A non-tissue culture young embryo generation system of lily and a high-efficiency genetic transformation method
By establishing a non-tissue culture embryogenesis system for lilies and optimizing genetic transformation methods, the problems of difficulty in obtaining lily embryos and low transformation efficiency were solved, achieving efficient genetic transformation and providing important technical support for lily variety improvement.
Patent Information
- Application Number
- CN202310663878.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-06
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2043-06-06
AI Technical Summary
Existing Agrobacterium lily-mediated genetic transformation methods suffer from low transformation efficiency, complex operation, and high contamination rate. Furthermore, obtaining lily embryos is difficult, and immature embryogenesis systems limit the application of gene transformation.
A non-tissue culture embryogenesis system for lilies was established. Seeds were disinfected with potassium permanganate and cultured in outdoor light-exposed culture dishes to obtain embryos with embryo tips reaching 1-2 mm in length. High-efficiency genetic transformation was carried out using negative pressure infection and co-culture methods, and the Agrobacterium concentration, infection time, and co-culture time were optimized.
This method enables efficient acquisition and genetic transformation of lily embryos, achieving a transformation efficiency of 74.7% and a stable transformation rate of 62.0%. It simplifies the operation process, reduces the risk of contamination, and provides a rapid and effective method for genetic improvement.
Smart Images

Figure CN117016092B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of lily genetic breeding technology, specifically relating to a non-tissue culture embryogenesis system for lilies and an efficient genetic transformation method. Background Technology
[0002] Lilies are perennial herbaceous bulbous plants belonging to the genus *Lilium* in the family Liliaceae. As cut flowers, lilies have become one of the world's five major cut flowers. With their large, vibrant, and beautiful flowers, lilies are loved for their ornamental, edible, and medicinal uses. There are over 100 wild species and 9,000 cultivars worldwide. However, traditional breeding methods suffer from drawbacks such as long cycles, low efficiency, and unclear breeding objectives, limiting the development of breeding work. Less than 50% of these lily resources are used for breeding, and some are endangered. With technological advancements, more and more plants are using molecular breeding methods to improve varieties and cultivate new lily varieties with stress resistance, disease resistance, and novel horticultural traits. This is of great significance for lily breeding, and establishing an efficient and stable genetic transformation system has a crucial impact on the success of lily gene transformation. Therefore, how to establish a stable genetic transformation system for lilies has become a current research hotspot.
[0003] Currently, numerous genetic transformation methods are used for lilies, including Agrobacterium-mediated transformation, gene gun transformation, electroporation induction, PEG-mediated transformation, virus-mediated transformation, ovary injection, and microinjection. The main methods used for lily transgenic transformation are Agrobacterium-mediated transformation and gene gun transformation. Compared to the latter, Agrobacterium-mediated transformation is often used due to its advantages such as inducing heritable variation in plants, low copy number, fixed insertion sites, and simple offspring inheritance. However, lilies are monocotyledonous plants, and using Agrobacterium-mediated transformation may encounter some problems, such as insensitivity to Agrobacterium, unstable T-DNA integration, and poor genetic stability of transformed plant traits. Therefore, the Agrobacterium-mediated transformation system for lilies is not yet mature. Currently, only a few studies have reported successful Agrobacterium-mediated transformation of lilies, and the transformation efficiency remains a problem for researchers, still some distance from practical application. For example, Mercuri et al. (2003) successfully transformed rolA, rolB, and rolC genes using embryogenic callus induced from lily pedicels and receptacles as recipients, with a transformation rate of only 0.8%. Hoshi et al. (2004) rubbed the callus surface with sandpaper before infecting it with callus induced by Oriental lily filaments and removed NH4NO3 in a co-culture medium. After screening with hygromycin, they obtained six resistant lines. GUS histochemical staining and reverse PCR detection confirmed that all six lines were positive, with a transformation rate of 3%. Therefore, establishing an efficient, stable, and highly operable lily genetic transformation system has become an urgent problem to be solved.
