine was 25.3 min.

[0045] Example 1: Construction of genetically engineered bacteria

[0046] The present invention adopts traditional gene mining technology to clone 23 potential L-amino acid dehydrogenase genes. The construction of expression plasmid pET-28a (+) and plasmid transformation of host Escherichia coli E.coli BL21 (DE3) were completed by Beijing Qingke Biotechnology Co., Ltd., and the basic information is shown in Table 1. Using pET-28a (+) as a vector, heterologous induced expression was successfully achieved in E.coli BL21 (DE3). It should be understood that gene sequence synthesis, construction of expression plasmid pET-28a (+) and plasmid transformation of host E. coli E.coli BL21 (DE3) are all conventional technical means in this field. Those skilled in the art can achieve cloning of target genes, construction of expression plasmid pET-28a (+), and plasmid transformation of host E. coli E.coli BL21 (DE3) based on the following gene information and conventional technical means in this field.

[0047] Table 1

[0048] Example 2: Cultivation of engineered bacteria

[0049] Twenty-three genetically engineered recombinant Escherichia coli strains and an engineered formate dehydrogenase from Pseudomonas sp. 101 (PDB ID: 2GUG) were activated by streaking onto plates. Single colonies were then inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured with shaking at 37°C for 10 hours. A 2% inoculum was transferred to 50 mL of LB liquid medium also containing 50 μg / mL kanamycin and cultured with shaking at 37°C until the OD600 reached approximately 0.8. IPTG was then added to a final concentration of 0.1 mM and cultured with shaking at 25°C for 12 hours. Following the incubation period, the culture was centrifuged at 8000 rpm for 10 minutes, the supernatant discarded, and the cells collected and stored in a -80°C freezer until ready for use.

[0050] Example 3: Screening for amino acid dehydrogenases with high substrate benzoylformate catalytic ability

[0051] The crude enzyme solutions of the 23 recombinant AADHs were used for in vitro enzyme activity assays. Since L-amino acid dehydrogenases promote reductive amination while consuming an equal amount of the cofactor NADH, which has an absorbance value at 340 nm, this experiment can indirectly calculate substrate consumption and enzyme activity by monitoring NADH consumption using a microplate reader. The assay results are shown in Figure 2. Figure 2 As shown by Figure 2 It can be seen that AADH-10, the leucine dehydrogenase MsLeuDH from Marinobacter sp., has the highest enzyme activity towards the substrate BFA, so it was selected as the enzyme for subsequent research.

[0052] Example 4: MsLeuDH homology modeling

[0053] The crystal structure of leucine dehydrogenase from Bacillus sphaericus (PDB: 1leh) with a similarity of 47.13% was used as a template to perform online homology modeling of MsLeuDH using the SWISS-MODEL online server

[93] (https: / / swissmodel.expasy.org / ).

[0054] Example 5: Multiple sequence alignment

[0055] MsLeuDH was aligned with amino acid dehydrogenases reported to have BFA catalytic activity. First, the gene sequences from different sources (MsLeuDH, TsLeuDH, EsLDH, BcAADH, BcLDH, LaLDH) were edited and saved in the same TXT document, then converted to fasta format and opened with Mega software. Click Alignment→Align by musle, Data→Export alignment→FASTA Fromat to obtain a .fas file. Open it with Clustal software and save it as a .aln format file. Use the ESPript 3.0 website (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi) to add the aln file and pdb file, and click SUBMIT to obtain a multiple sequence alignment file.

[0056] Example 6: Construction of mutant genetically engineered bacteria

[0057] The whole plasmid PCR technology was used to perform site-directed mutagenesis with the obtained recombinant plasmid pET28a-MsLeuDH as a template to obtain the mutant plasmid pET28a-D332E, and then the mutant plasmid MsLDH-EER (D332E / G333E / L334R) was obtained using the mutant plasmid pET28a-D332E as a template.

[0058] Among them, the primers used for mutant D332E (SEQ ID NO.9-10) are as follows:

[0059] F:CAGCGTAGTGCACGTGAGGGTCTGCCG

[0060] R:CGGCAGACCTCACGTGCACTACGCTG;

[0061] The primers used for MsLDH-EER (SEQ ID NO.11-12) are as follows:

[0062] F:GAAGAAATTTTTCAGCGTAGTGCACGTGAGGAGCGGCCGACAG

[0063] GTCAGAT

[0064] R:ATCTGACCTGTCGGCCGCTCCCTCACGTGCACTACGCTGAAAAAT

[0065] TTCTTC.

[0066] High-fidelity pfu enzyme was used to introduce point mutations by whole-plasmid PCR. The PCR reaction system was: 20 μL, 10 μL 2× pfu enzyme, 1 μL primer F, 1 μL primer R, 1 μL template, and 7 μL ddH2O.

[0067] PCR reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 5 min, 30 cycles; post-extension at 72°C for 5 min; storage at 4°C.

[0068] After the PCR reaction is complete, 3 μL of the reaction solution can be electrophoresed to verify the presence of product bands. Add 1 μL of Dpn I enzyme to the reaction solution containing the correct band to remove the template plasmid, and incubate the reaction in a 37°C water bath for 3 hours. Transform the Dpn I-treated amplified product into E. coli BL21 (DE3) and plate it onto LB solid medium. Incubate at 37°C for 8-10 hours. Pick one transformant from the LB solid medium and inoculate it into LB liquid medium. After incubation at 37°C for 10 hours, extract the plasmid and sequence the plasmid. If the sequence is correct, the plasmid encoding the mutant D332E, MsLDH-EER, is obtained.

