A single-base level detection method for N 4 -mC and 5mC modified sequencing methods

Abstract

The present invention relates to a method for detecting 5mC and N in DNA molecules. 4 A method for modifying a DNA molecule by removing an AlkB protein or a variant thereof.

Description

Technical Field

[0001] The invention belongs to the field of sequencing, and in particular relates to a method for detecting methylation. Background Art

[0002] DNA methylation modification in prokaryotes is a method to protect bacterial DNA from exogenous DNA from bacteriophages. This defense mechanism is called the restriction and modification system (RM system for short). The RM system refers to the methylation modification of bacterial genomic DNA at specific sites under the action of its own methyltransferase, while the unmethylated DNA will be cut by the homologous restriction endonuclease. The RM system consists of two parts: DNA methyltransferase and restriction endonuclease. The methyltransferase methylates specific parts of the DNA, while the restriction endonuclease cuts the DNA according to the sequence. Because the RM system consists of restriction and modification systems, they can effectively distinguish between "self" and "non-self" DNA to limit exogenous or bacteriophage infection. This mechanism is similar in principle to the innate immune response.

[0003] Through the study of more than 200 different bacteria and other prokaryotes, such as archaea, researchers found that DNA methylation exists in more than 90% of prokaryotes, and there are more than 600 methyltransferases, indicating a large diversity of methylation modifications. Many other DNA methylation patterns (even those without restriction endonucleases) have also been observed. This shows that DNA methylation is involved in genome regulation in prokaryotes and plays a vital role in the physiology and biochemistry of prokaryotes, such as regulating virulence, antibiotic resistance, and adapting to oxidation, hypoxia, nutrient deficiency, acidic pH and other environments. Not only that, DNA methylation modification may also be related to epigenetic regulation of gene expression. DNA methylation changes the interaction between DNA and regulatory proteins through direct atomic steric hindrance effects, or indirectly changes the DNA structure to reduce the thermodynamic stability of the double helix structure, resulting in differences in gene expression. At the same time, some DNA binding proteins also inhibit the methylation of specific DNA sequences, for example, by binding to non-methylated DNA with high affinity, thereby protecting specific DNA from being methylated.

[0004] N 6 -Methyladeniine(N 6 -methyladenine, 6mA for short, and 5-methylcytosine (5mC) are two common DNA modifications in bacteria. Then in the 1980s, N was also found in some bacteria. 4 -methylcytosine(N4 -methylcytosine, referred to as N 4 -mC). Similar to 6mA and 5mC, N 4 -mC also participates in the bacterial RM system, which protects bacteria from bacteriophages and other foreign invading DNA. 4 -mC modification plays an important role in DNA replication, cell cycle and regulation of gene expression, and is involved in genome stability, recombination and evolution. 4 The detailed mechanism and role of -mC in gene regulation have not been clear, mainly due to the lack of single-base detection of N in the genome. 4 -mC. An effective method to reveal N 4 -mC function in the genome depends on N 4 Sensitive detection, precise quantification, and localization of -mC in the genome.

[0005] Mass spectrometry has become an effective technology for qualitative and quantitative analysis of nucleic acid modifications, but it is still unable to detect the sequence information where the DNA modifications are located. Single-molecule real-time sequencing (SMRT) technology can analyze data used for the assembly of the entire genome and detect all N 4 SMRT sequencing can detect base modifications such as -mC and 6mA, but the accuracy still needs to be improved. At the same time, compared with commonly used second-generation sequencing technologies such as the Illumina sequencing system, SMRT sequencing is more expensive for library preparation and sequencing, so it is not a feasible solution for analyzing DNA methylation in large samples. Therefore, it is necessary to establish a N sequencer that is compatible with the second-generation sequencing platform. 4 -mC-specific detection methods are essential to facilitate the identification of N in many uncharacterized but potentially useful strains. 4 -Study on the distribution and function of mC.

