Tobacco nitrate transporter NtNPF7.4 and its encoding gene, gene editing vector and application

Abstract

The present invention discloses a tobacco nitrate transporter NtNPF7.4 and its encoding gene, gene editing vector and application. The present invention cloned the encoding gene NtNPF7.4 gene of the tobacco nitrate transporter, and detected different tobacco tissues and organs by fluorescent quantitative PCR. The results showed that the gene was expressed in the roots, stems, leaves and flowers of tobacco. Subcellular localization analysis found that the NtNPF7.4 protein was located on the cell membrane, and the expression level of the NtNPF7.4 gene in the leaves was significantly increased after salt stress, indicating that the NtNPF7.4 protein was involved in the chloride ion transport process. The NtNPF7.4 gene was knocked out using a gene editing vector to construct a gene knockout strain. The chloride ion content in the roots and leaves of the knockout strain was significantly increased, which made it possible to cultivate tobacco enriched in chloride ions, providing a new direction for improving the low chloride content of flue-cured tobacco in my country.

Description

Technical Field

[0001] The invention relates to tobacco nitrate transporter NtNPF7.4 and its encoding gene, gene editing vector and application, belonging to the technical field of plant genetic engineering. Background Art

[0002] Plants have two types of nitrate transporters, NRT1 / PRT and NRT2, of which NRT1 / PRT is also named NPF. The NPF transport substrates reported so far include NO3 - , Cl-, peptides, various hormones (IAA, ABA, GA, etc.), mustard oil, etc. The plant NPF family is generally composed of 8 subfamily genes. Studies have shown that NPF7.3, a member of the NPF7 subfamily, may also participate in K transport in addition to nitrate transport. + Atnpf7.3 mutants also show lateral root development and leaf senescence phenotypes. In addition, some literatures have mentioned that NPF7.3 may also be involved in Cl- transport, but there is no conclusive evidence so far.

[0003] Chlorine is one of the essential nutrients for the growth and development of flue-cured tobacco. Too high or too low chlorine content in flue-cured tobacco will reduce the quality and yield of tobacco leaves. The chlorine content of tobacco leaves is generally related to the chlorine content in the soil. Therefore, the chlorine content of tobacco leaves in areas with low soil chlorine content, such as the southwest region, southwestern Hubei, southern Anhui and Fujian Province, is relatively low. Generally, studies have shown that the chlorine content of high-quality tobacco leaves should be between 0.3% and 0.8%, but the chlorine content of tobacco leaves in most tobacco-growing areas in my country is lower than 0.3%, which affects the quality of tobacco leaves to a certain extent (Reference: Comparative Study on the Characteristics of Chlorine Content in Flue-cured Tobacco in Major Tobacco-growing Areas in my country. Guizhou Agricultural Science, 2008, 36(1): 106-107). The regional characteristics and distribution of chlorine content in flue-cured tobacco in my country's major tobacco-growing areas show that the chlorine content in flue-cured tobacco is generally low in my country. High-chlorine flue-cured tobacco is mainly distributed in the north (77.32%), and low-chlorine flue-cured tobacco is mainly distributed in the south (78.23%). Among the 2712 flue-cured tobacco samples investigated, 53.32% of the samples had a chlorine content of less than 0.30%, 43.10% of the samples had a chlorine content of 0.30% to 0.80%, and 3.43% of the samples had a chlorine content of more than 0.80% (Reference: Study on Regional Characteristics of Chlorine Content in Flue-cured Tobacco in China's Major Tobacco-growing Areas. Chinese Soil and Fertilizer, 2010 (2): 49-54). The application of chlorine-containing fertilizers can increase the chlorine content in the soil, but the increase is closely related to the amount of chlorine applied, rainfall and soil permeability, and improper use of chlorine-containing fertilizers can also cause soil chloride ion pollution.

[0004] With the increasing maturity of molecular biotechnology and the achievements of molecular biology of chloride nutrition in other crops, studying the chloride transport mechanism, chloride ion channels, and effective genes for chloride absorption in tobacco leaves at the molecular level is of great significance to solving the problem of low chloride content in flue-cured tobacco in my country. Therefore, in order to further understand the molecular regulation of chloride ion transport and achieve more accurate tobacco breeding, it is an urgent problem to explore and screen proteins and coding genes involved in the chloride ion transport process. Summary of the invention

[0005] To solve the above problems, the first object of the present invention is to provide a tobacco nitrate transporter encoding gene NtNPF7.4 gene, which can encode the tobacco nitrate transporter NtNPF7.4 and enrich the regulatory network of tobacco chloride ion transport related genes.