[0069] Example 7: Purification of wild-type MsLeuDH and its mutants

[0070] The supernatant of the crude enzyme solution of the wild-type MsLeuDH and its mutants obtained in Example 3 was loaded onto a Ni-NTA column, and the 6x His-tagged protein was bound to the Ni-NTA column at a flow rate of 1 ml / min. The column was then eluted with 20 mM, 50 mM, 100 mM, 250 mM, and 500 mM imidazole at the same flow rate. The purity of the collected protein was checked by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The fraction containing the target protein was collected and dialyzed against 20 mM PB buffer (pH 8.0) for desalting. The enzyme solution was then concentrated, 20% (v / v) glycerol was added, and the solution was stored at -80°C for future use. The results are shown in FIG. Figure 3 shown.

[0071] Example 8: Determination of kinetic parameters of wild-type MsLeuDH and its mutants.

[0072] Using BFA as the substrate, under the premise of a certain concentration of NADH and ammonium ion concentration, the substrate concentration gradient was set to: 0, 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 1, 5, 10, 20 mM, with the substrate concentration as the horizontal axis and the ordinate as the specific enzyme activity. The curve fitting was performed according to the Michaelis-Menten equation, and the fitting equation was: y = (Vmax × x) / (Km + x), and Vmax and k m The experimental results are shown in Table 2.

[0073] Table 2

[0074]

[0075] The results showed that the kcat / Km value of the triple-point mutant MsLDH-EER increased by 1.3 times and 5.1 times compared with the single-point mutant D332E and the wild type, respectively, indicating that the catalytic efficiency of the enzyme was improved. The kinetic parameter measurement results were consistent with the reaction curve of the catalytic synthesis of L-phenylglycine, indicating that the increase in the conversion rate of the mutant may be attributed to the increase in the number of substrate conversions of the enzyme.

[0076] Example 9: Construction of a dual-enzyme co-expression strain based on the optimal triple-point mutant MsLDH-EER for the synthesis of L-phenylglycine.

[0077] The co-expression recombinant strain was constructed by double enzyme digestion and ligation. First, the pET28a-PseFDH plasmid was double-enzyme digested to obtain the linearized pET28a-PseFDH gene. The pET28a-MsLDH-EER was amplified using PCR to obtain the MsLDH-EER fragment with the target restriction site. The MsLDH-EER gene was then double-enzyme digested to obtain the same sticky ends as the linearized pET28a-PseFDH, and then ligated overnight with T4 ligase. The recombinant plasmid pET28a-PseFDH-EER in which formate dehydrogenase pET28a-PseFDH and leucine dehydrogenase MsLDH-EER were expressed in tandem was obtained. The plasmid was transformed into Escherichia coli BL21 (DE3) competent cells to obtain a recombinant strain co-expressing pET28a-PseFDH-EER. The primers used (SEQ ID NO.13-14) are as follows:

[0078] F:ATAAGAATGCGGCCGCAAGGAGATATACCATGACCGTTTTC

[0079] R:CCGCTCGAGTTAACGTGGAATATGACGAAAACGTTC.

[0080] Example 10: Synthesis of L-phenylglycine by a co-expression strain of formate dehydrogenase and the triple-point mutant of leucine dehydrogenase MsLDH-EER

[0081] The co-expression strain was cultured according to the method of Example 2, and the bacterial cells were collected by centrifugation and vacuum-freeze-dried.

[0082] The 5 mL reaction system includes: 15 g / L lyophilized cells of the co-expression strain, 250 or 300 mM BFA, 3 times the substrate concentration of ammonium formate, pH 9.0, 0.1 mM NAD + The reaction was carried out in a shaker at 30°C and 250 rpm. Samples were taken at regular intervals and the BFA concentration was measured by HPLC after the samples were diluted to a certain concentration to determine the conversion rate (conversion rate = BFA concentration during the process / initial BFA concentration × 100%). The results are as follows: Figure 4 shown.

[0083] The results showed that the conversion rate of 250 mM substrate reached 99.0% in 2 h. When the substrate concentration was increased to 300 mM, the conversion rate reached 98.7% in 4 h.

[0084] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Various modifications are possible. Any simple, equivalent changes and modifications made in accordance with the claims and description of the present invention are within the scope of protection of the patent claims. Anything not fully described in this invention is conventional technology.

Claims

1. An active enhanced leucine dehydrogenase mutant, characterized in that, The leucine dehydrogenase mutant is: using the wild-type leucine dehydrogenase MsLDH shown in SEQ ID NO.1 as a template, the aspartic acid D at the 332nd position is mutated to glutamic acid E, the glycine G at the 333rd position is mutated to glutamic acid E, and the leucine L at the 334th position is mutated to arginine R to obtain the mutant MsLDH-EER, and its amino acid sequence is shown in SEQ ID NO.

2.

2. The leucine dehydrogenase mutant with improved activity according to claim 1, characterized in that, The wild-type leucine dehydrogenase MsLDH is derived from Marinobacter sp.

3. A coding gene encoding the leucine dehydrogenase mutant with improved activity according to claim 1.

4. A recombinant vector containing the coding gene according to claim 3.

5. A genetically engineered bacterium containing the coding gene according to claim 3.

6. The genetically engineered bacterium according to claim 5, characterized in that, The host bacterium is Escherichia coli BL21(DE3).

7. An application of the leucine dehydrogenase mutant according to claim 1 in catalyzing the preparation of L-phenylglycine from benzoylformic acid.

8. The application according to claim 7, wherein The application includes: carrying out a reduction reaction on benzoylformic acid in the presence of an enzyme catalytic system to generate L-phenylglycine, and the enzyme catalytic system includes the leucine dehydrogenase mutant according to claim 1 for converting benzoylformic acid into L-phenylglycine.

Images