[0006] Bisulfite sequencing can identify base modification sites in the genome with single-base resolution. 4 The partial resistance of -mC to deamination leads to complex sequencing results and is not suitable for accurate differentiation of N 4 -mC and 5mC. 4 -mC-Tet-assisted bisulfite sequencing (N 4 -mC-Tet-assisted-bisulfite-sequencing) technology uses Tet to oxidize 5mC to generate 5caC. After bisulfite treatment, both cytosine (C) and 5mC are read as thymine, while only N 4 -mC is read as cytosine, revealing their specific location throughout the genome.4 High -mC content and incomplete TET oxidation reaction will lead to more false positives. In addition, the cost of purifying TET proteins with high enzyme activity is also high.

[0007] 4mC-AMD-seq technology uses cytosine deaminase A3A protein to deaminate normal cytosine (C) and 5mC in DNA, and then amplify them in the subsequent polymerase chain reaction to form thymine (T). 4 -mC is able to resist deamination by cytosine deaminase A3A and is therefore amplified to cytosine (C) in the subsequent polymerase chain reaction. 4 -mC can be read as cytosine (C) in the final sequencing. However, C and 5mC in the genome are generally more abundant than N 4 The -mC content is much higher, and the A3A protein does not completely deaminize C or 5mC, which will lead to more false positives.

[0008] Therefore, a method for detecting 5mC and N in genomic DNA at the single base level was developed. 4 Identifying and distinguishing -mC modification sites is a technical problem that needs to be urgently solved in this field. Summary of the invention

[0009] The present invention uses AlkB protein or its variants to treat DNA, and then compares the sequencing results of DNA molecules treated with AlkB protein or its variants and DNA molecules not treated with AlkB protein or its variants by bisulfite sequencing, thereby distinguishing 5mC and N 4 -mC site.

[0010] In the first aspect, the present invention provides a method for detecting 5mC and N in DNA molecules. 4 -mC modification site method, the method comprising the step of treating the DNA molecule with AlkB protein or its variant.

[0011] In a second aspect, the present invention provides a method for sequencing a DNA molecule, the method comprising the step of treating the DNA molecule with an AlkB protein or a variant thereof.

[0012] In some embodiments, the methods of the first aspect and the second aspect comprise the following steps:

[0013] (1) treating the DNA molecule with AlkB protein or its variant; and

[0014] (2) Treating DNA molecules treated with AlkB protein or its variants and DNA molecules not treated with AlkB protein or its variants with bisulfite.

[0015] In some embodiments, the methods of the first and second aspects further include the step of sequencing the DNA molecules treated with AlkB protein or its variants treated with bisulfite obtained in step (2), and the DNA molecules not treated with AlkB protein or its variants treated with bisulfite.

[0016] In some embodiments, the sequencing is Sanger sequencing or next generation sequencing.

[0017] In some embodiments, the methods of the first and second aspects further include sequencing the 5mC and N 4 -mC site identification step.

[0018] In some embodiments, if the sequencing result of a site before and after AlkB treatment is C, the site is 5mC; if the sequencing result of a site before AlkB treatment is C and the sequencing result after AlkB treatment is T, the site is N 4 -mC site.

[0019] The method of the present invention can detect 5mC and N on DNA molecules at the single base level. 4 -mC modification site.

[0020] The method of the present invention can detect 5mC and N on genomic DNA at the single base level. 4 -mC modification site.

[0021] The DNA molecule of the present invention can be, but is not limited to, genomic DNA, such as nuclear DNA, mitochondrial DNA, chloroplast DNA, etc.; plasmid DNA, free DNA, or DNA obtained from a single-stranded nucleic acid sample, such as DNA, cDNA.

[0022] Preferably, the DNA molecules can be obtained, for example, by enrichment or by chromatin immunoprecipitation (ChiP).

