A genetically engineered bacterium for efficiently producing ectoine and its preparation and application

Abstract

The invention proposes a genetic engineering bacterium for efficiently producing ectoine and a preparation and application thereof, characterized in that the genetic engineering bacterium uses Escherichia coli MG1655, numbered ATCC 47076, as a host and comprises the following modifications: based on the pyruvate-responsive transcription factor PdhR, a PdhR binding site PdhR Box is inserted into the downstream of a T7 promoter by a fusion PCR method so that its transcription is inhibited by the pyruvate-responsive transcription factor PdhR, and a Ppr promoter regulated by pyruvate is constructed by a seamless cloning method using a kit ClonExpress; T7RNAP is exogenously introduced and expressed under PxylF; a codon-optimized ectABC gene cluster is exogenously introduced, one copy is under the T7 promoter, and the other copy is under the constructed strong promoter Ppr promoter regulated by pyruvate; phosphoenolpyruvate carboxylase gene ppc and aspartate kinase gene lysC are incrementally expressed under the control of Ppr; and the expression of thrA, lysA, iclR and zwf genes is inhibited by antisense transcription. The engineered bacteria of the present application can produce ectoine and has a relatively high yield.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium for efficiently producing ectoine and the preparation and application thereof. Background Art

[0002] Ectoine (1, 4, 5, 6-tetrahydro-2-methyl-4-pyrim-idinecarboxylic acid, ectoine), also known as tetrahydropyrimidine, 1,4,5,6-tetrahydro-2-methyl-4-pyrimidinecarboxylic acid, is a pyrimidine derivative and a cyclized amino acid derivative. It is highly water-soluble and has no charge in the physiological pH range. In 1985, Galinski et al. first observed the existence of ectoine in an extremely halophilic phototrophic purple sulfur bacterium ( Halorhodospira halochloris ) and was identified and separated by nuclear magnetic resonance, mass spectrometry and infrared spectroscopy. It has been found that ectoine can accumulate in the cells of microorganisms such as salt-tolerant or halophilic bacteria, archaea, actinomycetes and fungi. Ecdoine-compatible solutes protect cells in extreme external environments (freezing, drought, high salinity, high temperature, radiation, etc.). Mainly under high salt concentrations, as osmotic pressure compensation solutes, they accumulate in large quantities in the cells of certain halophilic or salt-tolerant bacteria, archaea and other microorganisms to resist changes in the high osmotic pressure of the external environment. As a biomacromolecule protective agent, ectoine protects the structure of enzymes, nucleic acids and proteins. Therefore, ectoine is widely used in cosmetics, medicine, enzyme industry, biotechnology and other fields.

[0003] At present, the production methods of Ecdoin mainly include chemical synthesis and biosynthesis. The chemical synthesis method has the disadvantages of environmental pollution, harsh reaction conditions, and high cost. The biosynthesis method is divided into enzyme catalysis and biological fermentation. The enzyme catalysis method requires the addition of inducers and has complex operating processes. The traditional biological fermentation method often uses halophilic or salt-tolerant bacteria. The main production process is the "bacterial milking" method, that is, through the cyclic control of osmotic pressure, the high-salt, hypertonic external environment induces cells to synthesize Ecdoin, and the low-salt, hypotonic environment stimulates and promotes release. The high-salt environment used in this method causes problems such as equipment corrosion, cell growth inhibition, and increased difficulty in post-extraction, which in turn increases the production cost of Ecdoin and restricts the large-scale production and application of Ecdoin.

[0004] Studies have shown that there is an ectoine biosynthesis pathway in halophilic or halophilic bacteria that use aspartic acid as a precursor, which is mainly composed of three key genes ( ectA, ectB, ectC ) are involved in the process of mitochondrial remodeling, and the three genes are usually expressed as ectABCThe operon unit is formed in the form of a operon unit. After aspartate is converted into L-aspartate-4-semialdehyde by aspartate kinase and aspartate semialdehyde dehydrogenase, diaminobutyrate aminotransferase (EctB) catalyzes the conversion of L-aspartate-4-semialdehyde into L-2,4-diaminobutyric acid (DABA), which is then catalyzed by L-diaminobutyrate transferase (EctA) to generate N-acetyl-2,4-diaminobutyric acid (ADABA), and finally ADABA is converted into the final product of the reaction, ectoine, by the catalysis of tetrahydropyrimidine synthase (EctC). The three key genes of the ectoine biosynthesis pathway in halophiles were identified. ectA, ectB, ectC Transferring non-halophilic strains to reconstruct the synthesis pathway of ectoine, and using heterologous expression of Escherichia coli, Corynebacterium glutamicum, yeast, etc. to produce ectoine can effectively avoid the problems of the "bacterial milking method" and is an increasingly common method in industrial production. As the most widely used strain in the microbial fermentation industry, Escherichia coli has the advantages of clear genetic background, short fermentation cycle, low cost and easy genetic modification. It has been approved by the US FDA as a safe genetic engineering receptor organism and is an advantageous platform for fermentation synthesis of ectoine.

[0005] The glycolysis pathway is a key central metabolic pathway to maintain cell growth, providing carbon skeletons for cell growth and product synthesis. Excessive metabolic flux in the glycolysis pathway will lead to metabolic overflow, causing more carbon skeletons to flow to cell growth and generate by-products, while too low metabolic flux in the glycolysis pathway will affect cell growth and lead to decreased product synthesis efficiency. Therefore, rational and precise control of the metabolic flux of the glycolysis pathway is one of the key factors to achieve efficient synthesis of target products. Pyruvate is a key carbon central metabolite connecting the glycolysis pathway and the TCA cycle. The two carbon source utilization pathways, the PTS pathway and the NPTS pathway, will flow into the glycolysis pathway to generate pyruvate, provide carbon skeletons for cells, or continue to enter the TCA cycle to be converted into nitrogen sources, ATP or reducing power. The pyruvate-responsive transcription factor PdhR is a pleiotropic transcription factor in Escherichia coli that can respond to intracellular pyruvate concentrations and regulate multiple metabolic nodes, thereby maintaining the homeostasis of intracellular central metabolism. When the intracellular pyruvate concentration is low, the pyruvate-responsive transcription factor PdhR will bind to the promoter region of the target gene, hindering the binding of RNA polymerase to the promoter, thereby inhibiting gene transcription; when the intracellular pyruvate concentration reaches a certain threshold, pyruvate will bind to the pyruvate-responsive transcription factor PdhR, causing it to fall off from the promoter region of the target gene, thereby relieving the inhibitory effect of the pyruvate-responsive transcription factor PdhR. The present invention inserts a PdhR binding site PdhR Box (ATTGGTATGACCAAT) downstream of the T7 promoter so that its transcription is inhibited by the pyruvate-responsive transcription factor PdhR, thereby obtaining a Ppr promoter regulated by pyruvate, and then expressing exogenous genes under the control of the Ppr promoter, while enhancing and inhibiting the expression of sugar metabolism and amino acid metabolism regulatory genes under the control of the Ppr promoter. It can achieve accurate and reasonable regulation of sugar metabolism flow according to the concentration level of pyruvate in the cells, dynamically increase amino acid and sugar metabolism tributaries, and guide the metabolic flow to the product ectoine without affecting the normal growth and energy supply of the host bacteria, thereby increasing the yield of ectoine.

[0006] Antisense transcription is a regulatory system that is ubiquitous in many organisms. Its main modes of action can be divided into two types: the production of antisense RNA (asRNA) or transcriptional interference. Among them, asRNA can bind to the mRNA of the target gene, reduce its stability and translation efficiency, and thus inhibit the expression of the target gene; while transcriptional interference occurs between RNA polymerases (RNAPs). When the extension directions of the two RNAPs are opposite, the two will physically collide, causing them to fall off the DNA chain, thereby interfering with the effective synthesis of mRNA. The present invention inserts a reverse Ppr promoter downstream of the thrA, lysA, iclR and zwf genes, respectively, inhibits gene expression through antisense transcription, and reduces the flux of amino acid and sugar metabolic tributaries.

[0007] Xie Xixian et al. (CN106754603B) announced a genetically engineered bacterium that uses xylose to induce the production of ectoine and its application. The genetically engineered bacterium is an Escherichia coli with a specific genotype, comprising the ectABC gene from Elongatus Halomonas controlled by the T7 promoter; two gene defective types, thrA and iclR; the lysC gene from Corynebacterium glutamicum controlled by the T7 promoter; the ppc gene controlled by the trc promoter; and the RNA polymerase from T7 bacteriophage controlled by the xylose promoter PxylF. After 20-28 hours of shake flask fermentation, the ectoine production reached 12-16 g / L, and after 24-40 hours of fermentation in a 5L fermenter, the ectoine production reached 35-50 g / L. However, after the bacteria were transformed by exogenous introduction, overexpression and knockout of genes, the amino acid and sugar metabolic flows were not accurately and reasonably regulated, which would affect the growth and energy supply of the bacteria to a certain extent, causing certain pressure on the bacteria, and thus affecting the production of ectoine; at the same time, the bacteria did not optimize the heterologous gene cluster ectABC, which to a certain extent limited the further increase in the production of ectoine. Summary of the invention

[0008] The invention provides a genetic engineering bacterium capable of efficiently producing ectoine and a preparation method and application thereof, and solves the technical problem that the bacterium can effectively produce ectoine with a high yield.

