A long non-coding RNA and its application in preparing drugs for treating liver cancer

Abstract

The present invention discloses a long non-coding RNA and its use in preparing a drug for treating liver cancer, belonging to the field of cell biology. The present invention discloses the use of an inhibitor of a long non-coding RNA in preparing a drug for treating liver cancer, wherein the nucleotide sequence of the long non-coding RNA is shown in SEQ ID NO: 1, and the inhibitor comprises an siRNA having a sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3. The present invention found that LincRNA063480 is highly expressed in patients with liver cancer. By reducing lincRNA063480, the protein expression of hnRNPF can be inhibited, the stability of lactate dehydrogenase mRNA, mRNA transcription and translation, and lactate synthesis can be reduced, and the proliferation ability of liver cancer cells can be inhibited. This indicates that lincRNA063480 is expected to be a new therapeutic target for liver cancer and provide a new strategy for the development of drugs for treating liver cancer.

Description

Technical Field

[0001] The present invention relates to the field of cell biology, and in particular to a long-chain non-coding RNA and its application in preparing a drug for treating liver cancer. Background Art

[0002] Long noncoding RNA (lncRNA) is a class of RNA molecules longer than 200 nucleotides that lack protein-coding capacity. They can bind to proteins and regulate gene transcription, splicing, translation, and stability. However, the biological functions of lncRNAs remain to be further explored, particularly in liver cancer cells. Therefore, identifying novel lncRNAs that regulate hepatocellular carcinoma holds promise for uncovering new therapeutic targets.

[0003] Studies have shown that noncoding RNAs play a wide range of roles in tumor proliferation, migration, invasion, metastasis, energy metabolism, and apoptosis. Cancer cells rely on multiple metabolic sources to fuel their metabolic activities. Under aerobic conditions, normal mammalian cells use glucose as their energy source, which undergoes glycolysis to form pyruvate, which enters the mitochondria and completes the tricarboxylic acid cycle to supply energy. Under hypoxic conditions, most of the pyruvate produced by glycolysis leaves the mitochondria and is converted into lactate by lactate dehydrogenase (LDHA), completing the energy supply. In highly proliferating tumor cells, the continued use of lactate dehydrogenase metabolism for energy even under aerobic conditions is known as "aerobic glycolysis" or the "Warburg effect." Therefore, intervening in the "Warburg effect" of tumors with lncRNAs can influence tumor progression, and the development of new lncRNAs is currently a key goal.

[0004] In summary, finding a novel lncRNA that can inhibit the tumor aerobic glycolysis pathway can provide a new strategy for tumor treatment. Summary of the Invention

[0005] The purpose of the present invention is to provide a long non-coding RNA and its use in the preparation of a drug for treating liver cancer, so as to solve the problems existing in the above-mentioned prior art. The present invention can inhibit the lactate synthesis and proliferation ability of liver cancer cells by reducing lincRNA063480, indicating that lincRNA063480 is expected to be a new therapeutic target for liver cancer, providing a new strategy for the development of drugs for treating liver cancer.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of an inhibitor of a long-chain non-coding RNA in the preparation of a drug for treating liver cancer. The nucleotide sequence of the long-chain non-coding RNA is shown in SEQ ID NO: 1.

[0008] Furthermore, the inhibitor comprises siRNA that inhibits the expression of the long non-coding RNA.

[0009] Furthermore, the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0010] Furthermore, the siRNA knocks down the expression level of the long non-coding RNA, inhibits lactic acid synthesis and proliferation activity of liver cancer cells, and exerts a therapeutic effect.

[0011] Furthermore, the siRNA knocks down the expression level of the long non-coding RNA and reduces the content of the long non-coding RNA binding protein hnRNPF, thereby inhibiting lactic acid synthesis in liver cancer cells.

[0012] The present invention also provides a use of a lentiviral recombinant vector in the preparation of a drug for treating liver cancer, wherein the lentiviral recombinant vector comprises a nucleotide sequence as shown in SEQ ID NO: 2 or as shown in SEQ ID NO: 3.

[0013] Furthermore, the lentiviral recombinant vector achieves the effect of treating liver cancer by knocking down the expression level of the long non-coding RNA shown in SEQ ID NO: 1.

[0014] The present invention also provides a medicine for treating liver cancer, which contains the siRNA or the lentiviral recombinant vector.

[0015] The present invention discloses the following technical effects:

[0016] The present invention discovered that LincRNA063480 is expressed at high levels in patients with liver cancer. By reducing lincRNA063480, the protein expression of hnRNPF can be inhibited, the stability of lactate dehydrogenase mRNA, mRNA transcription and translation, and lactate synthesis can be reduced, and the proliferation ability of liver cancer cells can be inhibited. Combined with animal experiments, it was further confirmed that knocking down lincRNA063480 in vivo can inhibit liver cancer tumor growth, indicating that lincRNA063480 is expected to be a new therapeutic target for liver cancer and provide a new strategy for the development of drugs to treat liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Characterization of lincRNA063480 pulled down by CLIP-seq; A: Classification and quantity of RNA pulled down by CLIP-seq; B: Abundance of lincRNA063480 in each group after CLIP pull-down; C: RNA secondary structure of lincRNA063480; D: Chromosomal localization of lincRNA063480; E: Multi-species homology analysis of lincRNA063480; F, G: TCGA database analysis of lincRNA expression and survival analysis in liver cancer patients; H: Localization of lincRNA063480 in HepG2 cells;