[0023] The sample of DNA molecule of the present invention can be from biological source or environmental source. Biological sample includes but is not limited to animal or human sample, liquid and solid food and feed product (dairy product, vegetable, meat etc.). Preferred biological sample includes but is not limited to any biological fluid, cell, tissue, organ or its part containing DNA. Biological sample can comprise cancer cell, for example from colon, rectum, breast, ovary, prostate, kidney, lung, blood, brain or other organ or tissue cancer cell. Any organism can be used as source, and includes but is not limited to, bacteria, fungi, virus, plant, animal, for example human, non-human primate, reptile, insect, bird, worm, fish, mammal, livestock and farm animal (cow, horse, pig, sheep, goat, dog, cat, rodent etc.). Environmental sample includes but is not limited to, surface material, soil, water and industrial sample, and the sample obtained from food and dairy product processing instrument. The sample analyzed can be derived from single source (for example single organism, tissue, cell etc.) or the amalgamation of nucleic acid from multiple organism, tissue or cell.

[0024] In some embodiments, the DNA molecule may also be DNA from lambda phage (λDNA) and DNA from other microorganisms.

[0025] In some embodiments, the AlkB protein variant is a variant that retains the activity of the wild-type AlkB protein, such as a truncated form, a conservative amino acid variant, or a variant that retains the activity.

[0026] In some embodiments, the truncated form is a variant lacking the first 10-12 amino acid residues relative to the wild-type AlkB protein, preferably, the truncated form is a variant lacking the first 11 amino acid residues relative to the wild-type AlkB protein.

[0027] In the present invention, using AlkB protein or its variants, after bisulfite treatment, 5mC is read as cytosine (C), while N 4 -mC is read as thymine (T). Combined with the bisulfite sequencing results before and after AlkB treatment, it is possible to detect 5mC and N in genomic DNA at the single base level. 4 -mC modification site.

[0028] In addition, the purification cost of AlkB protein or its variants is low and the 4 -mC has high catalytic activity and sufficient reaction, eliminating false positives.

[0029] In a third aspect, the present invention provides a sequencing kit, wherein the kit comprises AlkB protein or a variant thereof.

[0030] In a fourth aspect, the present invention provides a method for distinguishing 5mC and N in DNA molecules.4 -mC modification site kit, the kit comprising AlkB protein or a variant thereof.

[0031] In some embodiments, the AlkB protein variant is a variant that retains the activity of the wild-type AlkB protein, such as a truncated form, a conservative amino acid variant, or a variant that retains the activity.

[0032] In some embodiments, the truncated form is a variant lacking the first 10-12 amino acid residues relative to the wild-type AlkB protein, preferably, the truncated form is a variant lacking the first 11 amino acid residues relative to the wild-type AlkB protein.

[0033] In some embodiments, the kit further comprises bisulfite, wherein the bisulfite and the AlkB protein or variant thereof are contained in a different container in the kit.

[0034] In a fourth aspect, the present invention provides a method of the first or second aspect, or a kit of the third aspect for detecting 5mC and N in a DNA molecule. 4 -mC modification site, or its application in DNA molecule sequencing.

[0035] In a fifth aspect, the present invention provides a method for detecting 5mC and N in a sample DNA molecule. 4 -mC modification site reagent is used in the preparation of a sample for determining whether it is cancerous or precancerous, or contains N 4 -mC and 5mC N in microorganisms 4 -mC and 5mC distribution and function study of the product, the reagent comprising AlkB protein or its variant.

[0036] The present invention provides a new sulfite sequencing. Conventional sulfite sequencing cannot accurately distinguish between 5mC and N 4 -mC, in the present invention, AlkB protein is used, which can selectively catalyze only N 4 -mC demethylation. By comparing the results of bisulfite sequencing before and after AlkB treatment, we were able to detect 5mC and N in genomic DNA at the single base level. 4 -mC modification sites, can accurately distinguish 5mC and N 4 -mC.

[0037] The present invention is aimed at N with low content 4 -mC operation improves the reaction efficiency, reduces false positives, and improves the 5mC and N 4 -mC site efficiency.

[0038] Compared to SMRT, or N 4-mC-Tet-assisted bisulfite sequencing (N 4 -mC-Tet-assisted-bisulfite-sequencing), with reduced costs and significantly improved accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the results of bisulfite sequencing of cytosine in different states before and after AlkB treatment.