[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0010] A genetically engineered bacterium for efficiently producing ectoin, wherein the genetically engineered bacterium uses Escherichia coli MG1655, numbered ATCC 47076, as a host, A) based on the pyruvate-responsive transcription factor PdhR, a PdhR binding site PdhR Box is inserted downstream of a T7 promoter by a fusion PCR method, so that its transcription is inhibited by the pyruvate-responsive transcription factor PdhR, and a Ppr promoter regulated by pyruvate is constructed by a seamless cloning method using a kit ClonExpress;

[0011] B) Exogenously introduced T7RNAP was expressed under PxylF;

[0012] C) Exogenously introduce the codon-optimized ectABC gene cluster, one copy under the T7 promoter and the other copy under the constructed strong promoter Ppr regulated by pyruvate; under the control of Ppr, the phosphoenolpyruvate carboxylase gene ppc and the aspartate kinase gene lysC are incrementally expressed;

[0013] D) Inhibit the expression of thrA and lysA through antisense transcription, reduce the flux of threonine, methionine, and lysine metabolic branches and reduce their feedback inhibition; inhibit the expression of iclR gene through antisense transcription, activate the glyoxylate pathway, and increase the accumulation of the important precursor oxaloacetate; inhibit the expression of zwf gene through antisense transcription, and reduce the metabolic flux of 6-phosphate glucose to the HMP pathway;

[0014] The codon-optimized ectABC gene cluster modifies part of the codons of the original exogenous gene ectABC gene cluster sequence according to established rules to make it suitable for Escherichia coli expression, and finally artificially synthesizes the codon DNA fragment ectOPT.

[0015] The codon-optimized ectABC gene cluster is ectOPT, and its nucleotide sequence is shown in SEQ ID No. 1 in the sequence table.

[0016] The nucleotide sequence of the T7 promoter is shown in the sequence table as SEQ ID No.2;

[0017] The nucleotide sequence of the T7 terminator is shown in the sequence table SEQ ID No. 3

[0018] The nucleotide sequence of the PxylF gene is shown in the sequence table SEQ ID No.5

[0019] The nucleotide sequence of the RNAP gene is shown in the sequence table SEQ ID No.6

[0020] The GeneID of the thrA gene is 945803, and the nucleotide sequence is shown in the sequence table SEQ ID No. 11

[0021] The GeneID of the lysA gene is 947313, and the nucleotide sequence is shown in the sequence table SEQ ID No. 12

[0022] The GeneID of the iclR gene is 948524, and the nucleotide sequence is shown in the sequence table SEQ ID No. 13

[0023] The GeneID of the zwf gene is 946370, and the nucleotide sequence is shown in the sequence table SEQ ID No. 14

[0024] The GeneID of the ppc gene is 948457, and the nucleotide sequence is shown in the sequence table SEQ ID No. 15

[0025] The GeneID of the lysC gene is 948531, and the nucleotide sequence is shown in the sequence table SEQ ID No. 16

[0026] The GeneID of the pdhR gene is 944827, and the nucleotide sequence is shown in the sequence table SEQ ID No. 17

[0027] The nucleotide sequence of the Ppr promoter is shown in the sequence listing SEQ ID No.18.

[0028] A method for preparing a genetically engineered bacterium that efficiently produces ectoine is carried out according to the following steps:

[0029] a) Based on the transcription factor PdhR, the pyruvate-responsive transcription factor PdhR binding site PdhR Box (ATTGGTATGACCAAT) was inserted downstream of the T7 promoter by fusion PCR, so that its transcription was inhibited by the pyruvate-responsive transcription factor PdhR, and the plasmid pPRZ with the Ppr promoter was constructed by seamless cloning using the kit ClonExpress, thereby obtaining the Ppr promoter regulated by pyruvate;

[0030] b) inserting the T7 RNA polymerase gene T7RNAP expressed under PxylF into the lacZ gene site by Cre / loxP technology;

[0031] c) against Halomonas elongatus ( Halomonas elongata DSM 2581) were codon-optimized to obtain gene cluster fragments ectOPT, and the codon-optimized foreign gene ectOPT was introduced into the pseudogene lfhA site by Cre / loxP technology and expressed under T7 promoter; the codon-optimized second copy of the foreign gene ectOPT was introduced into the pseudogene ycgH site by Cre / loxP technology and expressed under Ppr promoter;

[0032] d) At the pseudogene yneO site, Cre / loxP technology was used to introduce P pr The phosphoenolpyruvate carboxylase gene ppc under the control of the pseudogene was introduced into the ilvG site by Cre / loxP technology to achieve the controlled incremental expression of the ppc gene. P pr The aspartate kinase gene lysC under the control of lysC gene is realized to achieve the controlled incremental expression of lysC gene;

[0033] e) Inhibit the expression of thrA and lysA through antisense transcription, reduce the flow of threonine, methionine, and lysine metabolic branches and reduce their feedback inhibition. Inhibit the expression of iclR gene through antisense transcription, activate the glyoxylate pathway, and increase the accumulation of the important precursor oxaloacetate. Inhibit the expression of zwf gene through antisense transcription, and reduce the metabolic flow of 6-phosphate glucose to the HMP pathway;

[0034] The codon-optimized ectABC gene cluster modifies part of the codons of the original exogenous gene ectABC gene cluster sequence according to established rules to make it suitable for Escherichia coli expression, and finally artificially synthesizes the codon DNA fragment ectOPT.

[0035] The codon-optimized ectABC gene cluster is ectOPT, and its nucleotide sequence is shown in SEQ ID No. 1 in the sequence table.

[0036] The nucleotide sequence of the T7 promoter is shown in the sequence table as SEQ ID No.2;

[0037] The nucleotide sequence of the T7 terminator is shown in the sequence table SEQ ID No. 3

[0038] The GeneID of the lacZ gene is 945006, and the nucleotide sequence is shown in the sequence table SEQ ID No.4

[0039] The nucleotide sequence of the PxylF gene is shown in the sequence table SEQ ID No.5

[0040] The nucleotide sequence of the RNAP gene is shown in the sequence table SEQ ID No.6

[0041] The GeneID of the lfhA gene is 944908, and the nucleotide sequence is shown in the sequence table SEQ ID No.7

[0042] The GeneID of the ycgH gene is 2847703, and the nucleotide sequence is shown in the sequence table SEQ ID No.8

[0043] The GeneID of the yneO gene is 7751623, and the nucleotide sequence is shown in the sequence table SEQ ID No. 9

[0044] The GeneID of the ilvG gene is 948279, and the nucleotide sequence is shown in the sequence table SEQ ID No. 10

[0045] The GeneID of the thrA gene is 945803, and the nucleotide sequence is shown in the sequence table SEQ ID No. 11

[0046] The GeneID of the lysA gene is 947313, and the nucleotide sequence is shown in the sequence table SEQ ID No. 12

[0047] The GeneID of the iclR gene is 948524, and the nucleotide sequence is shown in the sequence table SEQ ID No. 13

[0048] The GeneID of the zwf gene is 946370, and the nucleotide sequence is shown in the sequence table SEQ ID No. 14

[0049] The GeneID of the ppc gene is 948457, and the nucleotide sequence is shown in the sequence table SEQ ID No. 15

[0050] The GeneID of the lysC gene is 948531, and the nucleotide sequence is shown in the sequence table SEQ ID No. 16

[0051] The GeneID of the pdhR gene is 944827, and the nucleotide sequence is shown in the sequence table SEQ ID No. 17

[0052] The nucleotide sequence of the Ppr promoter is shown in the sequence listing SEQ ID No.18.

[0053] The invention discloses a genetically engineered bacterium for efficiently producing ectoine, characterized in that the shaking flask fermentation culture steps are as follows:

[0054] Slant activation: Use an inoculation loop to dip the genetically engineered bacteria that efficiently produce ectoine and store it in a -80℃ refrigerator and inoculate it into a solid test tube slant culture medium. Cultivate it at 33℃-37℃ for 14-16h. Scrape a loop of slant bacterial lawn with the inoculation loop and transfer it to the second-generation test tube slant culture medium for 14-16h.

[0055] Seed bottle culture: scrape a loop of the slant culture and transfer it to the seed bottle culture medium, culture at 33℃-37℃, 200-220rpm for 6-9h;

[0056] Shake flask fermentation culture: inoculate shake flask fermentation medium at 5-12% inoculation rate, culture at 33°C-37°C, 200-220rpm for 22-26h; use ammonia water to control pH at 6.8-7.2 through phenol red colorimetric agent, and use 50%-70% glucose for feeding during the process; add xylose at 3-12h to make the final concentration of xylose 5-20g / L;

[0057] The activated slant medium consists of 1-2 g / L glucose, 5-10 g / L peptone, 3-6 g / L yeast extract, 5-10 g / L sodium chloride, 15-25 g / L agar strip, and the rest is water, and the pH is adjusted to 7.0-7.2;

[0058] The composition of the seed bottle culture medium is: glucose 20-30g / L, peptone 2-4g / L, yeast powder 4-6g / L, corn steep liquor 5-15g / L, citric acid 0.3-2g / L, KH2PO4 0.5-3g / L, K2HPO4 0.5-3g / L, MgSO4 0.1-2g / L, FeSO4 5-15mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2;

[0059] The shake flask fermentation medium consists of: glucose 20-30 g / L, peptone 1-2 g / L, yeast powder 2-4 g / L, corn steep liquor 10-20 g / L, citric acid 2-5 g / L, KH2PO4 2-5 g / L, K2HPO4 2-5 g / L, MgSO4 1-5 g / L, FeSO4 10-50 mg / L, MnSO4 10-50 mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0060] The application is characterized in that the fermentation and culturing steps in a fermenter are:

[0061] Slant activation: Use an inoculation loop to dip the genetically engineered bacteria that efficiently produce ectoine and store it in a -80℃ refrigerator and inoculate it into a solid test tube slant culture medium. Cultivate at 33℃-37℃ for 14-

[0062] After 16 hours, scrape a ring of slant bacterial lawn with an inoculation loop and transfer it to the slant medium of the second generation eggplant bottle and culture it for 14-16 hours;

[0063] Preparation of bacterial suspension: Wash the slant bacteria with sterile saline to make a bacterial suspension;

[0064] Seed culture: inoculate the bacterial suspension into the seed culture medium, control the pH to 7.0-7.2, 33℃-37℃, dissolved oxygen 20%-40%, and culture for 6-9h;

[0065] Fermentation culture: inoculate the fermentation medium at an inoculum rate of 5-12%, control the pH at 7.0-7.2 with ammonia water, maintain the temperature at 33°C-37°C, and maintain the dissolved oxygen at 20%-40%. Cultivate until the sugar concentration is below 0.5g / L, feed with 50%-70% glucose to maintain the sugar concentration at 0.5-1.5g / L, add xylose every 5-20h to make the final xylose concentration 5-20g / L, and the fermentation cycle is 40-48h;

[0066] Slant activation medium composition: glucose 1-2g / L, peptone 5-10g / L, yeast extract 3-6g / L, sodium chloride 5-10g / L, agar strip 15-25g / L, the rest is water, and the pH is adjusted to 7.0-7.2;

[0067] The composition of the seed culture medium is: glucose 20-30g / L, peptone 2-4g / L, yeast powder 5-10g / L, corn steep liquor 10-15g / L, xylose 5-20g / L, citric acid 1-5g / L, KH2PO4 0.5-3g / L, K2HPO4 0.5-3g / L, MgSO4 0.1-2g / L, FeSO4 5-15mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2;

[0068] The fermentation medium is composed of: glucose 20-30g / L, yeast powder 2-6g / L, corn steep liquor 15-20g / L, citric acid 2-6g / L, KH2PO4 2-5g / L, K2HPO4 2-5g / L, MgSO4 1-5g / L, FeSO4 10-50mg / L, MnSO4 10-50mg / L, vitamin B1 0.5-5mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2;

[0069] The dissolved oxygen is corrected to 100% based on the dissolved oxygen in air.

[0070] The invention has the following beneficial technical effects:

[0071] 1) The present invention constructs for the first time a constitutively controlled promoter Ppr based on the T7 promoter and the pyruvate-responsive transcription factor RdhR, integrates a codon-optimized heterologous gene cluster ectABC under the Ppr promoter, and accurately and reasonably regulates the sugar metabolic flow according to the concentration level of pyruvate in the cells, thereby directing the metabolic flow to the product ectoin without affecting the normal growth and energy supply of the host bacteria, thereby increasing the yield of ectoin; the genetically engineered bacteria integrates the expression codon-optimized The heterologous gene cluster ectABC enhances the efficiency of ectoine production without placing excessive burden on cells; the phosphoenolpyruvate carboxylase gene ppc and the aspartate kinase gene lysC are incrementally expressed under the control of Ppr, and the amino acid and sugar metabolic tributaries are dynamically increased according to the concentration level of pyruvate in the cells, thereby increasing the production of ectoine; a regulatory system through antisense transcription inhibition under the control of Ppr is established, which weakens the amino acid and sugar metabolic tributaries without affecting the normal growth of cells, thereby greatly increasing the production of ectoine.

[0072] 2) The present invention, for the first time, inhibits the expression of the zwf gene through antisense transcription, reduces the metabolic flux from 6-phosphate glucose to the HMP pathway, and significantly increases the yield of ectoine, providing a new idea for the development of high-yield ectoine strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 This is a schematic diagram of the metabolic pathway modification of the strain;

[0074] Figure 2 is a schematic diagram of the Ppr promoter;

[0075] Figure 3 is a schematic diagram of the pPRZ vector;

[0076] Figure 4 is a schematic diagram of the pJM1 vector;

[0077] Figure 5 is a schematic diagram of the pET-Pprx-lacZ vector;

[0078] Figure 6 is a schematic diagram of the pPRZ vector;

[0079] Figure 7 is a schematic diagram of the pECT1 vector;

[0080] Figure 8 This is a schematic diagram of the pECT2 vector. DETAILED DESCRIPTION

[0081] The present invention is further described below with reference to specific examples.

[0082] Example 1

[0083] Construction of a single promoter expression system for the codon-optimized ectABC gene cluster

[0084] (1) Construction of plasmid pPRZ with Ppr promoter

[0085] Based on the pyruvate-responsive transcription factor PdhR, we inserted the PdhR binding site PdhR Box (ATTGGTATGACCAAT) downstream of the T7 promoter by fusion PCR, so that its transcription was inhibited by the pyruvate-responsive transcription factor PdhR, thereby obtaining the Ppr promoter regulated by pyruvate.

[0086] Reverse PCR primers Ppr.F and Ppr.R were designed, and plasmid p7Z6 was used as a template for PCR amplification and recombination ligation using the kit ClonExpress to obtain plasmid pPRZ with Ppr promoter inserted behind the Bolai resistance gene;

[0087] (2) Introduction of T7RNAP gene

[0088] The T7 RNA polymerase gene T7RNAP was inserted into the lacZ gene site by Cre / loxP technology;

[0089] Using the genome of Escherichia coli MG1655 (ATCC 47076) as a template, a pair of primers (PxylF.F, PxylF.R) were designed according to the promoter sequence of the xylose encoding gene xylF, and the xylose promoter fragment PxylF was obtained by PCR amplification.

[0090] Using the E. coli BL21 (DE3) genome as a template, a pair of primers (T7RNAP.F, T7RNAP.R) were designed according to the T7RNAP gene sequence, and the T7RNAP fragment was obtained by PCR amplification;

[0091] Primers (T7RNAP-zeo.F, T7RNAP-zeo.R) were designed using plasmid p7Z6 as a template to amplify the bleomycin resistance gene fragment (the two ends of the fragment contain lox71 / lox66 recognition sites respectively);

[0092] Using the genome of Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (lacZ-LF, lacZ-LR) and downstream homology arm primers (lacZ-RF, lacZ-RR) were designed according to the sequence of the lacZ gene (GeneID: 945006). The upstream homology arm was located upstream of the lacZ gene, and the downstream homology arm was located inside the lacZ gene by PCR amplification.

[0093] Using the fragment amplified in the above step as a template, the PxylF-T7RNAP integration fragment was obtained by overlapping fusion PCR, which contained about 520 bp of the upstream homology arm of the lacZ gene, about 512 bp of the downstream homology arm of the lacZ gene, about 538 bp of the bleomycin resistance gene fragment, about 268 bp of the PxylF promoter fragment, and about 2652 bp of the T7RNAP gene fragment. The PxylF-T7RNAP integration fragment after overlapping fusion was about 4490 bp, the original bacterial genome fragment size was about 3660 bp, and after deleting the resistance marker, it was about 4030 bp;

[0094] The above integration fragments were transformed into competent cells of Escherichia coli MG1655 (ATCC 47076) by chemical transformation, and screened on LB plates containing bleomycin to obtain positive transformants. After PCR identification and sequencing verification, the plasmid pJM1 was transformed into the strain. pJM1 is a temperature-sensitive plasmid and will be lost when cultured under high temperature conditions. The pJM1 plasmid contains a Cre recombinase gene expressed under the mannose promoter. The Cre recombinase produced by mannose induction can specifically recognize the lox71 / lox66 site for DNA recombination, eliminate the DNA fragment between the two recognition sites, and can be used to eliminate the resistance marker. The strains transformed with pJM1 were screened on LB containing kanamycin. After PCR verification, the transformants were inoculated into LB medium containing mannose to induce the expression of Cre recombinase, and start site-specific recombination to eliminate the bleomycin resistance gene. Subsequently, the strain was transferred to LB non-resistant medium, cultured at 42°C for 12 hours, and then spread on LB non-resistant solid medium to eliminate the thermosensitive plasmid pJM1. After verifying the resistance, the strain HEC1 was obtained in which the lacZ gene was replaced with the T7RNAP gene controlled by the PxylF promoter.

[0095] (3) Introducing the codon-optimized ectABC gene cluster and expressing it under the T7 promoter

[0096] At the pseudogene lfhA site, the codon-optimized exogenous gene ectABC was introduced by Cre / loxP technology and expressed under the T7 promoter;

[0097] Halomonas elongatus ( Halomonas elongata DSM 2581) were codon optimized and synthesized to obtain the gene cluster fragment ectOPT. T7 promoter and T7 terminator sequences were added before and after to obtain the gene cluster expression framework fragment T7-ectOPT. The fragment was inserted into plasmid pET28 to obtain plasmid pECT1.

[0098] A pair of primers ect.F and ect.R were designed according to the pECT1 sequence, and the T7-ectOPT gene cluster fragment was amplified using plasmid pECT1 as a template;

[0099] Primers (lfhA-zeo.F, lfhA-zeo.R) were designed using plasmid p7Z6 as a template to amplify the bleomycin resistance gene fragment;

[0100] Using Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (lfhA-LF, lfhA-LR) and downstream homology arm primers (lfhA-RF, lfhA-RR) were designed according to the pseudogene lfhA (GeneID: 944908). The upstream homology arm and downstream homology arm fragments of lfhA were obtained by PCR amplification. The upstream homology arm was located upstream of the lfhA gene, and the downstream homology arm was located inside the lfhA gene.