[0019] Figure 2 Knockdown of lincRNA063480 inhibits the proliferation of HepG2 cells; A: CCK8 assay detects the ability of knockdown of lincRNA063480 to inhibit cell proliferation; B: Flow cytometry assay detects the effect of knockdown of lincRNA063480 on cell cycle progression; C, D: Plate cloning assay detects the ability of knockdown of lincRNA063480 to inhibit cell clone formation; E: EdU staining assay detects the effect of knockdown of lincRNA063480 on cell cycle replication ratio; F, G: RT-qPCR and Western blot assays detect the effect of knockdown of lincRNA063480 on mRNA and protein expression of cell cycle-related genes;

[0020] Figure 3 Figure 1: lincRNA063480 combined with hnRNPF regulates lactate metabolism in HepG2 cells; A: CLIP pulls down the abundance of corresponding LDHA in each group; B, C: lincRNA063480 and hnRNPF affect the mRNA and protein expression of LDHA; D, E: Knockdown of lincRNA063480 or hnRNPF inhibits LDHA enzyme activity and lactate synthesis; F: Knockdown of lincRNA063480 reduces the mRNA stability of hnRNPF; G, H: Knockdown of lincRNA063480 reduces the protein expression level of hnRNPF in the cytoplasm;

[0021] Figure 4 Knockdown of lincRNA063480 inhibited the growth of subcutaneous tumors in nude mice; A: Subcutaneous tumor growth volume change curve; B: Subcutaneous tumor fluorescence signal imaging; C: Gross image of subcutaneous tumor after peeling; D: Subcutaneous tumor weight statistics. DETAILED DESCRIPTION

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0027] The present invention uses a method of ultraviolet cross-linking immunoprecipitation combined with high-throughput sequencing to perform a pull-down experiment in HepG2 liver cancer cells using heterogeneous nuclear ribonucleoprotein F (hnRNPF) antibodies. The RNA molecule lincRNA063480 that binds to hnRNPF was discovered, and the bioinformatics characteristics of lincRNA063480 were analyzed. It was found that knocking down lincRNA063480 inhibited tumor cell proliferation. Furthermore, through bioinformatics, immunofluorescence, nuclear cytoplasm separation and other methods, it was revealed that knocking down lincRNA binding to hnRNPF inhibited the energy supply and proliferation ability of tumor cells by reducing lactate energy metabolism, namely the "Warburg effect". The specific research is as follows:

[0028] Example 1

[0029] 1. UV cross-linking immunoprecipitation combined with high-throughput sequencing

[0030] 1.1 Cell culture and cross-linking

[0031] (1) Culture cells in 6-8 culture dishes with a diameter of 15 cm. When the cell density reaches about 80%, discard the old culture medium.

[0032] (2) 16 h before UV cross-linking, 4-thiouracil was added to the cell culture medium to a final concentration of 100 μM.

[0033] (3) After 16 h of culture, discard the culture medium, wash once with 5 mL / dish of pre-cooled PBS, and discard the PBS.

[0034] (4) Place the cells on ice and place them in a UV crosslinker with a wavelength of 365 nm. The irradiation dose is set to 0.15 J / cm 2 , cross-linking time 10min.

[0035] (5) Add 5 mL of pre-chilled PBS to the culture dish, scrape the cells with a cell scraper, transfer them to a 50 mL enzyme-free centrifuge tube, centrifuge at 4°C and 500 g for 5 min, and remove the supernatant.

[0036] 1.2 Cell lysis and immunoprecipitation

[0037] (1) Add 12 mL of 1× Cell lysis buffer, 120 μL of 100× DTT, and 120 μL of 100× Protease inhibitor to the cross-linked cells and lyse on ice for 10 min, vortexing 2-3 times.

[0038] (2) Centrifuge the cell lysate at 13,000 g for 15 min at 4°C, collect the supernatant, and discard the precipitate.

[0039] (3) Take 200 μL of the supernatant as the input group and store it at -80°C. Take 6 mL and transfer it to a new 15 mL enzyme-free tube as the IgG group. Take 6 mL as the IP group.

[0040] (4) 5-10 μg of hnRNPF antibody was added to the IP group, and an equal volume of IgG antibody was added to the IgG group. The cells were incubated overnight at 4°C on a vertical mixer.

[0041] 1.3 Magnetic Bead Preparation and Incubation

[0042] (1) Take 40 μL of Protein A / G Beads from each IP and IgG group and transfer them to a 1.5 mL enzyme-free EP tube. Add 1 mL of Cell lysis buffer to each of the IP and IgG group magnetic beads, pipette to mix thoroughly, and place on a magnetic stand for 15-20 seconds. Discard the supernatant and repeat the washing of the magnetic beads once.

[0043] (2) Add 40 μL of Cell lysis buffer to resuspend the magnetic beads in the IP and IgG groups respectively.

[0044] (3) Add the magnetic beads to the corresponding antibody-cell lysate mixture and incubate with rotation at 4°C for 3 h.

[0045] (4) Place the incubated centrifuge tube on a magnetic rack, adsorb for 20-30 seconds, and discard the supernatant.

[0046] (5) Add 1 mL of IP wash buffer, mix thoroughly by inverting 10 times, transfer the magnetic beads to a 1.5 mL centrifuge tube, place on a magnetic stand, adsorb for 30 seconds, and discard the supernatant.

[0047] (6) Repeat washing twice.

[0048] 1.4 RNase T1 digestion

[0049] (1) Add 60 μL of IP wash buffer and 6 μL of RNase T1 to each of the IP and IgG groups.

[0050] (2) Place in a 22°C water bath for 15 minutes, then immediately place in an ice bath for 5 minutes.

[0051] (3) Adsorb the beads on the magnetic stand for 20 seconds, discard the supernatant, add 200 μL of IP wash buffer and wash three times. Adsorb on the magnetic stand for 20 seconds and discard the supernatant.

[0052] (4) Add 50 μL of Cell lysis buffer to the IP and IgG groups respectively.