[0006] The second purpose of the present invention is to provide tobacco nitrate transporter NtNPF7.4. The present invention proves through experiments that NtNPF7.4 protein is involved in the absorption and transport of chloride ions in tobacco, laying the foundation for regulating the chloride ion content in tobacco, which is of great significance to the precision breeding of tobacco.

[0007] The third object of the present invention is to provide a gene editing vector, which can achieve effective knockout of the NtNPF7.4 gene, successfully obtain tobacco plants with NtNPF7.4 gene knockout, inhibit the expression of the NtNPF7.4 gene, and thereby increase the chloride ion content in the roots and leaves of the knockout tobacco plants.

[0008] The fourth object of the present invention is to provide the application of the tobacco nitrate transporter encoding gene NtNPF7.4 gene or gene editing vector in the breeding of chloride ion enriched tobacco varieties. Through the CRISPR / Cas9 gene editing technology, the NtNPF7.4 gene in the tobacco plant is knocked out, and it is found that the chloride ion content in the roots and leaves of the knockout strain is significantly increased, thereby obtaining a tobacco variety with accumulated chloride ion content.

[0009] The fifth object of the present invention is to provide an application of NtNPF7.4 gene knockout tobacco plants in improving low chloride content in flue-cured tobacco in soil with low chloride ion content.

[0010] In order to achieve the above object, the technical solution adopted by the tobacco nitrate transporter encoding gene NtNPF7.4 of the present invention is:

[0011] The nucleotide sequence of the tobacco nitrate transporter encoding gene NtNPF7.4 is:

[0012] (1) the nucleotide sequence shown in SEQ ID NO.1;

[0013] (2) A nucleotide sequence in which one or more nucleotides are replaced and / or deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0014] The beneficial effect of the above technical solution is that: the present invention cloned the tobacco nitrate transporter encoding gene NtNPF7.4 by designing specific primers, and through fluorescence quantitative PCR analysis, in normal tobacco plants, the NtNPF7.4 gene is mainly expressed in roots, stems, leaves and flowers.

[0015] In order to achieve the above object, the technical solution adopted by the tobacco nitrate transporter NtNPF7.4 of the present invention is:

[0016] The amino acid sequence of tobacco nitrate transporter NtNPF7.4 is:

[0017] (1) the amino acid sequence shown in SEQ ID NO.2;

[0018] (2) A derivative protein having the same function as the amino acid sequence shown in SEQ ID NO. 2, wherein one or more amino acid residues are replaced and / or deleted and / or added.

[0019] The beneficial effect of the above technical solution is that: it has been verified that the tobacco nitrate transporter NtNPF7.4 of the present invention is closely related to the absorption and transport of chloride ions in tobacco.

[0020] In order to achieve the above-mentioned purpose, the technical solution adopted by the gene editing vector of the present invention is:

[0021] A gene editing vector, wherein the gene editing vector comprises a target site knockout sequence designed according to the NtNPF7.4 gene, and the nucleotide sequence of the NtNPF7.4 gene is shown in SEQ ID NO.1.

[0022] The beneficial effect of the above technical solution is that the gene-knockout tobacco obtained by using CRISPR / Cas9 technology has a better and more stable effect in inhibiting gene expression compared with the VIGS strain, and can be passed on to the next generation.

[0023] As a further improvement, the knockout primer sequence designed based on the target site knockout sequence is as follows:

[0024] NtNPF7.4-T1_F: GATTGATGGAAGTGTGGATAAGCA (as shown in SEQ ID NO. 12);

[0025] NtNPF7.4-T1_R: AAACTGCTTATCCACACTTCCATC (as shown in SEQ ID NO. 13).

[0026] In order to achieve the above-mentioned object, the technical scheme adopted by the application of the tobacco nitrate transporter encoding gene NtNPF7.4 gene or gene editing vector in the breeding of chloride ion enriched tobacco varieties of the present invention is:

[0027] Application of tobacco nitrate transporter encoding gene NtNPF7.4 gene or gene editing vector in the breeding of chloride ion enriched tobacco varieties.