[0101] Using the fragment amplified in the above step as a template, a T7-ectOPT integration fragment was obtained by overlapping extension PCR, which contained about 645 bp of the upstream homology arm of the lfhA gene, about 686 bp of the downstream homology arm of the lfhA gene, about 538 bp of the bleomycin resistance gene fragment, and about 2625 bp of the T7-ectOPT gene cluster fragment. The integration fragment after overlapping fusion was about 4494 bp, the original bacterial genome fragment size was about 2220 bp, and after deleting the resistance marker, it was about 4000 bp;

[0102] The above integration fragment was introduced into Escherichia coli HEC1 to obtain positive transformants, and then introduced into plasmid pJM1 to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC2A with the ectOPT gene cluster controlled by the T7 promoter.

[0103] (4) Introducing the codon-optimized ectABC gene cluster and expressing it under the Ppr promoter

[0104] The codon-optimized ectABC gene cluster was exogenously introduced into the pseudogene ycgH locus by Cre / loxP technology and expressed under the Ppr promoter;

[0105] pECT2 was obtained by replacing the T7 promoter in plasmid pECT1 with the Ppr promoter;

[0106] The Ppr-ectOPT gene cluster fragment was obtained by using plasmid pECT2 as template and ect.F and ect.R as primers;

[0107] Primers (ycgH-zeo.F, ycgH-zeo.R) were designed using plasmid p7Z6 as a template to amplify the bleomycin resistance gene fragment;

[0108] Using Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (ycgH-LF, ycgH-LR) and downstream homology arm primers (ycgH-RF, ycgH-RR) were designed according to the pseudogene ycgH (GeneID: 2847703), and the upstream and downstream homology arm fragments of ycgH were obtained by PCR amplification. Both the upstream and downstream homology arms were located inside ycgH.

[0109] Using the fragment amplified in the above step as a template, the Ppr-ectOPT integration fragment was obtained by overlapping extension PCR, which contained about 757 bp of the upstream homology arm of the ycgH gene, about 685 bp of the downstream homology arm of the ycgH gene, about 538 bp of the bleomycin resistance gene fragment, and 2640 bp of the Ppr-ectOPT gene cluster fragment. The integration fragment after overlapping fusion was about 4620 bp, the original bacterial genome fragment size was about 2544 bp, and after deleting the resistance marker, it was about 4120 bp;

[0110] The above integration fragment was introduced into Escherichia coli HEC1 to obtain positive transformants, and then introduced into plasmid pJM1. After eliminating the bleomycin resistance gene in the transformants, the temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC2B with the ectOPT gene cluster controlled by the Ppr promoter.

[0111] The above-mentioned E. coli HEC2A and HEC2B containing the ectoine synthesis gene were subjected to shake flask fermentation culture of ectoine for 24 hours according to Example 6. After liquid chromatography detection, the yield of ectoine in E. coli HEC2A was 1.82 g / L, and the yield of ectoine in E. coli HEC2B was 3.76 g / L. The yield of ectoine in shake flask fermentation of E. coli HEC2B was 2.07 times that of E. coli HEC2A. It is shown that the codon-optimized heterologous gene cluster ectABC is more advantageous under the control of the Ppr promoter, and the yield of ectoine is higher.

[0112] List of primers used in this section

[0113] Primer Name Sequence 5’→3‘ pdhR-L.F GTATTACGGAGGCGCTACCC pdhR-L.R GTACCTTGGTTGGCGGATTTTGCTG pdhR-zeo.F AAATCCGCCAACCAAGGTACCCGGGGATCCTCTAGA pdhR-zeo.R TAAAGGCCAGATGGCGAGCAGGTCGACGATTCTACCG pdhR-R.F TGCTCGCCATCTGGCCTTTATCG pdhR-R.R TTGCGGAAGACTGGAAGGAC Ppr.F GGCCTCATTGGTATGACCAATTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATCGTGACTGGGAAAACCCTG Ppr.R TTGGTCATACCAATGAGGCCTATAGTGAGTCGTATTAGCAGGTCGACGATTCTACCG lacZ-L.F AGTGCCATGTCCGGTTTTCA lacZ-L.R TACCTCCGCTCACAATTCCACACA T7RNAP-zeo.F TGGAATTGTGAGCGGAGGTACCCGGGGATCCTCTAGA T7RNAP-zeo.R GAATTATCTCGCAGGTCGACGATTCTACCG PxylF.F GTCGACCTGCGAGATAATTCACAAGTGTGCGCTC PxylF.R CGTGTTCATCATGGTGTAGGGCCTTCTGTAGT T7RNAP.F CCTACACCATGATGAACACGATTAACATCGCTAAGA T7RNAP.R ACATCAACGGTTACGCGAACGCGAAGTCC lacZ-R.F GTTCGCGTAACCGTTGATGTTGAAGTGGCG lacZ-R.R TACGCGAAATACGGGCAGAC lfhA-L.F CGTATCGGACGCACTTTTGG lfhA-L.R GGGTACCCGTGAAAGCATTATCGCCGC lfhA-zeo.F TAATGCTTTCACGGGTACCCGGGGATCCTCTAGA lfhA-zeo.R ATTAATTTCGCGGGCAGGTCGACGATTCTACCG ect.F GACCTGCCCGCGAAATTAATACGACTCAC ect.R AATGGCGCAAAAAACCCCTCAAGACCCG lfhA-R.F GAGGGGTTTTTTGCGCCATTTTCATCAACGGCA lfhA-R.R TCTGCTCTTTCACCTGTGGC ycgH-L.F CTCCCCGGGTTTAGTTTGGG ycgH-L.R GTACCCAGCCACAGTTTCAAGTGCC ycgH-zeo.F TTGAAACTGTGGCTGGGTACCCGGGGATCCTCTAGA ycgH-zeo.R ATTAATTTCGCGGGCAGGTCGACGATTCTACCG ycgH-R.F GGTTTTTTGCTACGTCTCGCAGTTAGGGGG ycgH-R.R CGCTGGATTCAGGTTGCCAT

[0114] Example 2 Construction of a dual promoter expression system for the codon-optimized ectABC gene cluster

[0115] The codon-optimized ectABC gene cluster was exogenously introduced into the pseudogene ycgH locus by Cre / loxP technology and expressed under the Ppr promoter;

[0116] pECT2 was obtained by replacing the T7 promoter in plasmid pECT1 with the Ppr promoter;

[0117] The Ppr-ectOPT gene cluster fragment was obtained by using plasmid pECT2 as template and ect.F and ect.R as primers;

[0118] Primers (ycgH-zeo.F, ycgH-zeo.R) were designed using plasmid p7Z6 as a template to amplify the bleomycin resistance gene fragment;

[0119] Using Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (ycgH-LF, ycgH-LR) and downstream homology arm primers (ycgH-RF, ycgH-RR) were designed according to the pseudogene ycgH (GeneID: 2847703), and the upstream and downstream homology arm fragments of ycgH were obtained by PCR amplification. Both the upstream and downstream homology arms were located inside ycgH.

[0120] Using the fragment amplified in the above step as a template, the Ppr-ectOPT integration fragment was obtained by overlapping extension PCR, which contained about 757 bp of the upstream homology arm of the ycgH gene, about 685 bp of the downstream homology arm of the ycgH gene, about 538 bp of the bleomycin resistance gene fragment, and 2640 bp of the Ppr-ectOPT gene cluster fragment. The integration fragment after overlapping fusion was about 4620 bp, the original bacterial genome fragment size was about 2544 bp, and after deleting the resistance marker, it was about 4120 bp;

[0121] The above integration fragment was introduced into the Escherichia coli HEC2A of Example 1 to obtain positive transformants, and then introduced into plasmid pJM1. After eliminating the bleomycin resistance gene in the transformants, the temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC3 with the ectOPT gene cluster controlled by the Ppr promoter.

[0122] The above-mentioned E. coli HEC2A and HEC3 containing the ectoine synthesis gene were subjected to shake flask fermentation culture of ectoine for 24 hours according to Example 6. After liquid chromatography detection, the yield of ectoine in E. coli HEC2A was 1.82 g / L, and the yield of ectoine in E. coli HEC3 was 7.43 g / L. The yield of ectoine in shake flask fermentation of E. coli HEC3 was 4.08 times that of E. coli HEC2A. It shows that for the codon-optimized heterologous gene cluster ectABC, the expression efficiency of ectoine is higher under the control of dual promoters.