[0040] Figure 2 N 4 PCR products of -mC and 5mC before and after AlkB treatment 4 -mC site Bisulfite sequencing results.

[0041] Figure 3 N 4 Statistics of Bisulfite sequencing results of the 5mC site of the PCR fragment products of -mC and 5mC before and after AlkB treatment.

[0042] Figure 4 N 4 Full-length λDNA at -mC site before and after AlkB treatment 4 -mC site Bisulfite sequencing results

[0043] Figure 5 The full-length λDNA (including N 4 -mC site), N before and after AlkB treatment 4 -mC site Bisulfite sequencing results

[0044] Figure 6 The full-length λDNA (including N 4 -mC site), Bisulfite sequencing results before and after AlkB treatment (another N 4 -mC site). DETAILED DESCRIPTION

[0045] Genomic DNA refers to the heritable genetic information of an organism. Genomic DNA includes nuclear DNA (also known as chromosomal DNA), and also includes DNA of plastids (e.g., chloroplasts) and other organelles (e.g., mitochondria). The term "genomic DNA" in the present invention also includes genomic DNA of sequences complementary to those described herein.

[0046] The AlkB protein is an Fe(II)- and α-ketoglutarate-dependent dioxygenase that repairs DNA alkyl lesions by directly reversing the damage mechanism as part of an adaptive response in Escherichia coli. Reported substrates of AlkB include simple DNA alkyl adducts such as 1-methyladenine, 3-methylcytosine, 3-ethylcytosine, 1-methylguanine, 3-methylthymine, N 6 -methyladenine, N 2 -methylguanine, N 2 -ethylguanine, N 2 -Furan-2-yl-methylguanine, N 2 -tetrahydrofuran-2-yl-methylguanine and N 4 -methylcytosine. The AlkB protein is a multifunctional guardian of genome integrity under conditions of alkylation stress.

[0047] AlkB protein variants refer to proteins with altered amino acid sequences but retaining AlkB protein activity, such as truncated forms, amino acid optimized proteins, etc. It also includes homologous proteins of AlkB in other species.

[0048] For example, ALKBH1 is a histone dioxygenase that can remove methyl groups from histone H2A. ALKBH1 can be a gene associated with a cancer hallmark. It can act on nucleic acids such as DNA, RNA, tRNA. It can act as a regulator of translation initiation and elongation, for example, in response to glucose deprivation. ALKBH1 can be a demethylase (epigenetic modification) of DNA N6-methyladenine (N6-mA) and can interact with the core transcriptional pluripotency network of embryonic stem cells. ALKBH1 expression in human mesenchymal stem cells (MSCs) can be upregulated in stem cell induction. Depletion of ALKBH1 can lead to accumulation of N6-mA on the promoter region of activating transcription factor 4 (ATF4), which can silence ATF4 transcription. ALKBH1 can participate in the reversible methylation of tRNA, which can serve as a mechanism for post-transcriptional gene expression regulation.

[0049] The present invention uses AlkB protein or AlkB protein variant to treat DNA molecules, and then after sulfite treatment, 5mC is read as cytosine, while N 4 -mC is read as thymine ( Figure 1 ), combined with the results of bisulfite sequencing before and after AlkB treatment, it is possible to detect 5mC and N in genomic DNA at the single base level. 4 -mC modification site. In addition, the purification cost of AlkB protein is low and it is not suitable for N 4 -mC has high catalytic activity and sufficient reaction, eliminating false positives.

[0050] Figure 1 Schematic diagram of sulfite sequencing results of cytosine in different states before and after AlkB treatment. In traditional sulfite sequencing before AlkB treatment, 5mC sequencing results are all displayed as C, N 4 -mC sequencing results showed about 70% as T, and 30% as C; while after AlkB enzyme treatment, 5mC sequencing results were still all shown as C, while N 4 -mC sequencing results are all shown as T. The unmodified C bisulfite sequencing results are all T before and after AlkB treatment.

