Use of circulating plasma mir26b-3p as a biomarker in the diagnosis of abdominal aortic aneurysm

Abstract

The application provides use of circulating plasma miR26b-3p as a biomarker in preparation of a kit for diagnosing abdominal aortic aneurysm. The application also provides use of a reagent for detecting circulating plasma miR26b-3p in preparation of a kit for diagnosing abdominal aortic aneurysm. The application also provides use of a miR26b-3p activator agomir in preparation of a medicine for treating abdominal aortic aneurysm. The application also provides use of miR26b-3p as a drug target in screening of a medicine for treating abdominal aortic aneurysm. Overexpression of miR26b-3p can effectively inhibit formation and rupture of abdominal aortic aneurysm. The application finds through experiments that miR26b-3p is significantly down-regulated in abdominal aortic aneurysm tissues and plasma, and circulating miR26b-3p in blood has good detection and diagnosis value.

Description

Technical field:

[0001] The present invention belongs to the field of medical detection and relates to a plasma small RNA miR26b-3p, specifically to the use of circulating plasma miR26b-3p as a biomarker for abdominal aortic aneurysm. Background technology:

[0002] Abdominal aortic aneurysm (AAA) is not a "tumor" in the usual sense, but rather an enlarged "balloon" that bulges out locally in the blood vessel. With the depletion of adventitial collagen and the impact of blood pressure, the abdominal aortic wall expands or bulges. When the maximum diameter reaches or exceeds 1.5 times the original diameter, it is called an "abdominal aortic aneurysm". Abdominal aortic aneurysm has a high risk of rupture. Once ruptured, massive bleeding in the abdominal cavity and hypovolemic shock will occur. In severe cases, death will occur rapidly within a few hours. Moreover, the large amount of rapid bleeding places extremely high demands on surgery and anesthesia. Even with active surgery, the cure rate is not high. Therefore, preventing the occurrence of abdominal aortic aneurysm, promptly detecting the lesion and controlling its rupture and bleeding are key steps in saving lives. Currently, there is little research on the pathogenesis of the disease, and there is a lack of targeted drugs that effectively prevent or treat the disease. The present invention is based on the perspective of epigenetics, studies the key genes and signaling pathways of abdominal aortic aneurysm, and provides a scientific basis for the future design and development of effective targeted drugs.

[0003] Diagnosis of abdominal aortic aneurysm includes the following:

[0004] 1.1 Vascular Ultrasound

[0005] Abdominal ultrasound examinations for abdominal aortic aneurysms (AAAs) are 100% accurate. Vascular ultrasound avoids ionizing radiation, is painless, non-invasive, and relatively inexpensive. It can image the aneurysm both transversely and longitudinally, and can also provide detailed information on the aneurysm wall structure, including the presence of atherosclerotic plaques and mural thrombi. Its ease of use makes it the preferred method for diagnosing AAAs.

[0006] 1.2 CT examination

[0007] CT scans can detect the degree of expansion of abdominal aortic aneurysms, measure the diameter of the aneurysm, and display the calcification of the arterial wall. CT can also show the involvement of the abdominal aortic branches and the presence of para-aortic complications, making it one of the best methods for diagnosing aortic aneurysms. It is also useful for ruling out other abdominal diseases, clarifying the relationship between the aneurysm and surrounding organs, and determining whether the aneurysm has ruptured. CT has a high resolution and can accurately measure the diameter of the aneurysm, the number and location of mural thrombi, and the presence of dissection. It can also reveal the condition of the various branches of the abdominal aorta, providing sufficient imaging evidence for the selection of surgical procedures.

[0008] 1.3MRI examination

[0009] MRI is a non-invasive examination that can produce coronal, sagittal, and transverse cross-sectional images, as well as three-dimensional images. It does not require contrast agents, yet boasts high resolution, accurately distinguishing arteries and veins between internal organs and other surrounding tissues. It can also accurately measure tumor diameter. It is particularly advantageous in determining renal artery involvement. In over 90% of patients, the renal arteries can be clearly imaged. However, its limitations are the cost of the equipment, the length of the examination, and the sensitivity of the imaging to changes in respiration, pulse, and body position.

[0010] Biomarkers for abdominal aortic aneurysm:

[0011] Abdominal aortic aneurysms (AAAs) can continue to grow and even rupture if left untreated. Many biomarkers have been discovered, but there is no universally recognized marker for AAA. The aim of this study was to identify new biomarkers that can predict AAA growth and rupture.