[0123] List of primers used in this section

[0124] Primer Name Sequence 5’→3‘ ect.F GACCTGCCCGCGAAATTAATACGACTCAC ect.R AATGGCGCAAAAAACCCCTCAAGACCCG ycgH-L.F CTCCCCGGGTTTAGTTTGGG ycgH-L.R GTACCCAGCCACAGTTTCAAGTGCC ycgH-zeo.F TTGAAACTGTGGCTGGGTACCCGGGGATCCTCTAGA ycgH-zeo.R ATTAATTTCGCGGGCAGGTCGACGATTCTACCG ycgH-R.F GGTTTTTTGCTACGTCTCGCAGTTAGGGGG ycgH-R.R CGCTGGATTCAGGTTGCCAT

[0125] Example 3 P pr Increased expression of ppc gene under control

[0126] At the pseudogene yneO site, the Cre / loxP technique was used to introduce P pr The phosphoenolpyruvate carboxylase gene ppc under the control of the ppc gene is used to achieve the controlled incremental expression of the ppc gene;

[0127] (1) Using Escherichia coli MG1655 (ATCC 47076) as a template, a pair of primers (ppc.F, ppc.R) were designed according to the sequence of the ppc gene (GeneID: 948457), and the ppc gene fragment was obtained by PCR amplification;

[0128] (2) Using plasmid pPRZ as a template, primers (ppc-zeo.F, ppc-zeo.R) were designed to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0129] (3) Using Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (yneO-LF, yneO-LR) and downstream homology arm primers (yneO-RF, yneO-RR) were designed according to the pseudogene yneO (GeneID: 7751623). The upstream and downstream homology arm fragments of yneO were obtained by PCR amplification. Both the upstream and downstream homology arms were located inside the yneO gene.

[0130] (4) Using the fragment amplified in the above step as a template, an integrated fragment of the incremental expression of the ppc gene was obtained by overlapping extension PCR, which contained about 710 bp of the upstream homology arm of the yneO gene, about 642 bp of the downstream homology arm of the yneO gene, about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter, and about 2652 bp of the ppc gene fragment. The integrated fragment after overlapping fusion was about 4660 bp, the original bacterial genome fragment size was about 2920 bp, and after deleting the resistance marker, it was about 4160 bp;

[0131] (5) The above integration fragment was introduced into the E. coli HEC3 of Example 2 to obtain positive transformants, and then the plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain E. coli HEC4 that incrementally expressed the ppc gene controlled by the Ppr promoter;

[0132] The above-mentioned E. coli HEC3 and HEC4 containing the ectoine synthesis gene were subjected to shake flask fermentation of ectoine for 24 hours according to Example 6. After liquid chromatography detection, the output of ectoine of E. coli HEC3 was 7.43g / L, and the output of ectoine of E. coli HEC4 was 9.37g / L. The output of ectoine of shake flask fermentation of E. coli HEC4 was 1.26 times that of E. coli HEC3. It is shown that the incremental expression of phosphoenolpyruvate carboxylase gene ppc under the control of Ppr dynamically increases the sugar metabolism tributary according to the concentration level of pyruvic acid in the cell, so that the output of ectoine is increased.

[0133] List of primers used in this section

[0134] Primer Name Sequence 5’→3‘ yneO-L.F TTCAGCGTCTGGTGCAAGTC yneO-L.R TCTAGAGGATCCCAGAGTCTGCGTACCGTGATG ppc-zeo.F AGACTCTGGGATCCTCTAGAGATTCTACCGTT ppc-zeo.R GTTCGTTCATGGTATATCTCCTTCTTAAAGT ppc.F GAGATATACCATGAACGAACAATATTCCGCA ppc.R ACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTAGCCGGTATTACGCAT yneO-R.F TGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCGCTTACTCACGCGATGTTG yneO-RR GTCGCACCGTATTGATTGCC

[0135] Example 4 P pr Incremental expression of lysC gene under control

[0136] At the pseudogene ilvG site, the Cre / loxP technique was used to introduce P pr The aspartate kinase gene lysC under the control of lysC gene is realized to achieve the controlled incremental expression of lysC gene;

[0137] (1) Using Escherichia coli MG1655 (ATCC 47076) as a template, a pair of primers (lysC.F, lysC.R) were designed according to the sequence of the gene lysC (GeneID: 948531), and the lysC gene fragment was obtained by PCR amplification;

[0138] (2) Using plasmid pPRZ as a template, primers (lysC-zeo.F, lysC-zeo.R) were designed to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0139] (3) Using Escherichia coli MG1655 (ATCC 47076) as a template, upstream homology arm primers (ilvG-LF, ilvG-LR) and downstream homology arm primers (ilvG-RF, ilvG-RR) were designed according to the pseudogene ilvG (GeneID: 7751623). The upstream and downstream homology arm fragments of ilvG were obtained by PCR amplification. The upstream homology arm was located upstream of the ilvG gene, and the downstream homology arm was located inside the ilvG gene.

[0140] (4) Using the fragment amplified in the above step as a template, an integrated fragment of the incremental expression of the lysC gene was obtained by overlapping extension PCR, which contained about 698 bp of the upstream homologous arm of the ilvG gene, about 678 bp of the downstream homologous arm of the ilvG gene, about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter, and about 1400 bp of the lysC gene fragment. The integrated fragment after overlapping fusion was about 3430 bp, the original bacterial group fragment size was about 1960 bp, and after deleting the resistance marker, it was about 2970 bp;

[0141] (5) The above integration fragment was introduced into the E. coli HEC4 of Example 3 to obtain positive transformants, and then the plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain E. coli HEC5 that incrementally expressed the lysC gene controlled by the Ppr promoter;

[0142] The above-mentioned E. coli HEC4 and HEC5 containing the ectoine synthesis gene were subjected to shake flask fermentation of ectoine for 24 hours according to Example 6. After liquid chromatography detection, the output of ectoine in E. coli HEC4 was 9.37 g / L, and the output of ectoine in E. coli HEC5 was 11.92 g / L. The output of ectoine in shake flask fermentation of E. coli HEC5 was 1.27 times that of E. coli HEC4. It is shown that the incremental expression of aspartate kinase gene lysC under the control of Ppr dynamically increases the amino acid metabolic tributary according to the concentration level of pyruvic acid in the cell, thereby increasing the output of ectoine.

[0143] List of primers used in this section

[0144] Primer name Sequence 5'→3' ilvG-LF ATGCAGCGGACAAAGGATGA ilvG-LR ATCTCTAGAGGATCCCAAGCCCGGTTATCAGGTTGG lysC-zeo.F GCTTGGGATCCTCTAGAGATTCTACC lysC-zeo.R TTCAGACATGGTATATCTCCTTCTTAAAGT lysC.F GGAGATATACCATGTCTGAAATTGTTGTCTC lysC.R ACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGGACAAGAAAATCAATACGGC ilvG-RF TGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGTGACCGGCAAACTGAACAC ilvG-RR TGGTCTTTCCGGGTGATGTG

[0145] Example 5 Inhibition of branch metabolism and activation of glyoxylate pathway by antisense transcription

[0146] Antisense transcription inhibits the expression of thrA and lysA, reduces the flow of threonine, methionine, and lysine metabolic branches, and reduces their feedback inhibition. Antisense transcription inhibits the expression of the iclR gene, activates the glyoxylate pathway, and increases the accumulation of the important precursor oxaloacetate. Antisense transcription inhibits the expression of the zwf gene, reducing the metabolic flow of 6-phosphate glucose to the HMP pathway. Antisense transcription is a regulatory system that is ubiquitous in a variety of organisms. Its main mode of action can be divided into two types: the production of antisense RNA (asRNA) or transcriptional interference. Among them, asRNA can bind to the mRNA of the target gene, reduce its stability and translation efficiency, and thus inhibit the expression of the target gene; while transcriptional interference occurs between RNA polymerases (RNAPs). When the extension directions of the two RNAPs are opposite, the two will physically collide, causing them to fall off the DNA chain, thereby interfering with the effective synthesis of mRNA. (If the background technology is available, it can be deleted here)

[0147] (1) Inhibition of thrA gene expression

[0148] Inserting a reverse Ppr promoter downstream of the thrA gene inhibits the expression of thrA through antisense transcription, thereby reducing the flux of metabolic branches threonine, methionine, and lysine.

[0149] Primers (thrA-zeo.F, thrA-zeo.R) were designed using plasmid pPRZ as a template to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0150] Using Escherichia coli MG1655 (ATCC 47076) as a template, the left homology arm primers (thrA-LF, thrA-LR) and right homology arm primers (thrA-RF, thrA-RR) of the antisense promoter were designed according to the downstream sequence of the gene thrA (GeneID: 945803). The homology arm fragments on both sides of the thrA antisense promoter were obtained by PCR amplification. The left homology arm was located downstream of the thrA gene, and the right homology arm was located inside the thrA gene.

[0151] Using the fragment amplified in the above step as a template, an integrated fragment for inhibiting thrA gene expression by antisense transcription was obtained by overlapping extension PCR, which contained about 525 bp of the left homologous arm downstream of the thrA gene, about 566 bp of the right homologous arm downstream of the thrA gene, and about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter. The integrated fragment after overlapping fusion was about 1700 bp, the original bacterial group fragment size was about 1090 bp, and after deleting the resistance marker, it was about 1240 bp;

[0152] The above integration fragment was introduced into the E. coli HEC5 of Example 4 to obtain a positive transformant, and then the plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformant, and the temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain the E. coli HEC6 that inhibits the expression of the thrA gene by antisense transcription;

[0153] (2) Inhibition of lysA gene expression

[0154] Inserting a reverse Ppr promoter downstream of the lysA gene inhibits the expression of lysA through antisense transcription, thereby reducing the flux of lysine in the metabolic tributary

[0155] Primers (lysA-zeo.F, lysA-zeo.R) were designed using plasmid pPRZ as a template to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0156] Using Escherichia coli MG1655 (ATCC 47076) as a template, the left homology arm primers (lysA-LF, lysA-LR) and right homology arm primers (lysA-RF, lysA-RR) of the antisense promoter were designed according to the downstream sequence of the gene lysA (GeneID: 947313). The homology arm fragments on both sides of the lysA antisense promoter were obtained by PCR amplification. The left homology arm was located downstream of the lysA gene, and the right homology arm was located inside the lysA gene.