[0028] The beneficial effect of the above technical solution is that: the present invention uses CRISPR / Cas9 technology to knock out the NtNPF7.4 gene in tobacco, inhibit its expression, and obtain tobacco plants with NtNPF7.4 gene knockout. Detection found that the chloride ion content in the roots and leaves of the obtained NtNPF7.4 gene knockout strain was significantly increased, which provides a new research object for the regulation of chloride ion content in tobacco and other plants, and enriches the gene network of chloride ion regulation in tobacco.

[0029] As a further improvement, the NtNPF7.4 gene was knocked out, and the chloride ion content in tobacco roots and leaves was significantly increased.

[0030] The beneficial effect of the above technical solution is that: through the detection of NtNPF7.4 gene knockout strains, the present invention found that compared with the control tobacco plants, the chloride ion content in the roots and leaves of the NtNPF7.4 gene knockout strains was significantly increased, and a chloride ion-enriched tobacco variety was obtained, laying the foundation for the precise breeding of chloride ion-enriched tobacco.

[0031] As a further improvement, the chloride ion-enriched tobacco variety is obtained by the following method: the gene editing vector is transformed into Agrobacterium as an infection liquid, and then the tobacco is transformed, and the chloride ion-enriched tobacco variety is obtained by screening and identification.

[0032] The beneficial effects of the above technical solution are that the knockout tobacco strains obtained by the Agrobacterium transformation method are highly operable, short in time and have a high success rate.

[0033] In order to achieve the above object, the technical scheme of the present invention for using the NtNPF7.4 gene knockout tobacco plant in improving the low chloride content of flue-cured tobacco in soil with low chloride ion content is:

[0034] Application of NtNPF7.4 gene knockout tobacco plants in improving low chloride content in flue-cured tobacco in soil with low chloride ion content.

[0035] The beneficial effect of the above technical solution is that: the present invention found that knocking out the NtNPF7.4 gene in tobacco can significantly increase the chloride ion content in the roots and leaves, which lays a theoretical foundation for improving the low chloride ion content in flue-cured tobacco in southern my country and provides a new direction for improving the low chloride content in flue-cured tobacco in my country.

[0036] The present invention uses real-time PCR to find that the tobacco nitrate transporter encoding gene NtNPF7.4 is expressed in the root, stem, leaf and flower tissues of tobacco. To further confirm the function of the NtNPF7.4 gene, a gene editing vector for knocking out the NtNPF7.4 gene was constructed by CRISPR / Cas9 technology, and a knockout strain that inhibited the expression of the NtNPF7.4 gene was successfully obtained after transformation. The test results show that compared with the control plants, the chloride ion content in the roots and leaves of the NtNPF7.4 gene knockout plants increased significantly, indicating that the NtNPF7.4 gene is closely related to the absorption and transport of chloride ions in tobacco, enriching the functional system of tobacco nitrate transporters, providing an important reference for plant chloride ion transport regulation, and laying the foundation for cultivating new chloride ion-enriched plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The expression characteristic diagram of NtNPF7.4 gene in different tissues in Experimental Example 1 of the present invention (the histograms without the same lowercase letters indicate significant differences);

[0038] Figure 2 This is the subcellular localization map of tobacco NtNPF7.4 protein in Experimental Example 1 of the present invention;

[0039] Figure 3 This is the expression characteristic diagram of the NtNPF7.4 gene under salt stress in Experimental Example 2 of the present invention (the histograms without the same lowercase letters indicate significant differences);

[0040] Figure 4 This is a schematic diagram of target site selection for NtNPF7.4 gene knockout in Experimental Example 3 of the present invention;

[0041] Figure 5 This is a diagram showing the sequencing results of the knockout target site of the T0 generation gene-edited plant in Experimental Example 4 of the present invention;

[0042] Figure 6 This is a graph of chloride ion content in the roots and leaves of NtNPF7.4 gene-edited plants in Experimental Example 4 of the present invention (** represents p<0.01). DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific examples. Unless otherwise specified, the equipment and reagents used in each embodiment, experimental example and comparative example can be obtained from commercial sources.