[0012] Dynamic monitoring strategies, such as ultrasound, are based on tumor size. Small AAAs are difficult to effectively assess given their complex biological behavior. Therefore, the detection of small AAAs still requires effective biological detection methods—biomarkers—to accurately predict the progression and rupture of small AAAs.

[0013] Traditional biomarkers include C-reactive protein, homocysteine, D-dimer, and fibrinogen. Potential biomarkers reported in the literature include matrix-regulated proteases and their inhibitors, elastin, collagen, matrix-degrading metalloproteinases, cystatin C, and methylenetetrahydrofolate reductase. MicroRNAs (microRNAs) are recently discovered regulators of gene expression. Their regulatory roles in transcription and stability in plasma have earned them the status of biomarkers. MiR181a, miR146a, and miR21 have all been reported in the aneurysm vessel wall and are potential new targets for the diagnosis of abdominal aortic aneurysms.

[0014] miR-26b is a widely studied miRNA, widely involved in regulating multiple cellular processes, including cell proliferation, apoptosis, differentiation, migration, and autophagy. Its abnormal expression is closely associated with the development and progression of various diseases, including cancer, diabetes, hypertension, and coronary heart disease. The two arms of the miR-26b precursor each produce a functional mature miRNA, each targeting a different site. These miRNAs are generally designated "-5p" and "-3p," respectively, such as miR-26b-5p and miR-26b-3p, indicating that they are processed from the 5' and 3' arms of the miR-26b precursor, respectively. Studies on miR-26b-3p are limited, and no studies have yet been conducted on its use in the prediction and diagnosis of abdominal aortic aneurysms. (The sequence of miR-26b-3p is: ccuguucuccauuacuuggcuc (shown in SEQ ID NO. 1). Summary of the invention:

[0015] In response to the above-mentioned technical problems in the prior art, the present invention provides the use of circulating plasma miR26b-3p as a biomarker for abdominal aortic aneurysm. The use of circulating plasma miR26b-3p as a biomarker for abdominal aortic aneurysm is intended to solve the technical problem of the prior art in that small abdominal aortic aneurysms are difficult to detect.

[0016] The present invention provides use of circulating plasma miR26b-3p as a biomarker in preparing a kit for diagnosing abdominal aortic aneurysm. The sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC.

[0017] The present invention also provides use of a reagent for detecting circulating plasma miR26b-3p in preparing a kit for diagnosing abdominal aortic aneurysm. The sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC.

[0018] Furthermore, the diagnosis comprises: detecting the level of circulating plasma miR26b-3p in a sample from the patient.

[0019] The present invention also provides the use of miR26b-3p activator agomir in the preparation of a drug for treating abdominal aortic aneurysm

[0020] The present invention also provides the use of miR26b-3p as a drug target in screening drugs for treating abdominal aortic aneurysms. The sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC. Overexpression of miR26b-3p can effectively inhibit the formation and rupture of abdominal aortic aneurysms.

[0021] The present invention also provides the use of an agent that activates miR26b-3p expression in the preparation of a drug for inhibiting abdominal aortic aneurysms. Overexpression of miR26b-3p using agomir can effectively inhibit the occurrence and development of angiotensin-induced abdominal aortic aneurysms, reduce vascular rupture, and reduce mortality.

[0022] The present invention provides the use of miR26b-3p as a biomarker for diagnosing abdominal aortic aneurysms. Experiments have shown that miR26b-3p is significantly downregulated in abdominal aortic aneurysm tissue and plasma. Circulating miR26b-3p in the blood has excellent detection and diagnostic value. Currently, abdominal aortic aneurysms require ultrasound or CT scans, which are expensive and time-consuming. The biomarker provided by the present invention is stable and highly expressed in plasma, making it relatively easy to detect. Changes in miR26b-3p expression indicate the development and progression of the disease, and therefore has significant economic significance for the diagnosis of abdominal aortic aneurysms.