[0157] Using the fragment amplified in the above step as a template, an integrated fragment for inhibiting the expression of the lysA gene by antisense transcription was obtained by overlapping extension PCR, which contained about 518 bp of the left homology arm downstream of the lysA gene, about 657 bp of the right homology arm downstream of the lysA gene, and about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter. The integrated fragment after overlapping fusion was about 1780 bp, the original bacterial group fragment size was about 1180 bp, and after deleting the resistance marker, it was about 1320 bp;

[0158] The above integration fragment was introduced into Escherichia coli HEC6 to obtain positive transformants, and then the plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC7 that inhibits the expression of the lysA gene by antisense transcription;

[0159] (3) Inhibit the expression of the iclR gene and activate the glyoxylate pathway

[0160] Inserting a reverse Ppr promoter downstream of the iclR gene inhibits the expression of the iclR gene through antisense transcription, activates the glyoxylate pathway, and increases the accumulation of the important precursor oxaloacetate

[0161] Primers (iclR-zeo.F, iclR-zeo.R) were designed using plasmid pPRZ as a template to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0162] Using Escherichia coli MG1655 (ATCC 47076) as a template, the left homology arm primers (iclR-LF, iclR-LR) and the right homology arm primers (iclR-RF, iclR-RR) of the antisense promoter were designed according to the downstream sequence of the gene iclR (GeneID: 948524). The homology arm fragments on both sides of the iclR antisense promoter were obtained by PCR amplification. The left homology arm was located downstream of the iclR gene, and the right homology arm was located inside the iclR gene.

[0163] Using the fragment amplified in the above step as a template, an integrated fragment for inhibiting the expression of the iclR gene by antisense transcription was obtained by overlapping extension PCR, which contained about 544 bp of the left homologous arm downstream of the iclR gene, about 576 bp of the right homologous arm downstream of the iclR gene, and about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter. The integrated fragment after overlapping fusion was about 1730 bp, the original bacterial group fragment size was about 1120 bp, and after deleting the resistance marker, it was about 1260 bp;

[0164] The above integration fragment was introduced into Escherichia coli HEC7 to obtain positive transformants, and then the plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC8 that inhibited the expression of the iclR gene by antisense transcription;

[0165] (4) Inhibition of zwf gene expression

[0166] Inserting a reverse Ppr promoter downstream of the zwf gene inhibits the expression of the zwf gene through antisense transcription, thereby reducing the metabolic flux of 6-phosphate glucose to the HMP pathway.

[0167] Primers (zwf-zeo.F, zwf-zeo.R) were designed using plasmid pPRZ as a template to amplify the bleomycin resistance gene fragment with the Ppr promoter;

[0168] Using Escherichia coli MG1655 (ATCC 47076) as a template, the left homology arm primers (zwf-LF, zwf-LR) and the right homology arm primers (zwf-RF, zwf-RR) of the antisense promoter were designed according to the downstream sequence of the gene zwf (GeneID: 946370). The homology arm fragments on both sides of the zwf antisense promoter were obtained by PCR amplification. The left homology arm was located downstream of the zwf gene, and the right homology arm was located inside the zwf gene.

[0169] Using the fragment amplified in the above step as a template, an integrated fragment for antisense transcription inhibition of zwf gene expression was obtained by overlapping extension PCR, which contained about 591 bp of the left homologous arm downstream of the zwf gene, about 535 bp of the right homologous arm downstream of the zwf gene, and about 607 bp of the bleomycin resistance gene fragment with the Ppr promoter. The integrated fragment after overlapping fusion was about 1730 bp, the original bacterial group fragment size was about 1130 bp, and after deleting the resistance marker, it was about 1270 bp;

[0170] The above integration fragment was introduced into Escherichia coli HEC8 to obtain positive transformants, and then plasmid pJM1 was introduced to eliminate the bleomycin resistance gene in the transformants. The temperature-sensitive plasmid pJM1 was eliminated by culturing at 42°C to obtain Escherichia coli HEC9 that inhibits the expression of the zwf gene by antisense transcription.

[0171] The above-mentioned E. coli HEC8 and HEC9 containing the ectoine synthesis gene were subjected to shake flask fermentation of ectoine for 24 hours according to Example 6. According to liquid chromatography, the yield of ectoine in E. coli HEC8 was 13.44 g / L, and the yield of ectoine in E. coli HEC9 was 16.31 g / L. The yield of ectoine in shake flask fermentation of E. coli HEC9 was 1.21 times that of E. coli HEC8. It shows that the expression of zwf gene is inhibited by antisense transcription, the metabolic flow from 6-phosphate glucose to HMP pathway is reduced, and the yield of ectoine is significantly increased.

[0172] Example 6 Shake flask culture of Ecdoin production strains

[0173] The genetically engineered bacteria producing ectoine are cultured and tested in shake flasks, and the specific steps are as follows:

[0174] (1) Slant activation: Use an inoculation loop to dip the genetically engineered bacteria that produce ectoine stored in a -80°C refrigerator and inoculate it into a solid test tube slant culture medium. Incubate at 37°C for 14-16 hours. Scrape a loop of the slant bacterial moss with the inoculation loop and transfer it to the second-generation test tube slant culture medium and incubate for 14-16 hours.

[0175] (2) Seed bottle culture: Scrape a loop of the bacterial culture from the slant and transfer it to the seed bottle culture medium. Culture at 37°C and 220 rpm for 6-9 hours.

[0176] (3) Shake flask fermentation culture: Inoculate the shake flask fermentation medium at 10% inoculum and culture at 37°C, 220 rpm for 24 h. Use ammonia water to control the pH at 6.8-7.2 through phenol red colorimetric reagent. Use 60% glucose for feeding during the process. Add xylose every 4 h to make the final xylose concentration of 10 g / L.

[0177] The activated slant culture medium consists of 1 g / L glucose, 5 g / L peptone, 3 g / L yeast extract, 5 g / L sodium chloride, 20 g / L agar strips, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0178] The composition of the seed bottle culture medium is: glucose 20g / L, peptone 2g / L, yeast powder 4g / L, corn steep liquor 5g / L, citric acid 0.3g / L, KH2PO4 0.5g / L, K2HPO4 0.5g / L, MgSO4 0.1g / L, FeSO4 5mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0179] The shake flask fermentation medium consists of: 20 g / L glucose, 1 g / L peptone, 2 g / L yeast powder, 10 g / L corn steep liquor, 2 g / L citric acid, 2 g / L KH2PO4, 2 g / L K2HPO4, 2 g / L MgSO4, 1 g / L FeSO4, 10 mg / L MnSO4, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0180] After 24 hours of shake flask fermentation, liquid chromatography showed that the production of ectoine by the genetically engineered bacteria Escherichia coli HEC9, which efficiently produces ectoine, was 16.31 g / L.

[0181] Ectoin production of different strains in shake flask culture (g / L)

[0182] strain Genetic changes Source strain Ecdoin production (g / L) HEC1 lacZ::PxylF-T7RNAP MG1655 / HEC2A lfhA::T7-ectOPT HEC1 1.82 HEC2B ycgH::Ppr-ectOPT HEC1 3.76 HEC3 ycgH::Ppr-ectOPT HEC2A 7.43 HEC4 yneO::Ppr-ppc HEC3 9.37 HEC5 ilvG::Ppr-lysC HEC4 11.92 HEC6 thrA::revPpr HEC5 / HEC7 lysA::revPpr HEC6 / HEC8 iclR::revPpr HEC7 13.44 HEC9 zwf::revPpr HEC8 16.31

[0183] Example 7 50L fermenter culture of Ecdoin production strain

[0184] The genetically engineered bacteria for efficiently producing ectoine were cultured and tested in a 50L fermentation tank, and the specific steps are as follows:

[0185] (1) Slant activation: Use an inoculation loop to dip into the genetically engineered bacteria that efficiently produce ectoine and store it in a -80℃ refrigerator and inoculate it into a solid test tube slant culture medium. Incubate at 37℃ for 14-16 hours. Scrape a loop of the slant bacterial moss with the inoculation loop and transfer it to the second-generation eggplant bottle slant culture medium and culture it for 14-16 hours.

[0186] (2) Preparation of bacterial suspension: Wash the slant bacteria with sterile saline to make a bacterial suspension.

[0187] (3) Seed culture: Inoculate the bacterial suspension into the seed culture medium, control the pH to 7.0-7.2 with ammonia water, culture at 37°C, dissolved oxygen 20%-40%, and culture for 6-9 hours.

[0188] (4) Fermentation culture: Inoculate the fermentation medium at 10% inoculum, control the pH at 7.0-7.2 with ammonia water, 37°C, and 20%-40% dissolved oxygen. Cultivate until the sugar concentration is below 1.5 g / L, feed with 60% glucose to maintain the sugar concentration at 0.5-1.5 g / L, and add xylose after 8 hours to make the final xylose concentration 12 g / L. The fermentation cycle is 46 hours.

[0189] The activated slant culture medium consists of 1 g / L glucose, 5 g / L peptone, 3 g / L yeast extract, 5 g / L sodium chloride, 20 g / L agar strips, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0190] The composition of the seed culture medium is: glucose 20g / L, peptone 2g / L, yeast powder 5g / L, corn steep liquor 10g / L, xylose 5g / L, citric acid 1g / L, KH2PO4 0.5g / L, K2HPO4 0.5g / L, MgSO4 0.1g / L, FeSO4 5mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0191] The fermentation medium consists of 20 g / L glucose, 2 g / L yeast powder, 15 g / L corn steep liquor, 2 g / L citric acid, 2 g / L KH2PO4, 2 g / L K2HPO4, 1 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 0.5 mg / L vitamin B1, and the rest is water, and the pH is adjusted to 7.0-7.2.