[0044] The tobacco NtNPF7.4 gene of the present invention encodes the tobacco nitrate transporter NtNPF7.4, and the tobacco nitrate transporter comprises an amino acid sequence as shown in SEQ ID: No. 2. The tobacco nitrate transporter may also be formed by the amino acid sequence shown in SEQ ID No: 2 through substitution and / or deletion and / or addition of one or more amino acid residues, and has a derivative polypeptide that affects tobacco chloride ion transport. The substitution and / or deletion and / or addition of one or more amino acid residues refers to the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0045] The nucleotide sequence contained in the tobacco nitrate transporter encoding gene NtNPF7.4 of the present invention is as shown in SEQ ID: No. 1. Or a nucleotide sequence that can hybridize with the DNA sequence defined by SEQ ID No: 1 in the sequence list under highly stringent conditions; or a DNA sequence that has more than 90% homology with the DNA sequence defined by SEQ ID No: 1 in the sequence list and encodes the same functional protein.

[0046] The application of the tobacco nitrate transporter encoding gene NtNPF7.4 of the present invention is to inhibit the expression of the NtNPF7.4 gene in tobacco plants, which can increase the chloride ion content in roots and leaves. The expression of the NtNPF7.4 gene can be inhibited by a variety of methods, such as: Agrobacterium-mediated transformation of gene editing vectors, plant virus vector-mediated gene silencing methods, Agrobacterium-mediated transformation of RNAi interference vectors, optimization and modification of gene coding frames, optimization of gene promoters, and other methods. The method of inhibiting gene expression of the present invention is not limited to the above methods, as long as it can inhibit the expression of NtNPF7.4.

[0047] Some of the biological materials, experimental reagents, experimental equipment, etc. involved in the following embodiments and test examples are briefly introduced as follows:

[0048] Biomaterials:

[0049] Tobacco variety: K326, the seeds used were provided by the National Tobacco Gene Research Center.

[0050] Vectors: pFF19 vector was provided by the National Tobacco Gene Research Center; pCS1300 was donated by Wuhan Tianwen Biotechnology Co., Ltd.; CRISPR / Cas9 vector was provided by the State Key Laboratory of Silkworm Genome Biology, Southwest University.

[0051] Strains: Trans5α chemical competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; primer synthesis and DNA sequencing were provided by Beijing Liuhe BGI Genomics Co., Ltd.

[0052] Experimental reagents: RNA extraction kit (RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit) and genome extraction kit (Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit) were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; fluorescence quantification kit and reverse transcription kit (Transcriptor First Strand cDNA Synthesis Kit) were purchased from Roche, Switzerland; DNA amplification enzyme was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction endonuclease BsaI, plasmid extraction kit and DNA gel recovery kit were purchased from Bao Biotechnology Co., Ltd.

[0053] Experimental equipment: PCR instrument Tprofessional Thermocycler, Biometra; quantitative PCR instrument LightCycler96, Roche.

[0054] Example 1 of tobacco nitrate transporter encoding gene NtNPF7.4 gene

[0055] The nucleotide sequence of the tobacco nitrate transporter encoding gene NtNPF7.4 in this example is:

[0056] (1) the nucleotide sequence shown in SEQ ID NO.1;

[0057] (2) A nucleotide sequence in which one or more nucleotides are replaced and / or deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0058] Example 1 of tobacco nitrate transporter NtNPF7.4

[0059] The amino acid sequence of the tobacco nitrate transporter NtNPF7.4 in this example is:

[0060] (1) the amino acid sequence shown in SEQ ID NO.2;

[0061] (2) A derivative protein having the same function as the amino acid sequence shown in SEQ ID NO. 2, wherein one or more amino acid residues are replaced and / or deleted and / or added.

[0062] Example 1 of gene editing vector

[0063] The gene editing vector of this embodiment contains a knockout primer sequence designed according to the target site of the NtNPF7.4 gene, and the nucleotide sequence of the NtNPF7.4 gene is shown in SEQ ID NO.1.

[0064] The knockout primer sequences designed based on the target site knockout sequences are as follows:

[0065] NtNPF7.4-T1_F: GATTGATGGAAGTGTGGATAAGCA (as shown in SEQ ID NO. 12);

[0066] NtNPF7.4-T1_R: AAACTGCTTATCCACACTTCCATC (as shown in SEQ ID NO. 13).