[0004] In plants, the embryo is a multicellular tissue with totipotency. Under normal conditions, it can mature and develop into a complete plant, and its cell division is active, making it a potential material for transformation. However, due to the complexity and precision of directly infecting young embryos, researchers often choose to use callus tissue induced from young embryos as the recipient material for genetic transformation. Hoshi et al. (2004) used lily embryogenic callus as the recipient material and achieved a high transformation rate. However, their embryogenic callus cultivation was based on tissue culture-based genetic transformation experiments, which required stringent experimental conditions, were complex, and had a long timeframe, thus limiting the induction and maintenance of embryogenic callus. Furthermore, most lily genetic transformation systems use tissue culture to cultivate materials and then cultivate callus tissue under sterile conditions to induce exogenous genes via Agrobacterium-mediated transformation to obtain transformed plants. The disadvantages of this method are a high contamination rate and the potential for damage to the material during sterilization, thus affecting the transformation efficiency. Currently, Agrobacterium-mediated genetic transformation of immature embryos has been successfully verified in maize and wheat. For example, invention patent CN104988178A discloses a method for genetic transformation of maize immature embryos by infecting them with Agrobacterium, which includes the following steps: (1) preparing Agrobacterium infection solution: dissolve Agrobacterium plaques in an infection solution with a pH of 4.8 to 5.6, shake slowly at room temperature for 3 to 4 hours, and adjust OD 550 The concentration is 0.5-0.55 to obtain Agrobacterium infection solution; (2) Infection and co-culture: The maize embryo is infected with the infection solution. After the infection is completed, the infection solution is removed, and the Agrobacterium infection solution is added. The embryo is infected in the dark for 5-15 minutes. After the infection is completed, the embryo is placed with the shield side facing up in the co-culture medium and cultured in the dark at 19-23°C for 1-4 days. Invention patent CN101307324 discloses an Agrobacterium-mediated genetic transformation method for the Chinese wheat variety Xinchun 9. The method includes the following steps: Infecting the embryo of the Chinese wheat variety Xinchun 9 with the target Agrobacterium, and then co-culturing to introduce the target gene into the wheat embryo. However, it has not been applied to Lilium plants at present, and there are very few related reports. The reason is that the embryo development system of Lilium is not yet mature, and it is relatively difficult to obtain embryos. Summary of the Invention
[0005] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a non-tissue culture embryogenesis system for lilies and an efficient genetic transformation method. This system enables outdoor cultivation of lily embryos without tissue culture technology, solving the problems of difficulty in obtaining lily embryos and the low transformation efficiency of existing Agrobacterium tumefaciens transformation methods that rely on tissue culture and require resistance screening. This provides new ideas and options for future research on gene function in lilies and genetic improvement of disease resistance.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: a non-tissue culture embryogenesis system for lilies, comprising the following steps: lily seeds are rinsed and disinfected with potassium permanganate; the disinfected lily seeds are then wrapped in sterile, moist gauze and placed in a sterile culture dish; the culture dish is then covered with plastic wrap and placed in a light incubator for cultivation. The light cultivation time is 12 h / d at a light cultivation temperature of 23±2℃, and the dark cultivation time is 12 h / d at a dark cultivation temperature of 18±2℃. The gauze is kept moist during the cultivation process until the embryo tip reaches 1–2 mm in length. Typically, lily seeds have a low germination rate and a longer germination time in culture media; however, using the present invention, lily seeds begin to germinate successively after 4 days, and embryos with an embryo tip length of approximately 1.5 mm can be selected after about a week. Furthermore, the present invention does not require tissue culture.
[0007] Preferably, the concentration of the potassium permanganate solution is 0.5%, and the disinfection time is 10 minutes.
[0008] Another object of the present invention is to provide a highly efficient genetic transformation method using lily embryos, comprising the following steps:
[0009] 1) Agrobacterium was activated in YEB medium to obtain an activated bacterial solution. The bacterial solution was then centrifuged to collect the bacterial cells, and the bacterial solution was resuspended in MS conversion liquid to a concentration of OD. 600 The concentration was set at 0.4–0.6 to obtain purified Agrobacterium bacterial solution for later use.