[0053] 1.5DNase I digestion

[0054] (1) Adsorb on a magnetic rack for 30 seconds and discard the supernatant.

[0055] (2) Add 100 μL of IP wash buffer and DNase I to each of the IP and IgG groups.

[0056] (3) Place in a 37°C water bath for 15 minutes, then immediately place in an ice bath for 5 minutes.

[0057] (4) Adsorb on the magnetic stand for 20 seconds, discard the supernatant, add 200 μL of IP wash buffer to wash the magnetic beads three times, adsorb on the magnetic stand, and remove the supernatant.

[0058] (5) Add 100 μL of Cell lysis buffer to each of the IP and IgG groups.

[0059] 1.6 Protein digestion and RNA extraction

[0060] (1) 10 μL of Proteinase K was added to the Input group, and 100 μL of Proteinase K buffer and 10 μL of Proteinase K were added to both the IP group and the IgG group.

[0061] (2) Digest at 55°C on a shaker at 250 rpm for 30 min.

[0062] (3) Add 0.8 mL of Trizol to the digested solution, vortex for 15 seconds, add 160 μL of chloroform, vortex for 15 seconds, and place on ice for 5 minutes.

[0063] (4) Centrifuge at 4°C, 12,000 g for 10 min.

[0064] (5) Transfer the supernatant to a new 2 mL enzyme-free EP tube, add 2 volumes of isopropanol, and precipitate at -80°C overnight.

[0065] (6) Centrifuge at 12,000 g for 10 min at 4°C and discard the supernatant.

[0066] (7) Add 1 mL of 75% ethanol (prepared with DEPC water) and wash the precipitate once.

[0067] (8) Centrifuge at 12,000 g for 10 min at 4°C and discard the supernatant.

[0068] (9) After opening the lid, bake in a metal bath at 42°C for 2 min to evaporate all the ethanol.

[0069] (10) Add 20 μL of DEPC water and pipette to mix and dissolve the RNA.

[0070] (11) The samples were transported on dry ice and sent to Shenzhen BGI for lncRNA and mRNA library construction and sequencing.

[0071] 2CLIP-seq data processing and analysis

[0072] (1) Three groups of RNA samples, Input, IgG, and hnRNPF, were submitted for sequencing using the DNBSEQ platform.

[0073] (2) The original sequencing data contained reads of low quality, contaminated library adapters, and reads with too high an unknown base N. The above reads were removed and filtered to obtain clean reads.

[0074] (3) Clean reads were aligned with the reference genome using HISAT.

[0075] (4) The comparison results are the abundance and binding fragment information of mRNA, lncRNA, and CirRNA that bind to hnRNPF protein (see Figure 1 A, B, Figure 3 Middle A).

[0076] The experimental results showed that the IP group hnRNPF pulled down a total of 1,527 RNA molecules, and the alternative lincRNA063480 and LDHA were screened.

[0077] 3LncRNA and mRNA screening and bioinformatics analysis

[0078] (1) By analyzing the expression levels of different transcripts of lncRNA and mRNA in the Input, IgG, and IP groups, candidate lncRNAs and mRNAs and their expression levels were screened. The RNA fragments detected in the clean reads were the specific sequences of RNA fragments that bind to hnRNPF. The detection results showed that lincRNA063480 and LDHA bind to hnRNPF. The full-length sequence of lincRNA063480 is shown in SEQ ID NO: 1:

[0079]

[0080] The RNA fragment sequence of the binding portion of lincRNA063480 and hnRNPF:

[0081] GCGCTCCTTCCTTCTTCCTAGCTTCCTTCACCAAATCGCACTGGCTCCTGGACTCTT TTCCTATCTTCACCACGAACTGCTGCTTGCTCGCTTGC;

[0082] The RNA fragment sequence of the binding portion of LDHA and hnRNPF:

[0083] GTACATTACCATATAATGTAAAAGATCTACATACAAACAATGCAACCAACTATCCA AGTGTTATAACCAACTAAAACCCCCAATAAACCTTGAACAGTGAC.

[0084] (2) LncRNA bioinformatics analysis: The RNA secondary structure was predicted in RNAFold using the minimum free energy as the standard ( Figure 1 C). The lncRNA sequence was measured and compared with the NONCODE human database by Blast to obtain the gene number. The sequence was placed in the UCSC database for comparison to see its genomic location and multi-species sequence conservation ( Figure 1 D, E). Using the CPAT and CPC2 databases, their coding abilities were predicted. The results are shown in Table 1:

[0085] Table 1 Prediction of protein coding ability of lincRNA063480

[0086]

[0087] From the above results, we can know that lincRNA063480, as an intergenic transcribed lincRNA, has multiple stem-loop structures, has highly homologous sequences in multiple species and has low coding ability.

[0088] (3) LncRNA TCGA database analysis: Download the transcriptome expression profiles of LIHC patients and normal subjects from the TCGA database, and perform expression level difference analysis and 5-year survival rate analysis (see Figure 1 (F, G in Chinese).

[0089] The experimental results showed that the expression level of lincRNA063480 was higher in liver cancer patients than in normal people, and the 5-year survival rate of patients with high expression of lincRNA063480 was lower.

[0090] 4 Fluorescence in situ hybridization

[0091] 4.1 Reagent Preparation

[0092] (1) Preparation of prehybridization solution and hybridization solution: Mix the blocking solution and prehybridization buffer at a ratio of 1:99; mix the blocking solution and hybridization solution at a ratio of 1:99, and incubate them at 37°C until transparent and clear before use;

[0093] (2) Prepare permeabilization solution: 0.5% Triton X-100 in PBS;

[0094] 4.2 Cell treatment

[0095] (1) Take out the 24-well plate, put in a sterile cell slide, and add 1×10 4 Cell suspension was placed in an incubator for culture; when the cell density was about 60%-70%, 500 μL 1× PBS was added to each well and washed on a shaker for 5 minutes;

[0096] (2) Add 4% paraformaldehyde, fix at room temperature for 10 min, and wash three times with PBS;

[0097] (3) Use 1 mL of pre-cooled permeabilization solution, incubate at 4°C for 5 min, and then wash three times with PBS.