[0023] Compared to existing technologies, the present invention offers significant and positive technical benefits. It provides a convenient blood test for miRNA, allowing for easy and minimally invasive collection of miRNA in body fluids. This method has the potential to serve as a biomarker for abdominal aortic aneurysm (AAA), suitable for early screening and rupture prediction. Given the current lack of cost-effective, efficient, and non-invasive biomarkers for predicting AAA, the use of circulating miRNAs could help address this challenge. Description of the drawings:

[0024] Figure 1 It was shown that the expression of miR26b-3p was significantly decreased in the AngII-induced abdominal aortic aneurysm mouse model and in the plasma of patients.

[0025] Figure 2 The value of miR26b-3p as a diagnostic test for AAA was evaluated using the receiver operating characteristic curve (ROC curve).

[0026] Figure 3 The results show that the miR26b-3p activator agomir (catalog number: HY-R02857A, website: https: / / www.medchemexpress.cn ; MedChemexpress Biotech, Inc., USA) to intervene in the formation of abdominal aortic aneurysms. Agomir is a specially chemically modified miRNA mimic. The mature miRNA chain is methoxylated throughout, with two and four thiolate backbone modifications at the 5' and 3' ends, respectively, and a high-affinity cholesterol linker at the 3' end. miRNA agomir can mimic endogenous miRNAs and upregulate miRNA activity. Specific implementation method:

[0027] Example 1. Establishment of mouse abdominal aortic aneurysm model and drug treatment

[0028] 1.1 Preparation of Ang II micropump:

[0029] Osmotic minipumps (Model 2004, volume 200 μL, dosing rate 0.25 μL / h, total dosing duration 28 days) were used. The total amount of AngII required for each group of mice was calculated at 1000 ng / kg / min, dissolved in saline solution, and filled with the micropump. Only saline solution was injected into the micropump of the control group.

[0030] 1.2 Micropump implantation surgery:

[0031] 8-10 week old mice were anesthetized by continuous inhalation of 2% isoflurane (ventilation rate 2L / min) through an anesthesia machine. After removing the hair on the back of the mouse with a small animal razor, the surgical area on the back was cleaned and disinfected with alcohol and covered with sterile towels. A 1 cm long incision was made on the skin on one side of the back, and the back skin and subcutaneous tissue were bluntly separated. After the prepared micropump was implanted subcutaneously, the skin incision was sutured. The anesthesia machine was turned off and the mouse was placed on a constant temperature heating blanket until it woke up from anesthesia. The operation lasted about 10 minutes.

[0032] Example 2. Ultrasound evaluation of the aorta in small animals

[0033] Mice were anesthetized with 2% isoflurane inhalation and positioned supine on a heated ultrasound table. Depilatory cream was used to remove hair from the chest and abdomen, and ultrasound coupling gel was applied. A VisualSonics VeVo 770 ultrasound system with a 30 MHz high-frequency probe was used to examine the inferior vena cava, abdominal aorta, and its branches. The transverse diameter of the abdominal aorta was examined below the renal arteries and above the iliac artery branches. Three measurements were taken at the maximum point, and the data were recorded. Instrument parameters were identical for all groups of mice, and the same person performed image acquisition and calculations. Vital signs and heart rate of the mice were carefully observed during the measurements.

[0034] Example 3. Magnetic resonance evaluation of the aorta in small animals

[0035] Mice were anesthetized with 2% isoflurane and secured in a prone position on a heated MRI table. A Bruker MRI system was used to examine the course of the abdominal aorta and its branches. Instrument settings were identical for all groups of mice, and the same person performed image acquisition and calculations. Vital signs and heart rate of the mice were carefully observed during the measurements.

[0036] Example 4. Mouse aorta collection

[0037] 4.1 Mouse tissue sampling mainly requires the preparation of the following materials

[0038] To ensure tissue freshness, prepare an ice plate and pre-cool autoclaved saline at 4°C. To ensure tissue sterility, sterilize experimental instruments such as surgical scissors, forceps, hemostats, 15mL centrifuge tubes, and cotton wool. Also, prepare a peristaltic pump, perfusion needle, and fixation plate for perfusion, and sterilize their surfaces with 75% alcohol. For mouse tissue sampling, anesthetize the mouse with the inhalation anesthetic isoflurane. The specific steps are as follows:

[0039] Place absorbent paper in a closed transparent container that is approximately 20 cm long, 15 cm wide, and 6 cm high. Use a syringe to inject approximately 0.3 mL of isoflurane onto the absorbent paper, quickly place the mouse in, and cover the lid tightly to prevent isoflurane from evaporating. Observe the mouse's breathing through the transparent container. The mouse's respiratory rate will change from normal to rapid, and then to slow. At this time, it can be considered that the mouse has entered a deep anesthesia period. Take a piece of absorbent cotton and make a small ball. The size should just pass through a 15 mL centrifuge tube. Stuff the absorbent cotton into the 15 mL centrifuge tube and drip 0.5 mL of isoflurane on it for continuous anesthesia. Place the anesthetized mouse on a mouse fixation board and fix its limbs with needles. Cover the mouse's mouth and nose with a 15 mL centrifuge tube filled with a cotton ball soaked in isoflurane to ensure that the mouse remains anesthetized during the perfusion process.

[0040] 4.2 Mouse aorta collection

[0041] Cut open the skin and sternum, separate all thoracic and abdominal organs except the cardiovascular system and kidneys, separate the entire mouse aorta under a microscope, place it in a culture dish filled with pre-cooled PBS, use microtweezers to squeeze out the remaining blood in the blood vessel, and wash it in two other culture dishes filled with clean PBS. Finally, place it in a tissue freezing tube, quickly freeze it with liquid nitrogen, and store it in a -80 refrigerator.

[0042] Example 5 Blood collection and treatment of mice (eye removal and blood collection)

[0043] Grab the mouse's neck skin with your left hand and gently press it on the experimental table. Put the mouse in a lateral position and use your left index finger to press the skin around the mouse's eyes to the back of the neck as much as possible to make the eyeball protrude. Use ophthalmic curved forceps to quickly remove the eyeball, turn the mouse upside down, and use a container to catch the flowing blood. Immediately apply pressure with gauze to stop bleeding after blood collection. The amount of blood collected each time is 0.6-0.1 ml. Use a dried heparin tube or a heparin anticoagulant tube with a small amount of liquid to thoroughly mix the whole blood and anticoagulant. After centrifugation at 3000 rpm for 10 minutes, the supernatant obtained is the plasma sample, which can be stored at -20°C or -80°C.

[0044] Example 6 RT-qPCR detection of miR26b-3p expression

[0045] The first step is RNA extraction

[0046] After removing the tissue from liquid nitrogen, quickly transfer it to a clean bench, place it in a small dish, add Trizol reagent (100 mg of tissue in 1.2 ml of Trizol reagent), and quickly grind it using a tissue grinder. Centrifuge at 12,000 rpm at 4°C for 5 minutes and discard the precipitate. (Prepare EP tubes on the clean bench. After centrifugation, transfer the supernatant to the prepared EP tubes.) Add chloroform at a ratio of 200 μl of chloroform / ml Trizol, shake vigorously for 15 seconds (hand shaking is sufficient). Incubate at 15-30°C for 2-3 minutes. Centrifuge at 12,000 rpm at 4°C for 15 minutes. Aspirate the upper aqueous phase and transfer it to another centrifuge tube. Add isopropanol at a ratio of 500 μl of isopropanol / ml Trizol, shake briefly by hand, and incubate at 15-30°C (room temperature is sufficient) for 10 minutes. Centrifuge at 12,000 g at 2-8°C for 10 minutes. Discard the supernatant and let the RNA settle to the bottom of the tube. Add 75% ethanol at a rate of 1 ml 75% ethanol / ml Trizol, vortex to mix, and resuspend the precipitate. (Note: 75% ethanol is prepared with DEPC water)

[0047] Centrifuge at 7500 rpm at 4°C for 5 minutes, discard the supernatant as much as possible, and air-dry at room temperature or vacuum-dry for 5-10 minutes. Dissolve the RNA precipitate in 30 μl of DEPC water and incubate at 60°C for 20 minutes. Measure the OD value to quantify the RNA concentration. Plasma miRNA was extracted using the QIAGEN Serum / Plasma miRNA Extraction Kit (217204).