[0010] 2) Add AS-activated bacterial solution to the purified Agrobacterium tumefaciens solution obtained in step 1), let stand for 2-4 hours, then add the lily embryos obtained by the method described above, and infect them under negative pressure. After infection, wash the transformation material with pure water, then co-culture, and finally plant them in soil for seedling cultivation. In this way, treatment under negative pressure can create tiny wounds on the surface of plant tissues, and the wound sites secrete phenolic substances that help Agrobacterium tumefaciens adsorb and penetrate through intercellular spaces into plant cells, thereby improving the instantaneous transformation efficiency of plants. Furthermore, the key to this invention lies in selecting embryos of suitable embryonic age for transformation, which is beneficial for the integration of exogenous genes into the plant genome. Studies have found that when the embryonic tip length is about 1.5 mm, the infection effect is better; embryos that are too young (<1 mm) are difficult to identify, while embryos that are too old (>2 mm) are prone to breakage during infection.
[0011] Preferably, the activation involves streaking Agrobacterium on YEB solid medium containing kanamycin and rifampicin, culturing it at 26–30°C for 36–48 hours, picking a single colony and inoculating it into YEB liquid medium, and then culturing it at 25–30°C and 180–250 rpm for 24–36 hours to obtain a first-activated bacterial solution. The first-activated bacterial solution is then added to YEB liquid medium at a volume ratio of 1:50 for further activation, and the culture is continued with shaking for about 12 hours to obtain the activated bacterial solution.
[0012] Preferably, the concentration of the AS activating solution is 100 μmol / L.
[0013] Preferably, the negative pressure is at 0.1 MPa.
[0014] Preferably, the inoculation time is 15–35 minutes. During the Agrobacterium infection stage, the infection time is closely related to the sensitivity of the recipient material to Agrobacterium, the infectivity of Agrobacterium, and the control of Agrobacterium reproduction in the later stages. Therefore, there are significant differences between recipient materials and explants. If the infection time in this invention is too short, Agrobacterium will not act sufficiently on the recipient material, resulting in poor transformation and failure to achieve the experimental objective; if the infection time is too long, the recipient material is susceptible to Agrobacterium toxicity, increasing the contamination rate and easily leading to browning and death.
[0015] Preferably, the co-culture is carried out in the dark at 21°C for 2–4 days. Co-culture is the optimal time for transformation. Agrobacterium requires a certain amount of time to transfer the exogenous gene into the host plant. If the co-culture time is too short, the transformation of the plant by Agrobacterium cannot be completed. However, if the co-culture time is too long, Agrobacterium will over-proliferate, causing irreversible damage to the plant and reducing the instantaneous transformation rate. In the experiment, the transformation rate was not high when only the infection conditions were changed without co-culture in the early stage. However, after co-culture, not only was the transformation rate improved, but the transformation effect was also significantly different from before.
[0016] Preferably, the Agrobacterium is Agrobacterium strain EHA105.
[0017] Preferably, the recovery culture is carried out in a humid environment for 5 to 7 days, with a light culture time of 12 hours / day and a light culture temperature of 23±2℃, and a dark culture time of 12 hours / day and a dark culture temperature of 18±2℃.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] 1. This invention establishes a non-tissue culture embryogenesis system for lilies. This system involves placing seeds in sterilized petri dishes, wrapping them in sterile, moist gauze, and culturing them outdoors. The embryo culture environment of this invention is simpler than with other materials, and the embryos are easier to obtain than callus tissue, with a shorter cycle than callus induction. The germination rate of lily seeds is also very high. This invention not only solves the problem of contamination but also shortens the time cycle to a certain extent. It represents a breakthrough in lily embryogenesis systems, solving the problem of difficult lily embryo acquisition, providing a new approach to lily embryo culture, and also providing important basic materials for future genetic improvement of lilies.
[0020] 2. This invention establishes, for the first time, a highly efficient Agrobacterium-mediated genetic transformation system for lily embryos using lily embryos as recipient material. Through optimization of embryo age, Agrobacterium concentration, infection time, and co-culture time, a transformation efficiency of 74.7% was achieved. No tissue culture or resistance medium screening was required, and a stable seedling transformation rate of 62.0% was obtained. This transformation efficiency is significantly higher than the previously reported efficiency (around 25%), solving the problem of low efficiency in Agrobacterium-mediated lily genetic transformation. This method is not only simple to operate but also allows the entire genetic transformation experiment to be conducted outdoors, simplifying the direct infection of embryos and greatly reducing the operational difficulty. It effectively avoids contamination of the recipient material during culture, improving the efficiency of genetic transformation and providing a rapid and effective method for lily variety improvement. This invention establishes a highly efficient lily embryo genetic transformation system, providing important technical support for lily genetic transformation and showing promising application prospects. Attached Figure Description
[0021] Figure 1 The lily embryogenesis system is shown below; A is an ungerminated embryo, B is a germinating embryo, with a scale bar of 2 cm; C is a magnified image of the embryo under a microscope, with a scale bar of 1 mm.