[0051] The following are preferred embodiments of the present invention, and the present invention is not limited to the following preferred embodiments. It should be noted that for those skilled in the art, several modifications and improvements made on the basis of this invention and creation concept all belong to the protection scope of the present invention. The reagents used without indicating the manufacturer are all conventional products that can be obtained through commercial purchase.

[0052] Example

[0053] Example 1: Sequencing verification of PCR amplified fragments

[0054] In this example, PCR (forward primer: CGCTTGAATTGTCCAACCA (SEQ ID NO. 2); reverse primer: AGACGAAAACATGCCACACA (SEQ ID NO. 3); template sequence is λ DNA (NEB, Cat: N3011S)) was used to amplify a BamHI methyltransferase (N 4 -mC methyltransferase) and M.SssI (5mC methyltransferase) sites; treated with two methyltransferases at 37°C for two hours to make them carry N 4 -mC, 5mC modification; after DNA denaturation (heated at 100℃ for 10 min and immediately placed on ice), AlkB protein (His tag purified after expression in Escherichia coli; Gene ID: 946708) (SEQ ID NO.1) was added at a molar ratio of 1:50, and 50mM HEPES (pH8.0), 75μM ammonium ferrous sulfate, 1mM α-ketoglutaric acid, 2mM ascorbic acid, 50μg / mL BSA and 0.1M ATP were added at 37℃ for 100min; EZ DNA Methylation TM The kit was used for sulfite treatment; after sulfite treatment recovery, specific fragments were amplified by PCR, connected to T vector, and Sanger sequencing was performed. Sulfite sequencing was used to analyze the DNA fragments before and after AlkB protein treatment. The results are shown in Figure 2 and Figure 3 middle.

[0055] From the results, we can see that N 4 Before AlkB treatment, about 67% of the sequencing results of -mC sites showed T, and about 33% of the sequencing results showed C, while after AlkB treatment, 100% of the sequencing results showed T ( Figure 2 ). The sequencing results of 5mC before and after AlkB treatment were both C( Figure 3 ), indicating that after AlkB treatment, N 4 The sequencing of -mC modification sites was significantly improved.

[0056] Example 2: Sequencing verification of λDNA

[0057] The λDNA (NEB, Cat: N3011S) was treated with methyltransferase and AlkB protein according to the experimental method of Example 1. 4 -mC methyltransferase treatment of full-length λ DNA to contain 5 N 4 -mC site was treated with AlkB protein, and λDNA before and after AlkB treatment was analyzed by bisulfite sequencing.

[0058] The results show that N 4 Before AlkB treatment, about 82% of the sequencing results of the -mC site (the site with the same sequence as in Example 1) showed T, and 18% of the sequencing results showed C. After AlkB treatment, 100% of the sequencing results showed T ( Figure 4 ).

[0059] Example 3: Sequencing verification of a mixture of E. coli genomic DNA and λ DNA

[0060] The N-containing 4 -mCλDNA was mixed with E. coli genomic DNA to simulate the genomic DNA environment. Bisulfite sequencing was used to analyze the λDNA before and after AlkB protein treatment.

[0061] The results show that N 4 -mC site (the same site as in Example 2) showed T in about 78% of the sequencing results before AlkB treatment, and C in 22% of the sequencing results. After AlkB treatment, 100% of the sequencing results showed T ( Figure 5 ).

[0062] Example 4: Sequencing verification of E. coli genomic DNA and λ DNA mixture

[0063] According to the method described in Example 3, another N sequence of λDNA before and after AlkB protein treatment was analyzed by sulfite sequencing. 4 -mC site.

[0064] The results show that N 4 Before AlkB treatment, about 72% of the sequencing results of -mC sites showed T, and 28% showed C. After AlkB treatment, 100% showed T ( Figure 6 ).