[0098] 4.3 Loading the probe

[0099] (1) Add 200 μL of preheated, clarified prehybridization solution to each well and block at 37°C for 30 min.

[0100] (2) Protect from light, restore the lncRNA Probe Mix, U6, and 18S internal reference probe storage solutions (20 μM) to room temperature, take 2 μL of each and add them to 150 μL of preheated clarified hybridization solution and mix well;

[0101] (3) Discard the pre-hybridization solution and add 150 μL of hybridization solution containing the probe to each well. Hybridize overnight at 37°C in the dark.

[0102] (4) Discard the hybridization solution and add 500 μL of hybridization wash solution I (4× SSC containing 0.1% Tween-20) to each well at 42°C in the dark, gently shake and wash for 5 min, for a total of three times;

[0103] (5) Add 500 μL of hybridization wash solution II (2×SSC) and 500 μL of hybridization wash solution III (1×SSC) to each well at 42°C in the dark, and wash with gentle shaking for 5 min.

[0104] (6) Wash with PBS three times, then stain the cell nuclei with DAPI and wash with PBS three times.

[0105] 4.4 Sealing and Observation

[0106] (1) Take out a clean glass slide and drop about 10 μL of anti-fluorescence quencher in the center; in the dark, place the cell slide upside down on the glass slide containing the fluorescence quencher and observe under a 40x fluorescence microscope.

[0107] The results showed that lincRNA063480 was distributed in both the nucleus and cytoplasm, with no significant distribution differences (e.g. Figure 1 (shown in H).

[0108] In this experiment, U6 and 18S were used as internal reference RNA in the nucleus and cytoplasm, respectively. The results confirmed that lincRNA063480 was distributed in both the nucleus and cytoplasm, with no significant difference in distribution.

[0109] 5. Cell Culture

[0110] (1) HepG2 cells were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0111] (2) The complete culture medium required for cell culture is DMEM basal medium containing 10% FBS (fetal bovine serum) and 1% PS (100× streptomycin and penicillin).

[0112] (3) Cell culture was carried out in a sterile incubator at 37°C, 5% CO2, and 100% humidity.

[0113] 6RNAi experiments

[0114] (1) Prepare cell suspension according to different well plates. Add appropriate amount of cells to 24-well plate, 12-well plate and 6-well plate respectively. Shake the well plates crosswise to make the cells evenly distributed. Place them in the incubator and continue to culture for 12 hours. Wait for them to adhere to the wall before conducting subsequent interference experiments.

[0115] (2) Prepare the transfection system according to the number of cell wells (see Table 2 below):

[0116] Table 2 Preparation of transfection system

[0117]

[0118] Among them, the siRNA sequences of lincRNA063480 and hnRNPF are:

[0119] si-lincRNA063480-1: CCACGAACTGCTGCTTGCT (SEQ ID NO: 2);

[0120] si-lincRNA063480-2: CCAATCTCTAAGTCTTCA (SEQ ID NO: 3);

[0121] si-hnRNPF-1:AAGCCGACCGAGAACGACAT;

[0122] si-hnRNPF-2:CCAATATGCAGCACAGATA;

[0123] The sequence of the si-NC used as a control is: UUCUCCGAACGUGUCACGUTT.

[0124] (3) Mix by pipetting, centrifuge briefly, and incubate at room temperature for 15 min;

[0125] (4) Remove the plate containing the cells, discard the old culture medium, add the corresponding complete culture medium and transfection system mixture to each well, shake to mix, and place in an incubator for culture.

[0126] 7CCK8 detection of the effect of interfering with lincRNA063480 on cell proliferation

[0127] (1) Following the 6-RNAi experimental steps, HepG2 cells were treated with si-lincRNA063480-1, si-lincRNA063480-2, and si-NC for 48 h until the cell density reached approximately 70%-80%.

[0128] (2) The cells were trypsinized and 2000 cells were taken and added to a 96-well plate and allowed to adhere to the wall;

[0129] (3) Discard the old culture medium, add 100 μL of 10% CCK-8 reagent to each well, and return the cells to the incubator for 2 h;

[0130] (4) The absorbance at 450 nm was measured using a microplate reader at 0 h, 24 h, 48 h, 72 h, and 96 h to reflect the number of viable cells;

[0131] The results showed that the growth of cells in the si-lincRNA063480-1 and si-lincRNA063480-2 groups was inhibited after 24 hours of culture, and the inhibitory effect became more obvious as time went on (e.g. Figure 2 It was confirmed that knockdown of lincRNA063480 significantly reduced the cell growth rate.

[0132] 8. Cell cycle detection

[0133] (1) After treating HepG2 cells according to the 6 RNAi experimental steps for 48 h, discard the old culture medium, wash twice with 1 mL of 1× PBS, add 500 μL of EDTA-free trypsin digestion solution, digest at room temperature for 2 min, transfer the cells to a 1.5 mL EP tube, centrifuge at 2000 rpm at 4°C for 5 min, discard the supernatant, and collect the cell pellet;

[0134] (2) Add 1 mL of pre-chilled PBS, centrifuge at 4°C, 1500 rpm for 5 min, discard the supernatant, wash the cell pellet, and repeat once;

[0135] (3) Add 300 μL of pre-chilled PBS to resuspend the cell pellet, slowly add 700 μL of pre-chilled ethanol, shake the EP tube to prevent the cells from clumping and making it difficult to separate them into single cells, and fix them at 4°C overnight;

[0136] (4) Centrifuge the fixed cells at 4°C, 1500 rpm, for 5 min, and discard the supernatant;

[0137] (5) Add 1 mL of pre-chilled PBS, centrifuge at 4°C, 1500 rpm for 5 min, discard the supernatant, wash the cell pellet, and repeat once;

[0138] (6) Add 500 μL DNA staining solution, vortex for 5-10 seconds to mix, and incubate at room temperature in the dark for 30 minutes;

[0139] (7) Detection was performed on a flow cytometer to analyze cell cycle changes.