[0022] Figure 2 GUS staining analysis was performed on transformed embryos; A and D were negative controls; B to C were positive embryos; E to G were positive embryos cultured for 4 days; H to I were positive embryos cultured for 1 week. The scale bar was 1 mm.
[0023] Figure 3 The effect of negative pressure infection time on GUS expression rate in immature embryos. Letters a, b, and c indicate significant differences, according to Duncan's test (P < 0.05).
[0024] Figure 4 The effect of co-culture time on GUS expression rate in immature embryos. Letters a, b, and c indicate significant differences, and Duncan's test was used (P < 0.05).
[0025] Figure 5A photo of embryos being grown into plants in soil.
[0026] Figure 6 To detect the GUS gene in the genome of transformed plants by PCR.
[0027] Figure 7 The effect of ultrasound treatment time on the expression rate of GUS in immature embryos. Letters a, b, and c indicate significant differences, and Duncan's test was used (P < 0.05). Detailed Implementation
[0028] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. Unless otherwise specified, the raw materials described in the embodiments are ordinary commercially available products. Unless otherwise specified, the experimental methods described in the embodiments are performed according to conventional molecular biology experimental methods.
[0029] The culture medium involved in this invention:
[0030] MS medium composition: per liter of medium contains 1650 mg NH4NO3, 1900 mg KNO3, 440 mg CaCl2·2H2O, 370 mg MgSO4·7H2O, 170 mg KH2PO4, 0.83 mg KI, 6.2 mg H2BO3, 22.3 mg MnSO4·4H2O, 8.6 mg ZnSO4·7H2O, 0.25 mg Na2MoO4·5H2O, 0.025 mg CuSO4·5H2O, 0.025 mg CoCl2·6H2O, 27.8 mg FeSO4·7H2O, 37.3 mg Na2-EDTA·2H2O, 100 mg inositol, 0.5 mg nicotinic acid, 2 mg glycine, 0.5 mg pyridoxine hydrochloride (vitamin B6), and 0.4 mg thiamine hydrochloride (vitamin B1).
[0031] YEB medium components: 5.0 g·L -1 +1.0g·L yeast powder -1 +Peptone 5.0g·L -1 +5.0g·L of sucrose -1 +MgSO4 0.493 g·L -1 +Kan 100mg·L -1 +Rif 100mg·L -1 pH = 7.0 (solid culture medium with 6 g / L agar added) - 1)
[0032] MS conversion fluid: MS + Kan 100 mg·L -1 +Rif 100mg·L -1
[0033] I. A non-tissue culture embryogenesis system for lilies and an efficient genetic transformation method
[0034] Example 1
[0035] 1) Using *Lilium davidii* seeds as material, the seeds were first placed in a petri dish, then the petri dish was wrapped with gauze and secured with a rubber ring, allowing the seeds to be thoroughly rinsed in running tap water for 3 days. After 3 days, the seeds were removed and treated with 0.5% potassium permanganate solution for different times (5 min, 10 min, and 15 min). The results are shown in Table 1.
[0036] Table 1
[0037]
[0038] As shown in Table 1, within 5–15 minutes, the number of contaminated lily seeds first decreased and then increased with the increase of treatment time with 0.5% potassium permanganate solution. The disinfection effect was best when the disinfection time was 10 minutes, and no contaminated seeds were found.
[0039] 2) Place the sterilized lily seeds from step 1) into a sterilized petri dish. First, wrap the petri dish with plastic wrap, then place three layers of sterile gauze on top. Use tweezers to neatly arrange the seeds in the petri dish, ensuring they are evenly distributed on the gauze (e.g., ...). Figure 1 A) Then, cover the petri dish with two layers of sterile gauze, wrap the seeds in the moist gauze, and then cover the petri dish with a layer of plastic wrap. Maintaining a moist and warm environment is beneficial for seed germination. Finally, the petri dish containing the seeds should be placed in a multi-functional light incubator for cultivation. The light incubation time is 12 hours / day at a light incubation temperature of 23℃, and the dark incubation time is 12 hours / day at a dark incubation temperature of 18℃. Water every 2-3 days, keeping the gauze moist, until the embryonic tip emerges. Results showed that lily seeds began to germinate after 4 days, and embryonic tips of about 1.5 mm in length could be selected after about a week (e.g., ...). Figure 1 B and Figure 1 C).