Claims

1. A non-diagnostic method for detecting 5mC and N in DNA molecules 4 -mC modification site method, the method comprising the step of treating the DNA molecule with AlkB protein; the AlkB protein consists of the amino acid sequence shown in SEQ ID NO:1; The method comprises the following steps: (1) treating the DNA molecule with AlkB protein; and (2) treating DNA molecules treated with AlkB protein and DNA molecules not treated with AlkB protein with bisulfite; The method further comprises the step of sequencing the DNA molecules treated with AlkB protein and treated with bisulfite obtained in step (2), and the DNA molecules treated with bisulfite but not treated with AlkB protein. The method also includes the steps of: 4 -mC site identification steps, If the sequencing result of a site is C before and after AlkB treatment, the site is 5mC; if the sequencing result of a site is C before AlkB treatment and T after AlkB treatment, the site is N 4 -mC site.

2. A method for sequencing a DNA molecule for non-diagnostic purposes, the method comprising the step of treating the DNA molecule with an AlkB protein; the AlkB protein consists of the amino acid sequence shown in SEQ ID NO: 1; The method comprises the following steps: (1) treating the DNA molecule with AlkB protein; and (2) treating DNA molecules treated with AlkB protein and DNA molecules not treated with AlkB protein with bisulfite; The method further comprises the step of sequencing the DNA molecules treated with AlkB protein and treated with bisulfite obtained in step (2), and the DNA molecules treated with bisulfite but not treated with AlkB protein. The method also includes the steps of: 4 -mC site identification steps, If the sequencing result of a site is C before and after AlkB treatment, the site is 5mC; if the sequencing result of a site is C before AlkB treatment and T after AlkB treatment, the site is N 4 -mC site.

3. The method according to claim 1 or 2, wherein the sequencing is Sanger sequencing or second-generation high-throughput sequencing.

4. The method according to claim 1 or 2, wherein the DNA molecule is selected from genomic DNA.

5. The method according to claim 1 or 2, wherein the DNA molecule is selected from nuclear DNA, mitochondrial DNA or chloroplast DNA.

6. The method according to claim 1 or 2, wherein the DNA molecule is selected from plasmid DNA or free DNA.

7. The method according to claim 1 or 2, wherein the DNA molecule is obtained from a single-stranded nucleic acid sample.

8. The method according to claim 1 or 2, wherein the DNA molecule is selected from DNA in lambda phage and other microorganisms.

9. The method according to claim 1 or 2, wherein the DNA molecule is obtained by enrichment.

10. The method according to claim 1 or 2, wherein the DNA molecule is obtained by chromatin immunoprecipitation.

11. The method according to claim 1 or 2, wherein the sample of DNA molecules is from a biological sample, an environmental sample or a combination thereof.

12. The method of claim 11, wherein the biological sample comprises any biological fluid, cell, tissue or organ containing DNA.

13. The method of claim 11, wherein the environmental samples include soil, water and industrial samples, and samples obtained from food and dairy processing equipment.

14. The kit containing AlkB protein and bisulfite is used to detect 5mC and N in DNA molecules. 4 -mC modification site, or non-diagnostic application in DNA molecule sequencing, wherein the AlkB protein consists of the amino acid sequence shown in SEQ ID NO: 1, The application comprises the step of treating the DNA molecule with AlkB protein; the AlkB protein consists of the amino acid sequence shown in SEQ ID NO: 1; The application comprises the following steps: (1) treating the DNA molecule with AlkB protein; and (2) treating DNA molecules treated with AlkB protein and DNA molecules not treated with AlkB protein with bisulfite; The application further comprises the step of sequencing the DNA molecules treated with AlkB protein and treated with bisulfite obtained in step (2), and the DNA molecules treated with bisulfite but not treated with AlkB protein. The application also includes the analysis of 5mC and N 4 -mC site identification steps, If the sequencing result of a site is C before and after AlkB treatment, the site is 5mC; if the sequencing result of a site is C before AlkB treatment and T after AlkB treatment, the site is N 4 -mC site.

15. The use according to claim 14, wherein the bisulfite and the AlkB protein are contained in different containers in the kit.

Images