[0140] The results showed that knockdown of linRNA063480 inhibited cell growth and arrested the cell cycle at the G0 / G1 phase (e.g. Figure 2 (As shown in B). It was confirmed that after knocking down lincRNA063480, the cells in the interference group were significantly arrested in the G0 / G1 phase, and the proportion of cells entering the S phase for cell replication was reduced.

[0141] 9-plate colony formation assay

[0142] (1) HepG2 cells were treated with si-NC and si groups according to the RNAi experimental steps in step 6 for 48 h, until the cell density reached approximately 70%-80%;

[0143] (2) The cells were trypsinized and 2000 cells were taken from each well and added to a 6-well plate. After culturing in a 37°C, 5% CO2 incubator for 7 days, fresh normal culture medium (10% FBS complete medium) was replaced and cultured for another 7 days until the clones grew to be visible to the naked eye.

[0144] (3) Wash twice with PBS, add 4% paraformaldehyde and fix for 30 min at room temperature, discard the fixative, and then stain with 500 μL crystal violet for 30 min;

[0145] (4) Discard the staining solution, wash away any unbound staining solution with double-distilled water, and dry at room temperature;

[0146] (5) Take photos under a microscope and count the number of monoclonal clones;

[0147] The results showed that the number of monoclonal clones in the si group was significantly reduced, indicating that reducing lincRNA063480 can significantly inhibit the growth of liver cancer cells (such as Figure 2 (as shown in C and D).

[0148] 10EdU

[0149] (1) 48 hours after the RNAi experiment, HepG2 and control cell lines were attached to the surface of the slide in the 24-well plate, and the culture medium was discarded.

[0150] (2) Dilute EdU solution (reagent A) with DMEM complete medium at a ratio of 1000:1 to a final concentration of 50 μM EdU medium. Add 500 μL to each well and incubate for 3 h.

[0151] (3) Discard the culture medium, add 1 mL of PBS to each well, shake gently, and discard the PBS. Repeat this process once.

[0152] (4) Add 500 μL of 4% paraformaldehyde solution to each well and fix at room temperature for 30 minutes.

[0153] (5) Discard the 4% paraformaldehyde solution, add 1 mL of PBS to each well, shake gently, and discard the PBS. Repeat this process once.

[0154] (6) Add 500 μL of 2 mg / mL glycine solution to each well, wash on a decolorizing shaker for 5 min, and discard the glycine solution.

[0155] (7) Add 1 mL of PBS to each well, shake gently, and discard the PBS. Repeat once.

[0156] (8) Add 500 μL of permeabilization agent (0.5% Triton X-100 in PBS) to each well, incubate on a decolorizing shaker for 10 min, and wash with PBS for 5 min.

[0157] (9) Add 500 μL of 1× Apollo staining solution to each well, incubate on a shaker for 30 min at room temperature in the dark, and discard the staining solution.

[0158] (10) Add 500 μL of permeabilization agent and wash on a decolorizing shaker 2-3 times, 10 min each time, and discard the permeabilization agent.

[0159] (11) Dilute the Hoechst 33342 stock solution with ddH2O at a ratio of 100:1 to prepare a 1× reaction solution.

[0160] (12) Add 500 μL of 1× reaction solution to each well and stain for 30 min at room temperature in the dark.

[0161] (13) Discard the reaction solution, add 1 mL of PBS to each well, shake gently, and discard the PBS. Repeat once.

[0162] (14) Add anti-fluorescence quenching agent to the slide and place the cell side facing the slide.

[0163] (15) After adding an appropriate amount of neutral gum around the slide, fix it overnight and then observe it using a laser confocal microscope.

[0164] The experimental results showed that after knocking down lincRNA06348, the proportion of cells in the division and replication phase decreased significantly (e.g. Figure 2 (as shown in E).

[0165] 11RNA extraction and real-time fluorescence quantitative PCR

[0166] 11.1 RNA extraction

[0167] (1) Add 300 μL of Trizol reagent to each well and scrape the cells thoroughly into a 1.5 mL enzyme-free EP tube.

[0168] (2) The precipitate was completely lysed on ice for 5 min, 60 μL of chloroform was added, and the mixture was immediately vortexed for 15 s to mix thoroughly.

[0169] (3) Precipitate on ice again for 5 min, then centrifuge at 4°C, 14,000 rpm for 15 min.

[0170] (4) Pre-cool isopropanol at 4°C and prepare a corresponding number of 1.5 mL enzyme-free EP tubes and label them.

[0171] (5) Use a pipette to transfer 120 μL of the supernatant to the enzyme-free EP tube marked above.

[0172] (6) Add an equal volume of isopropanol to precipitate RNA, mix by inverting the tube several dozen times, and precipitate on ice for 10 minutes.

[0173] (7) Centrifuge at 14,000 rpm for 10 min at 4°C and carefully discard the supernatant.

[0174] (8) Add 75% ethanol (prepared with DEPC water) to wash the precipitate, centrifuge at 14,000 rpm for 5 min at 4°C, repeat the washing twice, carefully discard the supernatant, centrifuge for 1 min, and dry the precipitate at 42°C.

[0175] (9) Add 20 μL DEPC water to dissolve RNA.