[0040] 3) Agrobacterium strain EHA105 (containing the pLGNe-GUS reporter gene) was inoculated using the streak method into a solution containing 100 mg / L of Kan. -1 and Rif 100mg·L -1 After incubation at 28°C for 36–48 h on YEB solid medium, single colonies were selected and inoculated into YEB liquid medium containing the same antibiotic. The cultures were then incubated at 28°C and 200 rpm. -1At a controlled rotation speed, culture for 18–24 hours to obtain a first-stage activated bacterial solution. Add the first-stage activated bacterial solution to YEB liquid medium at a volume ratio of 1:50 for reactivation, and culture under the same conditions with shaking for 10–12 hours to obtain a second-stage activated bacterial solution. Aliquot the two activated bacterial solutions into 50 mL centrifuge tubes and centrifuge at 4000 rpm. -1 Centrifuge for 10 min, collect the bacterial cells, and resuspend the bacterial culture in MS solution to the OD concentration. 600 The concentration was set to 0.5, and the purified bacterial solution was obtained.
[0041] 4) Add the collected purified bacterial solution to 100 μmol / L AS (acetylsuccinone) solution and let it stand for 2-4 hours. Then add the embryos obtained in step 2) and treat them under negative pressure (0.1 MPa) using a circulating water vacuum pump. The negative pressure inoculation times are 0 min, 15 min, 25 min and 35 min respectively. The 0 min negative pressure inoculation is when the embryos and purified bacterial solution are left to stand naturally for 15 min. During inoculation, gently shake to ensure that the bacterial solution and embryos are in full contact.
[0042] 5) After the infection is completed, the transformation material is washed with pure water. Then, the transformed embryos are placed on a culture dish containing sterile and moist gauze, and then placed in a multi-functional light incubator for recovery culture (light culture time is 12h / d, light culture temperature is 23±2℃, dark culture time is 12h / d, dark culture temperature is 18±2℃). GUS staining analysis is performed after 5 days.
[0043] GUS detection of immature embryos: Immature embryos were washed with pure water and then placed in GUS staining solution, kept at 37℃ for 6-10 hours. After staining, they were destained multiple times with 70% alcohol. Embryos with blue spots were then counted under a microscope. Figure 2 As can be seen, compared with the negative control (untransformed plants), different parts of the positive embryos showed varying degrees of blue spots, and the expression level of the GUS gene varied among different parts of the embryo, with the most significant expression in the roots. GUS staining was used to analyze the transformation efficiency of the embryos. The GUS embryo transformation rate was calculated as: GUS-stained embryos / number of transformed embryos * 100. The GUS staining results were observed and statistically analyzed. The experiment was repeated three times, and the average was calculated. The results are shown in Table 2 and... Figure 3 As shown.
[0044] Table 2
[0045]
[0046] The results showed that when the negative pressure infection time was 0 min (natural resting time for 15 min), the conversion rate of lily embryos was only 17.8%, while when the negative pressure infection time was 15 min, the conversion rate of lily embryos was 38.9%, significantly higher than the control. With increasing infection time, the conversion efficiency of embryos further improved. When the negative pressure infection time was 25 min, the conversion rate of embryos increased to 47.8%; when the negative pressure infection time was 35 min, the conversion efficiency was the highest, reaching 55.6%. Therefore, an infection time of 35 min yielded the best conversion efficiency.
[0047] Example 2
[0048] 1) Using *Lilium pulcherrimum* seeds as material, first place the seeds in a petri dish, then wrap the petri dish with gauze, and secure the gauze with a rubber ring, allowing the seeds to be thoroughly rinsed in running tap water for 3 days. After 3 days, remove the seeds and treat them with a 0.5% potassium permanganate solution for 10 minutes.