[0048] Step 2: Mix preparation

[0049] Generally, real-time qPCR MasterMix is ​​prepared in a 2x concentrate, requiring only template and primers. Due to the high sensitivity of real-time qPCR, at least three replicate wells should be prepared for each sample to prevent statistical analysis from being interrupted due to large Ct differences or SDs during subsequent data analysis. Generally, the final primer concentration in the reaction system is 100-400 mM. For total RNA, the template is typically 10-500 ng, while for cDNA, 1 μl or a 10-fold dilution of 1 μl is typically used. Adjust the concentration based on the expression abundance of the target gene. SYBR Green is an intercalating dye that binds between DNA bases. Upon binding to dsDNA, the fluorescence intensity increases approximately 100-fold, enabling detection of the amplified product during PCR. To achieve accurate and reproducible miRNA quantification using real-time PCR, the amount of the miRNA being measured must be normalized using an appropriate endogenous reference miRNA. This method is known as relative quantification. Normalization can avoid inaccurate quantitative results and enable direct comparison of test results between different experiments and different samples.

[0050] Step 3: Optimized PCR reaction program:

[0051]

[0052] Validated PCR primers:

[0053] miR-26b-3p(mouse):

[0054] F: gtcgtatccagtgcagggtccgaggtattcgcactggatacgacgagcca (shown in SEQ ID NO. 2);

[0055] R: cgcgcctgttctccattact (shown in SEQ ID NO. 3);

[0056] miR-26b-3p(human):

[0057] F: gtcgtatccagtgcagggtccgaggtattcgcactggatacgacagccaa (shown in SEQ ID NO. 4);

[0058] R: cgcgcctgttctccattac (shown in SEQ ID NO. 5).

[0059] like Figure 1The results showed that miR26b-3p was significantly downregulated in mouse abdominal aortic aneurysm tissue and patient plasma. Figure 1 Analyze the data, such as Figure 2 The value of miR26b-3p as a diagnostic test for AAA was evaluated using the receiver operating characteristic curve (ROC curve). The closer the area under the ROC curve is to 1 and the closer it is to the (0, 1) point, the better the authenticity of the diagnostic test.

[0060] Example 7 Agomir intervention via tail vein injection

[0061] This experiment was divided into two groups: ApoE - / - +AngII+agomir-NC (control group) and ApoE - / - +AngII+agomir-miR26b-3p (experimental group)

[0062] First, AngII-induced ApoE - / - Mice were modeled and administered via the tail vein. Both the control and experimental groups received the drug simultaneously at a dose of 10 nmol per mouse. This was continued weekly until modeling was complete on day 28. Ultrasound and MRI imaging tests were performed, and specimens were dissected to determine tumor formation rate and diameter. Tumors with good morphology were selected for pathological section staining (HE, EVG, and Masson staining). The effects of agomir on the formation and progression of abdominal aortic aneurysms were evaluated by assessing tumor size, formation rate, degree of elastic fiber disruption, and collagen deposition.

[0063] like Figure 1 As shown, an abdominal aortic aneurysm model was established using a subcutaneous AngII pump and high-fat diet. A control group received saline treatment and a high-fat diet. After 28 days of modeling, miR26b-3p expression was measured in mouse aortic tissue (A) and patient plasma (B). Results showed that miR26b-3p expression was significantly reduced in both abdominal aortic aneurysm mouse tissue and patient plasma.

[0064] like Figure 3 As shown, starting from the first week of pump implantation, 10 nmol of agomir was injected into the tail vein to overexpress miR26b-3p, with weekly injections to ensure the overexpression effect. The results showed that the agomir-injected model group had a significantly reduced aneurysm diameter compared to the agomir-controlled group, indicating that overexpression of miR26b-3p can effectively inhibit the formation and rupture of abdominal aortic aneurysms and may serve as a drug target for clinical prevention and treatment.

Claims

1. Use of a reagent for detecting circulating plasma miR-26b-3p in the preparation of a kit for diagnosing abdominal aortic aneurysm, wherein the sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC.

2. The use according to claim 1, characterized in that The diagnosis comprises detecting the level of circulating plasma miR-26b-3p in a sample from the patient.

3. Use of the miR-26b-3p activator agomir in the preparation of drugs for treating abdominal aortic aneurysm.

4. The use of miR-26b-3p as a drug target in screening drugs for the treatment of abdominal aortic aneurysms. The sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC. Overexpression of miR-26b-3p can effectively inhibit the formation and rupture of abdominal aortic aneurysms.

5. Use of agomir, a reagent for activating miR-26b-3p expression, in the preparation of a drug for inhibiting abdominal aortic aneurysm. The sequence of miR-26b-3p is: CCUGUUCUCCAUUACUUGGCUC.

Images