[0176] (10) The reverse transcription and qPCR steps refer to the Nanjing Novozymes kit (NO: R223-01) as follows:

[0177] 11.2 Reverse Transcription

[0178] (1) Removal of genomic DNA. See Table 3 for reagents for removal of genomic DNA.

[0179] Table 3 Reagents for removing genomic DNA

[0180]

[0181] After gently pipetting to mix, place the PCR tube into the PCR instrument and set the program to run at 42°C for 2 minutes.

[0182] (2) Prepare the reverse transcription reaction system as shown in Table 4

[0183] Table 4 Reverse transcription reaction system

[0184]

[0185]

[0186] Use a pipette to gently pipette to mix the mixture, then briefly centrifuge the PCR tube at 2000 rpm for 10 seconds, and place it in the PCR instrument to proceed to the next step.

[0187] (3) Reverse transcription reaction conditions are shown in Table 5

[0188] Table 5 Reverse transcription reaction conditions

[0189]

[0190] After the PCR process was completed, the cDNA samples were stored in a -20°C refrigerator.

[0191] 11.3 Real-time quantitative PCR (qRT-PCR)

[0192] Refer to the Nanjing Novozyme kit (NO: Q712-02) and the steps are as follows:

[0193] Table 6 Primer sequences

[0194]

[0195] (1) Preparation of reaction system

[0196] Table 7 Reaction system

[0197]

[0198] Mark the 96-well plate and add 20 μL of the above mixture to each well in sequence. Place the 96-well plate in a centrifuge, level it, and centrifuge briefly to collect the reaction solution.

[0199] (2) PCR reaction (performed on a CFX96 Real-Time PCR System)

[0200] Table 8 PCR reaction program

[0201]

[0202]

[0203] The relative expression level of the gene after the reaction was calculated according to 2 -△△Ct ( △ Ct value = Ct 目的 -Ct 内参 , △△ Ct value = △ Ct 实验组 - △ Ct 对照组 ) were calculated to obtain the relative expression levels of genes, and the β-Actin gene was used as a control gene to detect the mRNA expression levels of cell cycle-related genes in cells.

[0204] The experimental results showed that after knocking down lincRNA063480, the mRNA expression levels of cell cycle-related genes CCND1, CCNE1, CDK2, CDK4, and CDK6 were downregulated to varying degrees (e.g. Figure 2 (as shown in F in the figure).

[0205] 12 Protein immunoblotting experiments

[0206] (1) Discard the old culture medium and add PBS to wash the cells.

[0207] (2) Add 40-100 μL of IP lysis buffer containing 1% PMSF to each well, transfer to a 1.5 mL EP tube, and lyse on ice for 15 min.

[0208] (3) Centrifuge at 14,000 rpm for 7 min at 4°C. The supernatant is the extracted total cell protein. Transfer the supernatant to a new 1.5 mL EP tube and take 2 μL for protein concentration determination by BCA assay.

[0209] (4) Calculate the protein concentration according to the formula Y = bX + a (Y is the absorbance value, X is the protein concentration).

[0210] (5) Use IP lysis buffer and 5× loading buffer, vortex mix, and heat denaturation at 100°C for 5-7 minutes.

[0211] (6) Prepare a 10%-12% SDS-PAGE gel, load an appropriate volume of sample and marker into each well, then add electrophoresis buffer and perform electrophoresis.

[0212] (7) Cut the PVDF membrane, activate it in methanol, cut out the desired gel block and transfer it to the membrane in an ice bath.

[0213] (8) The PVDF membrane was placed in 5% skim milk and blocked at room temperature for 2 h. It was then placed in 1×TBST and rinsed three times for 3 min each time.

[0214] (9) Cut the band of the target protein molecular weight from the PVDF membrane, place it in the corresponding antibody, and incubate it on a shaker at 4°C overnight.

[0215] (10) Remove the strips that have been incubated overnight, place them in 1×TBST, and rinse three times.

[0216] (11) Place the strips in the corresponding secondary antibody according to the source of the primary antibody and incubate slowly at room temperature on a shaker for 60 minutes.

[0217] (12) Remove the bands from the secondary antibody and wash them three times with 1×TBST.

[0218] (13) Pipette ECL developer solution A and solution B in a ratio of 1:1, mix well, and add color developing solution for exposure.

[0219] The experimental results showed that after knocking down lincRNA063480, the protein expression levels of cell cycle-related genes Rb, p-Rb (S780), CDK2, and CDK6 were all decreased (e.g. Figure 2 (shown as G in the figure).

[0220] 13 Lactate dehydrogenase activity assay

[0221] (1) After 48 h of RNAi experiment (si-lincRNA063480 or si-hnRNPF) in 12-well plates, the cell culture medium was discarded and 1 mL of PBS was added to each well. After gentle shaking, the PBS was discarded and the washing was repeated once.

[0222] (2) Add 1 mL of trypsin to each well and digest for 2 minutes at room temperature. Discard the trypsin.

[0223] (3) Add 1 ml of PBS to each well and blow off the cells. Transfer the cell suspension to a 1.5 ml EP tube and centrifuge at 800 rpm for 5 min. Discard the supernatant.

[0224] (4) Dilute the LDHA release reagent with PBS at a ratio of 10:1. Add 150 μL of the diluted LDHA release reagent to each tube, mix thoroughly by pipetting, and resuspend the pellet. Incubate in a cell culture incubator at 37°C for 1 h.

[0225] (5) After centrifugation at 800 rpm for 5 min, the supernatant was transferred to a new 1.5 mL EP tube and the sample was immediately measured.

[0226] (6) Add 60 μL of sample supernatant, 20 μL of lactic acid solution, 20 μL of INT solution, and 20 μL of enzyme solution to each well of a 96-well plate. Mix thoroughly and incubate at room temperature in the dark for 30 min. Measure absorbance at 490 nm.