[0067] Example 1 of application of tobacco nitrate transporter encoding gene NtNPF7.4 gene or gene editing vector in chloride ion enrichment tobacco variety breeding

[0068] In this example, tobacco plants were transformed with a gene editing vector containing a knockout primer sequence designed according to the target site of the NtNPF7.4 gene to construct tobacco plants with the NtNPF7.4 gene knocked out. Compared with normal tobacco plants, the chloride ion content in the roots and leaves of this strain was significantly increased, and a chloride ion-enriched tobacco variety was obtained.

[0069] Example 1 of application of NtNPF7.4 gene knockout tobacco plants in improving low chloride ion content in soil with low chloride ion content

[0070] In this example, the NtNPF7.4 gene in tobacco plants was knocked out using CRISPR / Cas9 technology to obtain NtNPF7.4 gene knockout strains. The chloride ion content in the roots and leaves of the knockout strains was increased, and the strains were applied to soils with low chloride ion content in my country to improve the low chloride content in flue-cured tobacco and improve the quality of flue-cured tobacco.

[0071] Experimental Example 1 Analysis of the expression pattern of NtNPF7.4 gene and cloning of NtNPF7.4 gene fragment

[0072] In this example, total RNA from the roots of K326 tobacco plants was extracted, reverse transcribed into cDNA, and the NtNPF7.4 gene fragment was amplified by PCR, and the expression pattern of the NtNPF7.4 gene in different tissues and organs of tobacco was analyzed by fluorescent quantitative PCR. The specific implementation operation is as follows:

[0073] 1. Cloning of NtNPF7.4 gene

[0074] The cloning and acquisition process of NtNPF7.4 gene is as follows:

[0075] (1) Extract RNA and reverse transcribe cDNA

[0076] After the K326 seeds were sterilized, they were inoculated on MS culture medium for germination. Two weeks after germination, the seedlings were transplanted into pots and cultured in a plant culture room at a culture temperature of 23-26°C. When the tobacco seedlings grew to six leaves and one heart, they were transferred to 1 / 2MS liquid culture medium for further culture. After two weeks, the roots were sampled, frozen in liquid nitrogen and used for standby. The total RNA of tobacco roots was extracted using a plant RNA extraction kit. When extracting RNA, refer to the instructions of the kit, and then reverse transcribe it into cDNA for standby.

[0077] (2) Design primers and perform PCR amplification

[0078] The PCR amplification primer sequences are as follows:

[0079] NtNPF7.4-F: 5'-ATGGCTTGCTTAAACATTG-3' (as shown in SEQ ID NO. 3);

[0080] NtNPF7.4-R: 5'-TTAGACCTTGAAATCTCCTT-3' (as shown in SEQ ID NO. 4).

[0081] The cDNA reverse transcribed in step (1) was used as a template and the above primers were used for PCR amplification. The PCR amplification system was: 10 μL 5×GCL buffer, 2 μL cDNA, 1 μL upstream and downstream primers, 6 μL dNTP, 1 μL GXL DNA Polymerase, and sterilized water to 50 μL. The PCR amplification conditions were: 98°C, 10 sec; 55°C, 15 sec, 68°C, 2 min, 30 cycles. The PCR product was analyzed by agarose electrophoresis and purified and recovered by referring to the instructions of the DNA gel recovery kit.

[0082] The purified product was then connected to the pFF19 vector, and the connection system was as follows: DNA amplification product, 6 μL; pFF19 vector, 1 μL; after mixing, connect at 25°C for 25 minutes.

[0083] The ligation product was transformed into E. coli DH5α competent cells. The specific transformation process is as follows:

[0084] Take out the competent cells from the -80℃ refrigerator, place them on ice to dissolve, add the ligation product to 100μL DH5α competent cells, flick to mix, and place on ice for 20min; heat shock in a 42℃ water bath for 90s, and immediately place on ice for 2min; add 900μL LB (antibiotic-free) liquid culture medium equilibrated to room temperature, and culture at 37℃ with shaking for 1h; centrifuge at 4000rpm for 3min, remove part of the supernatant, keep 100μL and mix the precipitate, evenly spread it on the LB solid plate (containing 50μg / μL kanamycin), invert the culture dish, and culture at 37℃ overnight.

[0085] The next day, single clones were picked and sent for sequencing.

[0086] The sequencing and analysis results showed that the length of the coding region of the NtNPF7.4 gene was 1788 bp nucleotides; after analyzing the gene, it was found that the amino acid sequence of the NtNPF7.4 protein encoded by it was shown in SEQ ID NO.2.