[0049] 2) Place the sterilized lily seeds from step 1) into a sterilized petri dish. First, wrap the petri dish with plastic wrap, then place three layers of sterile gauze on top. Use tweezers to neatly arrange the seeds in the petri dish, ensuring they are evenly distributed on the gauze. Then cover the dish with two more layers of sterile gauze, encasing the seeds in moist gauze. Finally, cover the petri dish with another layer of plastic wrap, maintaining a consistently warm and humid environment conducive to seed germination. The petri dish containing the seeds should then be placed in a multi-functional light incubator for cultivation. The light incubation period is 12 hours / day at a light temperature of 23°C, and the dark incubation period is 12 hours / day at a dark temperature of 18°C. Water every 2-3 days, keeping the gauze moist, until the embryonic tip emerges.
[0050] 3) Agrobacterium strain EHA105 (containing the pLGNe-GUS reporter gene) was inoculated using the streak method into a solution containing 100 mg / L of Kan. -1 and Rif 100mg·L -1 After incubation at 28°C for 36–48 h on YEB solid medium, single colonies were selected and inoculated into YEB liquid medium containing the same antibiotic. The cultures were then incubated at 28°C and 200 rpm. -1 At a controlled rotation speed, culture for 18–24 hours to obtain a first-stage activated bacterial solution. Add the first-stage activated bacterial solution to YEB liquid medium at a volume ratio of 1:50 for reactivation, and culture under the same conditions with shaking for 10–12 hours to obtain a second-stage activated bacterial solution. Aliquot the two activated bacterial solutions into 50 mL centrifuge tubes and centrifuge at 4000 rpm. -1 Centrifuge for 10 min, collect the bacterial cells, and resuspend the bacterial culture in MS solution to the OD concentration. 600 The concentration was set to 0.5, and the purified bacterial solution was obtained.
[0051] 4) Add the collected purified bacterial solution to 100 μmol / L AS (acetylsyl syringone) solution and let it stand for 2-4 hours. Then add the embryonic tip length of about 1.5 mm obtained in step 2) and treat it with negative pressure (0.1 MPa) using a circulating water vacuum pump. The negative pressure infection time is 35 min. Gently shake during infection to ensure that the bacterial solution and the embryonic tip are in full contact.
[0052] 5) After infection, the transformation material was washed with pure water. The transformed embryos were then placed on a culture dish containing sterile and moist gauze and placed in a multi-functional light incubator. They were first co-cultured in the dark at 21°C for 2 days, and then incubated in recovery culture (light culture time 12h / d, light culture temperature 23±2°C, dark culture time 12h / d, dark culture temperature 18±2°C) for 5 days. After that, GUS staining analysis was performed to analyze the transformation efficiency of the embryos (as above).
[0053] Examples 3-4 differ from Example 2 in co-cultivation time, but other steps are the same. The results are shown in Table 3 and... Figure 4 As shown.
[0054] Table 3
[0055]
[0056]
[0057] The results showed that although no co-culture process was performed in Example 1, dark culture was still present during the recovery culture, thus the conversion rate of the embryos could still reach 55.6%. Compared with no co-culture, the conversion rate of the embryos was further improved after co-culture. Furthermore, the conversion rate initially increased and then decreased with increasing co-culture time. Specifically, the conversion rate reached its highest point at 74.4% when the co-culture time was 3 days; further increases in co-culture time actually decreased the conversion rate. This may be because excessively long co-culture times can cause Agrobacterium to over-proliferate, resulting in irreversible damage to the plants and reducing the embryo conversion rate.
[0058] The transformation was carried out according to Example 3. After co-cultivation, the embryos were placed in a multifunctional light incubator for recovery cultivation (light cultivation time 12h / d, light cultivation temperature 23±2℃; dark cultivation time 12h / d, dark cultivation temperature 18±2℃) for 7 days. Then, they were transplanted into soil for seedling cultivation. The transformed embryos were cultivated until true leaves appeared (e.g., Figure 5 Plants with true leaves were randomly selected, and DNA was extracted from the entire lily plant for GUS gene testing.
[0059] Using extracted DNA as a template, and GUS-F (ATGTTACGTCCTGTAGAAACC) and GUS-R (GTGACGCACAGTTCATAGVG) as primers, PCR amplification of the GUS gene was performed. The PCR reaction system was 20 μL: 10 μL 2xTaq mix, 0.5 μL GUS-F, 0.5 μL GUS-R, 1 μL DNA, and 8 μL ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, and 72℃ final extension for 5 min, for 34 cycles. The PCR amplification products were analyzed by agarose gel electrophoresis. The results are as follows: Figure 6 As shown.