[0192] The dissolved oxygen is corrected to 100% based on the dissolved oxygen in air.

[0193] After fermentation in a 50L fermenter for 46 hours, liquid chromatography showed that the ectoine production of the genetically engineered bacteria Escherichia coli HEC9, which efficiently produces ectoine, reached 63.26 g / L.

[0194] In Example 1 of the present invention, the yield of ectoine in shake flask fermentation of Escherichia coli HEC2B is 2.07 times that of Escherichia coli HEC2A, indicating that the codon-optimized heterologous gene cluster ectABC is more advantageous under the control of the Ppr promoter, and the yield of ectoine is higher.

[0195] In Example 2 of the present invention, the yield of ectoine in shake flask fermentation of Escherichia coli HEC3 was 4.08 times that of Escherichia coli HEC2A, indicating that the expression efficiency of ectoine was higher under the control of the codon-optimized heterologous gene cluster ectABC with dual promoters.

[0196] In Example 3 of the present invention, the yield of ectoine in shake flask fermentation of Escherichia coli HEC4 is 1.26 times that of Escherichia coli HEC3, indicating that the incremental expression of the phosphoenolpyruvate carboxylase gene ppc under the control of Ppr dynamically increases the sugar metabolism tributary according to the concentration level of pyruvate in the cells, thereby increasing the yield of ectoine.

[0197] In Example 4 of the present invention, the yield of ectoine in shake flask fermentation of Escherichia coli HEC5 is 1.27 times that of Escherichia coli HEC4, indicating that the incremental expression of the aspartate kinase gene lysC under the control of Ppr dynamically increases the amino acid metabolic tributary according to the concentration level of pyruvate in the cells, thereby increasing the yield of ectoine.

[0198] In Example 5 of the present invention, the yield of ectoine by shake flask fermentation of Escherichia coli HEC9 was 1.21 times that of Escherichia coli HEC8, indicating that the expression of the zwf gene was inhibited by antisense transcription, reducing the metabolic flow of 6-phosphate glucose to the HMP pathway, thereby significantly increasing the yield of ectoine.

[0199] In Example 6 of the present invention, shake flask fermentation was carried out for 24 hours, and the yield of ectoine by the genetically engineered bacteria Escherichia coli HEC9 that efficiently produces ectoine was 16.31 g / L as detected by liquid chromatography.

[0200] In Example 7 of the present invention, fermentation was carried out in a 50L fermentation tank for 46 hours, and liquid chromatography detection showed that the ectoine production of the genetically engineered bacteria Escherichia coli HEC9 that efficiently produced ectoine reached 63.26 g / L.

[0201] Sequence 1

[0202] ectOPT

[0203]

[0204] Sequence 2

[0205] T7 promoter

[0206] taatacgactcactatagg

[0207] Sequence 3

[0208] T7 terminator

[0209] ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg

[0210] Sequence 4

[0211] lacZ

[0212]

[0213] Sequence 5

[0214] PxylF

[0215] gagataattcacaagtgtgcgctcgctcgcaaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgttttcccctgtttagttgctaaaaattggttacgtttatcgcggtgattgttacttattaaaactgtcctctaactacagaaggccctacaccatg

[0216] Sequence 6

[0217] RNAP

[0218]

[0219] Sequence 7

[0220] f

[0221]

[0222] Sequence 8

[0223] HkDJ

[0224]

[0225] pecking order 9

[0226] yneO

[0227]

[0228] Sequence 10

[0229] ilvG

[0230]

[0231] Sequence 11

[0232] thrA

[0233]

[0234] Sequence 12

[0235] lysA

[0236]

[0237] Sequence 13

[0238] iclR

[0239] atggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgccaccgcaccagcgactggacaggttcagtctttaacgcgtggcctgaaattactggagtggattgccgaatccaatggcagtgtggcactcacggaactggcgcaacaagccgggttacccaattccacgacccaccgcctgctaaccacgatgcaacagcagggtttcgtgcgtcaggttggcgaactgggacattgggcaatcggcgcacatgcctttatggtcggcagcagctttctccagagccgtaatttgttagcgattgttcaccctatcctgcgcaatctaatggaagagtctggcgaaacggtcaatatggcggtgcttgatcaaagcgatcacgaagcgattattatcgaccaggtacagtgtacgcatctgatgcgaatgtccgcgcctatcggcggtaaattgccgatgcacgcttccggtgcgggtaaagcctttttagcccaactgagcgaagaacaggtgacgaagctgctgcaccgcaaagggttacatgcctatacccacgcaacgctggtgtctcctgtgcatttaaaagaagatctcgcccaaacgcgcaaacggggttattcatttgacgatgaggaacatgcactggggctacgttgccttgcagcgtgtattttcgatgagcaccgtgaaccgtttgccgcaatttctatttccggaccgatttcacgtattaccgatgaccgcgtgaccgagtttggcgcgatggtgattaaagcggcgaaggaagtgacgctggcgtacggtggaatgcgctga

[0240] Sequence 14

[0241] zwf

[0242]

[0243] Sequence 15

[0244] ppc

[0245]

[0246] Sequence 16

[0247] LysC

[0248]

[0249] Sequence 17

[0250] pdhR

[0251] atggcctacagcaaaatccgccaaccaaaactctccgatgtgattgagcagcaactggagtttttgatcctcgaaggcactctccgcccgggcgaaaaactcccaccggaacgcgaactggcaaaacagtttgacgtctcccgtccctccttgcgtgaggcgattcaacgtctcgaagcgaagggcttgttgcttcgtcgccagggtggcggcacttttgtccagagcagcctatggcaaagcttcagcgatccgctggtggagctgctctccgaccatcctgagtcacagtatgacttgctcgaaacacgacacgccctggaaggtatcgccgcttattacgccgcgctgcgtagtaccgatgaagacaaggaacgcatccgtgaactccaccacgccatagagctggcgcagcagtctggcgatctggacgcggaatcaaacgccgtactccagtatcagattgccgtcaccgaagcggcccacaatgtggttctgcttcatctgctaaggtgtatggagccgatgttggcccagaatgtccgccagaacttcgaattgctctattcgcgtcgcgagatgctgccgctggtgagtagtcaccgcacccgcatatttgaagcgattatggccggtaagccggaagaagcgcgcgaagcatcgcatcgccatctggcctttatcgaagaaattttgctcgacagaagtcgtgaagagagccgccgtgagcgttctctgcgtcgtctggagcaacgaaagaattag

[0252] Sequence 18

[0253] Ppr promoter (the underlined part is the pdhR box): taatacgactcactataggcctc attggtatg accaattagaaataattttgtttaactttaagaaggaga.

Claims

1. A genetically engineered bacterium for efficiently producing ectoin, wherein the genetically engineered bacterium uses Escherichia coli MG1655, numbered ATCC 47076, as a host, and is characterized in that: A) Based on the pyruvate-responsive transcription factor PdhR, a PdhR binding site PdhR Box was inserted downstream of the T7 promoter by fusion PCR, so that its transcription was inhibited by the pyruvate-responsive transcription factor PdhR. The Ppr promoter regulated by pyruvate was constructed by seamless cloning using the ClonExpress kit; B) Exogenously introduced T7 RNAP and expressed under PxylF; C) Exogenously introduce the codon-optimized ectABC gene cluster, one copy under the T7 promoter and the other copy under the constructed strong promoter Ppr regulated by pyruvate; under the control of Ppr, the phosphoenolpyruvate carboxylase gene ppc and the aspartate kinase gene lysC are incrementally expressed; D) Inhibit the expression of thrA and lysA through antisense transcription, reduce the flux of threonine, methionine, and lysine metabolic branches and reduce their feedback inhibition; inhibit the expression of iclR gene through antisense transcription, activate the glyoxylate pathway, and increase the accumulation of the important precursor oxaloacetate; inhibit the expression of zwf gene through antisense transcription, and reduce the metabolic flux of 6-phosphate glucose to the HMP pathway; The codon-optimized ectABC gene cluster modifies part of the codons of the original exogenous gene ectABC gene cluster sequence according to a set rule to make it suitable for Escherichia coli expression, and finally artificially synthesizes the codon DNA fragment ectOPT; The codon-optimized ectABC gene cluster is ectOPT, and its nucleotide sequence is shown in SEQ ID No. 1 in the sequence table; The nucleotide sequence of the T7 promoter is shown in the sequence table as SEQ ID No. 2; The nucleotide sequence of the T7 terminator is shown in the sequence listing as SEQ ID No.3; The nucleotide sequence of the PxylF gene is shown in the sequence table as SEQ ID No.5; The nucleotide sequence of the RNAP gene is shown in the sequence table SEQ ID No.6; The GeneID of the thrA gene is 945803, and the nucleotide sequence is shown in the sequence table as SEQ ID No.11; The GeneID of the lysA gene is 947313, and the nucleotide sequence is shown in the sequence table as SEQ ID No.12; The GeneID of the iclR gene is 948524, and the nucleotide sequence is shown in the sequence table as SEQ ID No.13; The GeneID of the zwf gene is 946370, and the nucleotide sequence is shown in the sequence table as SEQ ID No.14; The GeneID of the ppc gene is 948457, and the nucleotide sequence is shown in the sequence table SEQ ID No.15; The GeneID of the lysC gene is 948531, and the nucleotide sequence is shown in the sequence table as SEQ ID No.16; The GeneID of the PdhR gene is 944827, and the nucleotide sequence is shown in the sequence table as SEQ ID No. 17; The nucleotide sequence of the Ppr promoter is shown in the sequence listing SEQ ID No.