[0087] 2. Analysis of the expression pattern of NtNPF7.4 gene in different tissues and organs of tobacco

[0088] The roots, stems, leaves and flowers of K326 tobacco plants in the vigorous growth period were taken, RNA was extracted and reverse transcribed into cDNA, and the expression of NtNPF7.4 gene in various tissues and organs was detected by real-time quantitative PCR. Fluorescence quantitative PCR detection was performed with tobacco Nt26S gene as the internal reference, and the primer sequences were as follows:

[0089] Fluorescence quantitative primers for detecting NtNPF7.4 gene, the primer sequences are:

[0090] RT-NtNPF7.4-F: 5'-CAGTCTCAGGCTTTCAT-3' (as shown in SEQ ID NO. 5);

[0091] RT-NtNPF7.4-R: 5'-TCAAGAACTCTTCTATAG-3' (as shown in SEQ ID NO. 6).

[0092] When detecting tobacco Nt26S gene, the specific primers are:

[0093] Nt26S-F: 5'-GAAGAAGGTCCCAAGGGTTC-3' (as shown in SEQ ID NO. 7);

[0094] Nt26S-R: 5'-TCTCCCTTTAACACCAACGG-3' (as shown in SEQ ID NO. 8).

[0095] The reaction system of fluorescence quantitative PCR was: 10 μL 2×SYBR I Master, 0.5 μL each of upstream and downstream primers, 50 ng cDNA, and ddH2O to 20 μL.

[0096] The reaction conditions of fluorescence quantitative PCR were as follows: the first step was pre-denaturation at 95°C for 10 s; the second step was PCR reaction at 95°C for 5 s, 60°C for 30 s, and 39 cycles; the third step was melting curve.

[0097] Each sample was biologically replicated three times. Methods Relative gene expression differences were analyzed.

[0098] The results of fluorescence quantitative PCR were as follows Figure 1 As shown (bars not marked with the same lowercase letters indicate significant differences), the results indicate that the NtNPF7.4 gene is expressed in the roots, stems, leaves and flowers of tobacco.

[0099] 3. Subcellular localization of tobacco NtNPF7.4 protein

[0100] Primers pCS1300-NPF7.4F and pCS1300-NPF7.4R were designed to clone NtNPF7.4 into the pCS1300 vector containing a GFP tag. The primer sequences are:

[0101] pCS1300-NPF7.4F: 5′-GCTTTCGCGAGCTCGGTACCATGGCTTGCTTAAACATTG-3′ (as shown in SEQ ID NO. 9);

[0102] pCS1300-NPF7.4R: 5′-CCCTTGCTCACCATGGATCCGACCTTGAAATCTCCTTGC-3′ (shown in SEQ ID NO. 10).

[0103] The PCR amplification system and reaction procedure were the same as those in the cloning of the NtNPF7.4 gene in Part 1 of the experimental example. The obtained PCR product was connected to the pCS1300 vector using the In-Fusion enzyme. The connection system was as follows: DNA amplification product, 2 μL; pCS1300 vector 2 μL; In-Fusion enzyme 1 μL. After mixing, connect at 50°C for 15 minutes. The connection product was transformed into the competent E. coli DH5α, and a single colony was picked for sequencing.

[0104] The fusion plasmid GFP-NtNPF7.4 was extracted from the colonies with correct sequencing and transformed into Agrobacterium. The steps of Agrobacterium transformation are as follows:

[0105] Take out Agrobacterium GV3101 competent cells from the -80℃ refrigerator, freeze and thaw on ice, add 5μL of the constructed GFP-NtNPF7.4 fusion vector when it is about to thaw, and flick to mix; ice bath for 30min, freeze in liquid nitrogen for 5min, and then put on ice immediately after 5min of water bath at 37℃; add 900μL of LB liquid culture medium without antibiotics, and culture at 200rpm and shaking for 4h; then centrifuge the bacterial solution at 4500rpm for 3min, discard half of the volume of the supernatant, resuspend and evenly apply it on LB solid culture medium containing Rif (100μg / mL) and Kan (50μg / mL), and culture at 28℃ inverted for about 2-3d, until a single colony is formed; pick a single colony, and perform PCR identification on the bacterial solution after expansion, and identify the correct positive clone strain, which is the correctly transformed engineered bacteria.