[0227] The experimental results showed that the activity of lactate dehydrogenase was significantly reduced after knocking down lincRNA063480 or hnRNPF (e.g. Figure 3 (as shown in D in the figure).

[0228] 14LACT content determination

[0229] (1) After 48 h of RNAi experiment (si-lincRNA063480 or si-hnRNPF) in 12-well plates, the cell culture medium was discarded and 1 mL of PBS was added to each well. After gentle shaking, the PBS was discarded and the washing was repeated once.

[0230] (2) Add 1 mL of trypsin to each well and digest for 2 minutes at room temperature. Discard the trypsin.

[0231] (3) Add 1 ml of PBS to each well and blow off the cells. Transfer the cell suspension to a 1.5 ml EP tube and centrifuge at 800 rpm for 5 min. Discard the supernatant.

[0232] (4) According to the number of cells (10 4 The ratio of the volume of the extract (mL) to the volume of the extract (mL) was 500-1000:1, and the cells were disrupted by ultrasonication in an ice bath (power 300 W, ultrasonication 3 s, interval 7 s, total time 5 min).

[0233] (5) Centrifuge at 12000 g for 10 min at 4°C, take 0.8 mL of supernatant, add 0.15 mL of Extract 2, centrifuge at 12000 g for 10 min at 4°C, and take the supernatant for testing.

[0234] (6) Preheat the microplate reader for more than 30 minutes and adjust the wavelength to 570 nm.

[0235] (7) Dilute the 100 μmol / mL standard solution with distilled water to a 2.5 μmol / mL standard solution for testing.

[0236] (8) Perform sample addition and experimental operations as shown in Table 9 below:

[0237] Table 9

[0238]

[0239]

[0240] (9) After thoroughly mixing and dissolving the precipitate, add it to a 96-well plate and measure the absorbance at 570 nm.

[0241] (10) ΔA measurement = A measurement tube - A control tube, ΔA standard = A standard tube - A blank tube.

[0242] (11) C determination = ΔA determination ÷ ΔA standard × 2.5 = X μmol / mL.

[0243] (12) The protein concentration of each sample was determined by the BCA method.

[0244] (13) Calculate according to the sample protein concentration: LA content (μmol / mgprot) = X ÷ C protein concentration.

[0245] The experimental results are as follows Figure 3 As shown in middle E, the intracellular lactate concentration was significantly decreased after knockdown of lincRNA063480.

[0246] 15LDHA stability assay

[0247] (1) After 24 h of RNAi experiment (si-lincRNA063480) in a 12-well plate, the DMEM medium in the original well was discarded.

[0248] (2) Add 5 μg / mL of actinomycin D to DMEM complete medium. At 0 h, 4 h, 8 h, and 12 h, the medium was discarded and 300 μL of Trizol was added to lyse and collect the cells.

[0249] (3) RNA extraction and RT-qPCR detection were performed subsequently.

[0250] The experimental results are as follows Figure 3 As shown in Figure F, the mRNA half-life of LDHA in cells decreased from 7.74 h to 5.40 h after knocking down lincRNA063480, indicating that knocking down lincRNA063480 reduced the mRNA half-life of LDHA.

[0251] 16 Immunofluorescence

[0252] (1) After 48 h of RNAi (si-lincRNA063480) experiment, the culture medium was discarded, 1 mL of PBS was added to each well of the 24-well plate, and the cells were gently washed. The PBS was discarded and the washing was repeated once.

[0253] (2) Add 500 μL of 4% paraformaldehyde solution to each well and fix at room temperature for 30 minutes. Then discard the fixative solution and wash three times with PBS, each time for 5 minutes.

[0254] (3) Add 500 μL of 0.5% Triton-X100 in PBS to each well and permeabilize for 15 minutes at room temperature.

[0255] (4) Discard the liquid, add 500 μL of PBS to each well, and wash slowly on a shaker at room temperature for 5 minutes. Repeat three times.

[0256] (5) Add 500 μL of 5% BSA blocking solution to each well and block at room temperature for 30 minutes.

[0257] (6) Discard the liquid, add 500 μL of PBS to each well, and wash slowly on a shaker at room temperature for 5 minutes. Repeat three times.

[0258] (7) Immunofluorescence primary antibody diluent was used to dilute hnRNPF antibody at a ratio of 1:200. 200 μL of antibody was added to each well and incubated on a shaker at 4°C overnight.

[0259] (8) Add 500 μL of PBS to each well and wash slowly on a shaker at room temperature for 5 minutes. Repeat three times.

[0260] (9) Dilute the Cy3-labeled anti-rabbit fluorescent secondary antibody in the immunofluorescence secondary antibody dilution solution at a ratio of 1:200, add 200 μL of fluorescent secondary antibody to each well, and incubate at room temperature for 1 h in the dark.

[0261] (10) Add 500 μL of PBS to each well and wash slowly on a shaker at room temperature for 5 min. Repeat three times.

[0262] (11) Add 200 μL of DAPI staining solution to each well, incubate at room temperature in the dark for 15 min, and then discard the staining solution.

[0263] (12) Add 500 μL of PBS and wash slowly on a shaker at room temperature for 5 min. Repeat three times.

[0264] (13) Add 10 μL of anti-fluorescence quenching agent to the slide and place the slide along the edge.

[0265] (14) Add an appropriate amount of neutral resin evenly to the edge, seal the slide in the dark overnight, and observe with laser confocal microscopy.

[0266] The experimental results are as follows Figure 3 As shown in middle G, after knocking down lincRNA063480, the fluorescence of hnRNPF was significantly reduced, mainly in the cytoplasm, indicating that lincRNA063480 mainly affects the translation process of hnRNPF.