18.

2. The method for preparing a genetically engineered bacterium for efficiently producing ectoin as claimed in claim 1, characterized in that: Follow these steps: a) Based on the transcription factor PdhR, a pyruvate-responsive transcription factor PdhR binding site PdhR Box was inserted downstream of the T7 promoter by fusion PCR, and its sequence was ATTGGTATGACCAAT, so that its transcription was inhibited by the pyruvate-responsive transcription factor PdhR, and a plasmid pPRZ with a Ppr promoter was constructed by seamless cloning using the kit ClonExpress, thereby obtaining a Ppr promoter regulated by pyruvate; b) inserting the T7 RNA polymerase gene T7RNAP expressed under PxylF into the lacZ gene site by Cre / loxP technology; c) against Halomonas elongatus ( Halomonas elongata ) After codon optimization, the ectA, ectB, and ectC genes of DSM 2581 were synthesized to obtain gene cluster fragments ectOPT, and the GenBank IDs of the proteins encoded by the ectA, ectB, and ectC genes were CBV42472, CBV42473, and CBV42474, respectively; At the pseudogene lfhA site, the codon-optimized exogenous gene ectOPT was introduced by the Cre / loxP technique and expressed under the T7 promoter; at the pseudogene ycgH site, the codon-optimized second copy of the exogenous gene ectOPT was introduced by the Cre / loxP technique and expressed under the Ppr promoter; d) At the pseudogene yneO site, Cre / loxP technology was used to introduce P pr The phosphoenolpyruvate carboxylase gene ppc under the control of the pseudogene was introduced into the ilvG site by Cre / loxP technology to achieve the controlled incremental expression of the ppc gene. P pr The aspartate kinase gene lysC under the control of lysC gene is realized to achieve the controlled incremental expression of lysC gene; e) inhibiting the expression of thrA and lysA through antisense transcription, reducing the flux of threonine, methionine, and lysine metabolic branches and reducing their feedback inhibition; inhibiting the expression of iclR gene through antisense transcription, activating the glyoxylate pathway, and increasing the accumulation of the important precursor oxaloacetate; inhibiting the expression of zwf gene through antisense transcription, reducing the metabolic flux of 6-phosphate glucose to the HMP pathway; The codon-optimized ectABC gene cluster modifies part of the codons of the original exogenous gene ectABC gene cluster sequence according to a set rule to make it suitable for Escherichia coli expression, and finally artificially synthesizes the codon DNA fragment ectOPT; The codon-optimized ectABC gene cluster is ectOPT, and its nucleotide sequence is shown in SEQ ID No. 1 in the sequence table; The nucleotide sequence of the T7 promoter is shown in the sequence table as SEQ ID No. 2; The nucleotide sequence of the T7 terminator is shown in the sequence table as SEQ ID No.3; The GeneID of the lacZ gene is 945006, and the nucleotide sequence is shown in the sequence table as SEQ ID No.4; The nucleotide sequence of the PxylF gene is shown in the sequence table as SEQ ID No.5; The nucleotide sequence of the RNAP gene is shown in the sequence table SEQ ID No.6; The GeneID of the lfhA gene is 944908, and the nucleotide sequence is shown in the sequence table as SEQ ID No.7; The GeneID of the ycgH gene is 2847703, and the nucleotide sequence is shown in the sequence table as SEQ ID No.8; The GeneID of the yneO gene is 7751623, and the nucleotide sequence is shown in the sequence table as SEQ ID No.9; The GeneID of the ilvG gene is 948279, and the nucleotide sequence is shown in the sequence table as SEQ ID No.10; The GeneID of the thrA gene is 945803, and the nucleotide sequence is shown in the sequence table as SEQ ID No.11; The GeneID of the lysA gene is 947313, and the nucleotide sequence is shown in the sequence table as SEQ ID No.12; The GeneID of the iclR gene is 948524, and the nucleotide sequence is shown in the sequence table as SEQ ID No.13; The GeneID of the zwf gene is 946370, and the nucleotide sequence is shown in the sequence table as SEQ ID No.14; The GeneID of the ppc gene is 948457, and the nucleotide sequence is shown in the sequence table SEQ ID No.15; The GeneID of the lysC gene is 948531, and the nucleotide sequence is shown in the sequence table as SEQ ID No.16; The GeneID of the PdhR gene is 944827, and the nucleotide sequence is shown in the sequence table as SEQ ID No. 17; The nucleotide sequence of the Ppr promoter is shown in the sequence listing SEQ ID No.

18.

3. The use of a genetically engineered bacterium for efficiently producing ectoine as claimed in claim 1, characterized in that: The specific steps of producing Ecdoin by shake flask fermentation are as follows: Slant activation: Use an inoculation loop to dip the genetically engineered bacteria that efficiently produce ectoine and store it in a -80℃ refrigerator and inoculate it into a solid test tube slant culture medium. Cultivate it at 33℃-37℃ for 14-16h. Scrape a loop of slant bacterial lawn with the inoculation loop and transfer it to the second-generation test tube slant culture medium for 14-16h. Seed bottle culture: scrape a loop of the slant culture and transfer it to the seed bottle culture medium, culture at 33℃-37℃, 200-220rpm for 6-9h; Shake flask fermentation culture: inoculate shake flask fermentation medium at 5-12% inoculation rate, culture at 33°C-37°C, 200-220rpm for 22-26h; use ammonia water to control pH at 6.8-7.2 through phenol red colorimetric agent, and use 50%-70% glucose for feeding during the process; add xylose at 3-12h to make the final concentration of xylose 5-20g / L; The activated slant medium consists of 1-2 g / L glucose, 5-10 g / L peptone, 3-6 g / L yeast extract, 5-10 g / L sodium chloride, 15-25 g / L agar strip, and the rest is water, and the pH is adjusted to 7.0-7.2; The composition of the seed bottle culture medium is: glucose 20-30g / L, peptone 2-4g / L, yeast powder 4-6g / L, corn steep liquor 5-15g / L, citric acid 0.3-2g / L, KH2PO4 0.5-3g / L, K2HPO4 0.5-3g / L, MgSO4 0.1-2g / L, FeSO4 5-15mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2; The shake flask fermentation medium consists of: glucose 20-30 g / L, peptone 1-2 g / L, yeast powder 2-4 g / L, corn steep liquor 10-20 g / L, citric acid 2-5 g / L, KH2PO4 2-5 g / L, K2HPO4 2-5 g / L, MgSO4 1-5 g / L, FeSO4 10-50 mg / L, MnSO4 10-50 mg / L, and the rest is water, and the pH is adjusted to 7.0-7.

2.

4. The use of a genetically engineered bacterium for efficiently producing ectoin as claimed in claim 1, characterized in that: The specific steps of producing Ecdoin by fermentation in a fermenter are as follows: Slant activation: Use an inoculation loop to dip the genetically engineered bacteria that efficiently produce ectoine and store it in a -80℃ refrigerator and inoculate it into a solid test tube slant culture medium. Cultivate it at 33℃-37℃ for 14-16h. Scrape a loop of slant bacterial moss with the inoculation loop and transfer it to the second generation eggplant bottle slant culture medium for 14-16h. Preparation of bacterial suspension: Wash the slant bacteria with sterile saline to make a bacterial suspension; Seed culture: inoculate the bacterial suspension into the seed culture medium, control the pH to 7.0-7.2, 33℃-37℃, dissolved oxygen 20%-40%, and culture for 6-9h; Fermentation culture: inoculate the fermentation medium at an inoculum rate of 5-12%, control the pH at 7.0-7.2 with ammonia water, maintain the temperature at 33°C-37°C, and maintain the dissolved oxygen at 20%-40%. Cultivate until the sugar concentration is below 0.5g / L, feed with 50%-70% glucose to maintain the sugar concentration at 0.5-1.5g / L, add xylose every 5-20h to make the final xylose concentration 5-20g / L, and the fermentation cycle is 40-48h; Slant activation medium composition: glucose 1-2g / L, peptone 5-10g / L, yeast extract 3-6g / L, sodium chloride 5-10g / L, agar strip 15-25g / L, the rest is water, and the pH is adjusted to 7.0-7.2; The composition of the seed culture medium is: glucose 20-30g / L, peptone 2-4g / L, yeast powder 5-10g / L, corn steep liquor 10-15g / L, xylose 5-20g / L, citric acid 1-5g / L, KH2PO4 0.5-3g / L, K2HPO4 0.5-3g / L, MgSO4 0.1-2g / L, FeSO4 5-15mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2; The fermentation medium is composed of: glucose 20-30g / L, yeast powder 2-6g / L, corn steep liquor 15-20g / L, citric acid 2-6g / L, KH2PO4 2-5g / L, K2HPO4 2-5g / L, MgSO4 1-5g / L, FeSO4 10-50mg / L, MnSO4 10-50mg / L, vitamin B1 0.5-5mg / L, and the rest is water, and the pH is adjusted to 7.0-7.2; The dissolved oxygen is corrected to 100% based on the dissolved oxygen in air.

Images