[0060] The results showed that the GUS gene was detected in the genome extracted from the transformed plants, and the target band was amplified in 5 out of 6 samples, indicating that the gene from Agrobacterium was successfully transferred into the genome of lily seedlings. Repeated parallel experiments were conducted, and the final stable transformation rate of seedlings was about 62.0%.
[0061] Comparative Example 1
[0062] Negative pressure infection was replaced by ultrasonic infection, with an ultrasonic power of 40 kHz and ultrasonic times of 0 min (after allowing the embryos and purified cells to stand naturally for 10 min), 10 min, 15 min, and 20 min, respectively. Other steps were the same as in Example 3. The results are shown in Table 4 and... Figure 7 As shown.
[0063] Table 4
[0064]
[0065] The results showed that when the ultrasound treatment time was 0 min (10 min of natural rest), the conversion rate of lily embryos was 10.0%, while when the ultrasound treatment time was 10 min, the conversion rate was 23.3%. With the increase of ultrasound treatment time, the conversion efficiency of embryos further improved, reaching 30% after 15 min of treatment. However, extending the treatment time to 20 min did not significantly increase the conversion efficiency, with a conversion rate of only 37.8%. Therefore, the negative pressure infection method of this invention is significantly better than the effect of ultrasound treatment.
[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A highly efficient genetic transformation method using lily embryos, characterized in that, Includes the following steps: 1) Agrobacterium was activated in YEB medium to obtain an activated bacterial solution. The bacterial solution was then centrifuged to collect the bacterial cells, and the bacterial solution was resuspended in MS conversion liquid to a concentration of OD. 600 The concentration was set at 0.4~0.6 to obtain purified Agrobacterium bacterial solution for later use; 2) Add AS activation solution to the purified Agrobacterium tumefaciens solution obtained in step 1), let stand for 2-4 hours, then add the obtained lily embryos, and infect them under a negative pressure of 0.1 MPa. After the infection is completed, wash the transformation material with pure water, then co-culture, and then restore the culture before planting it in soil for seedling cultivation. The lily embryos were obtained by the following steps: lily seeds were rinsed and disinfected with potassium permanganate solution. The disinfected lily seeds were then wrapped in sterile, moist gauze and placed in a sterile petri dish. The petri dish was then covered with plastic wrap and placed in a light incubator for cultivation. The light cultivation time was 12 h / d and the light cultivation temperature was 23±2℃. The dark cultivation time was 12 h / d and the dark cultivation temperature was 18±2℃. The gauze was kept moist during the cultivation process. The lily embryos were obtained when the embryo tip grew to 1~2 mm.
2. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The concentration of the potassium permanganate solution is 0.5%, and the disinfection time is 10 min.
3. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The activation process involves streaking Agrobacterium on YEB solid medium, culturing it at 26–30°C for 36–48 h, then picking a single colony and inoculating it into YEB liquid medium. The culture is then shaken at 25–30°C and 180–250 rpm for 24–36 h to obtain a first-activated bacterial solution. This first-activated bacterial solution is then added to YEB liquid medium at a volume ratio of 1:50 for further activation, followed by shaking and culturing for 12 h to obtain the final activated bacterial solution.
4. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The working concentration of the AS-activated bacterial solution is 100 μmol / L.
5. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The infection time is 15-35 minutes.
6. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The co-culture was carried out in the dark at 21°C for 2-4 days.
7. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The Agrobacterium is Agrobacterium strain EHA105.
8. The efficient genetic transformation method using lily embryos according to claim 1, characterized in that, The recovery culture was carried out in a humid environment for 5-7 days, with a light culture time of 12 hours / day and a light culture temperature of 23±2℃, and a dark culture time of 12 hours / day and a dark culture temperature of 18±2℃.
Citation Information
Patent Citations
Non-tissue culture corn genetic transformation method
CN102051377A
Method for promoting germination of Lilium sargentiae seeds
CN103918376A
Genetic transformation method utilizing agrobacterium tumefaciens to infect maize immature embryos
CN104988178A
Agrolbacterium-mediated method for transforming lily from exogenous gene
CN1563392A