[0267] 17. Nuclear and cytoplasmic protein extraction

[0268] (1) After 48 h of RNAi (si-lincRNA063480) experiment, the culture medium was discarded, 2 mL of PBS was added to gently wash the cells, the PBS was discarded, and the washing was repeated once.

[0269] (2) Use a cell scraper to scrape off the cells and use a pipette to collect the cells and place them in a 1.5 mL EP tube.

[0270] (3) Centrifuge at 1000 rpm for 5 min, discard the supernatant, and add 100-300 μL of cytoplasmic protein extraction reagent A supplemented with 1% PMSF.

[0271] (4) Vortex at the highest speed for 5 seconds to completely disperse the cell pellet and then place on ice for 15 minutes.

[0272] (5) Add 10 μL of cytoplasmic protein extraction reagent B, vortex vigorously at the highest speed for 5 seconds, and place on ice for 1 minute.

[0273] (6) Vortex vigorously at maximum speed for 5 seconds and centrifuge at 12000-16000g at 4℃ for 5 minutes.

[0274] (7) Immediately transfer the supernatant to another 1.5 mL EP tube. This is the cytoplasmic protein obtained. Discard the remaining cytoplasmic protein supernatant.

[0275] (8) After completely aspirating the remaining supernatant, add 50 μL of nuclear protein extraction reagent supplemented with 1% PMSF and vortex at the highest speed for 15-30 seconds.

[0276] (9) Incubate on ice for 30 min, vortexing the sample at maximum speed for 15 s every 2 min.

[0277] (10) Centrifuge at 12000-16000 g for 10 min at 4°C. Immediately transfer the supernatant to another 1.5 mL EP tube. This is the obtained nuclear protein.

[0278] (11) Subsequently, the protein concentration was determined by the BCA method, and Western blot experiments were performed to detect the expression of hnRNPF proteins in the nucleus and cytoplasm.

[0279] The experimental results are as follows Figure 3 As shown in Figure H, knockdown of lincRNA063480 significantly reduced the expression of hnRNPF protein in the cytoplasm, while there was no significant change in the expression of hnRNPF in the nucleus.

[0280] 18 Subcutaneous tumor formation in nude mice

[0281] (1) The lentiviral vector Plent-CMV-luciferase-P2A-puro provided by Shandong Weizhen Biotechnology Co., Ltd. was used for double enzyme digestion with KpnI and ApaI, respectively. Then, the si-NC sequence carrying the enzyme cleavage site and the interference sequence si-lincRNA063480-2 were connected to obtain a recombinant vector. After the recombinant vector was infected with HepG2 cells for 48 hours, the cells were screened with DMEM complete medium containing 0.8 μg / mL puromycin for 72 hours. The cells obtained were used to construct the sh-NC and sh-lincRNA063480 stable cell lines.

[0282] (2) The two cell lines were expanded into a 15 cm culture dish to a density of 80%. The cells were digested, washed twice with 4°C PBS, centrifuged, and resuspended in DMEM medium without PS and fetal bovine serum to a concentration of 7 million cells per 200 μL.

[0283] (3) Six-week-old nude mice were divided into two groups (4 mice in each group) and 200 μL of control group cells and sh-lincRNA063480 cells were injected subcutaneously on the lower right side of the back.

[0284] (4) After the tumor grows to be visible to the naked eye, the length and width are measured once a week with a vernier caliper, using the formula: longest diameter × shortest diameter 2 ×1 / 2, calculate the tumor volume.

[0285] (5) Five weeks later, 200 μL of luciferase substrate was injected subcutaneously. Two minutes later, the mice were placed in the gas anesthesia chamber of the small animal imaging instrument. After the mice were anesthetized, the instrument collected the luciferase signal. The signal intensity and range reflected the growth of the subcutaneous tumor.

[0286] (6) After signal acquisition, an overdose of sodium pentobarbital was injected subcutaneously, the tumor was removed, weighed, and photographed (e.g. Figure 4 A, B, C, D).

[0287] Experimental results showed that knocking down lincRNA063480 in nude mice could inhibit subcutaneous tumor growth.

[0288] In summary, the present invention found that lincRNA063480 is highly expressed in liver cancer cells. By reducing lincRNA063480, the lactate synthesis and proliferation ability of liver cancer cells can be reduced, indicating that lincRNA063480 is expected to be a new therapeutic target for liver cancer.

[0289] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a long non-coding RNA inhibitor in the preparation of a drug for treating liver cancer, characterized in that: The nucleotide sequence of the long non-coding RNA is shown in SEQ ID NO: 1; The inhibitor is an siRNA that inhibits the expression of the long non-coding RNA; the nucleotide sequence of the siRNA is shown in SEQ ID NO: 2 or SEQ ID NO:

3.

2. The use according to claim 1, characterized in that The siRNA knocks down the expression level of the long non-coding RNA, inhibits lactic acid synthesis and proliferation activity of liver cancer cells, and exerts a therapeutic effect.

3. The use according to claim 2, characterized in that The siRNA knocks down the expression level of the long non-coding RNA and reduces the content of the long non-coding RNA binding protein hnRNPF, thereby inhibiting the lactic acid synthesis of liver cancer cells.

4. Use of a lentiviral recombinant vector in the preparation of a drug for treating liver cancer, characterized in that: The lentiviral recombinant vector includes the siRNA nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO:

3.

5. The use according to claim 4, characterized in that The lentiviral recombinant vector achieves the effect of treating liver cancer by knocking down the expression level of the long non-coding RNA shown in SEQ ID NO:

1.

6. A drug for treating liver cancer, characterized in that: The drug comprises the siRNA described in claim 1 or the lentiviral recombinant vector described in claim 4.

Images