[0106] The correctly transformed Agrobacterium was injected into healthy Nicotiana benthamiana leaves, and the distribution of the signal in the cells was observed using a laser confocal microscope 2 days later. Figure 2 As shown, it indicates that the NtNPF7.4 protein is localized on the cell membrane (where FM is a membrane localization dye).

[0107] Experimental Example 2 Salt stress test of tobacco

[0108] In order to determine the specific response of NtNPF7.4 gene to salt stress, the common cultivated tobacco K326 was treated with salt stress, and the roots were collected at different treatment times. The expression of NtNPF7.4 gene was analyzed by fluorescence quantitative PCR. The specific implementation operation is as follows:

[0109] (1) Salt stress experiment

[0110] Tobacco K326 was planted in the plant culture room of the National Tobacco Gene Research Center under the following culture conditions: temperature (23±1)℃, relative humidity 60%±2%, 16h light culture, 8h dark culture. When the tobacco seedlings grew to the six true leaves stage, they were moved to Hoagland's nutrient solution for further culture. 300mM NaCl was added when the nutrient solution was replaced after 1 week. Roots and leaves were collected at 0h, 12h, 3d and 7d after NaCl treatment. When sampling the roots, they were rinsed with distilled water and dried with absorbent paper, then quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator. Three independent replicates were set for each strain, and at least three tobacco seedlings with consistent growth were selected for each replicate.

[0111] (2) qPCR detection of NtNPF7.4 gene expression

[0112] RNA was extracted from the stored material, and cDNA was synthesized using a reverse transcription kit. Fluorescence quantitative PCR was performed using tobacco Nt26S gene as an internal reference. The specific operation process was as described in step 2 of Experimental Example 1.

[0113] The results of fluorescence quantitative PCR were as follows Figure 3 As shown in the figure (bars without the same lowercase letter indicate significant differences), the expression level of NtNPF7.4 gene in leaves of tobacco increased significantly after salt stress, indicating that NtNPF7.4 gene plays a certain role in salt stress and may be involved in the chloride ion transport process.

[0114] Experimental Example 3 Construction of gene editing vector

[0115] In order to further understand the function of NtNPF7.4 gene in chloride ion absorption and transport in tobacco, a gene editing vector for knocking out NtNPF7.4 gene was constructed. The specific implementation operation is as follows:

[0116] First, the target site was designed according to the recognition characteristics of the CRISPR / Cas9 system, and a 20 bp sgRNA target sequence was designed in the first exon region of the NtNPF7.4 gene, such as Figure 4 As shown, the sgRNA target sequence is: GATGGAAGTGTGGATAAGCA (as shown in SEQ ID NO.11), and the knockout primer sequences NtNPF7.4-T1_F and NtNPF7.4-T1_R are designed as follows:

[0117] NtNPF7.4-T1_F: GATTGATGGAAGTGTGGATAAGCA (as shown in SEQ ID NO. 12);

[0118] NtNPF7.4-T1_R:AAACTGCTTATCCACACTTCCATC (as shown in SEQ ID NO.13).

[0119] Design the reaction system to obtain the DNA double strand (annealing) of the target site. The 20 μL reaction system is designed as follows: Annealing Buffer for DNAOLigos (5×), 4 μL; upstream and downstream primers (NtNPF7.4-T1_F, NtNPF7.4-T1_R), 4 μL each (50 μmoL / μL); Nuclease-free water is added to 20 μL.

[0120] The reaction procedure is: 95°C for 5 min, decreasing by 0.1°C every 8 s until the temperature reaches 25°C; the reaction product is stored at 4°C for later use, or directly used for subsequent reactions.

[0121] The above annealing product was connected with the CRISPR / Cas9 vector after BsaⅠ digestion, and the CRISPR / Cas9 expression vector for knocking out the NtNPF7.4 gene was screened. The 20μL connection system was designed as follows: annealing product, 6μL; enzyme digestion product (CRISPR / Cas9 vector after BsaⅠ digestion), 3μL; 10×T4 DNA Ligase Buffer, 2μL; T4DNALigase, 1μL; sterile water was added to 20μL and connected at 37℃ for 3h.

[0122] The ligation product was transformed into competent E. coli cells, and the positive clones were picked, expanded and cultured, and the plasmid was extracted. After the successful construction of the vector was confirmed by PCR, it was stored at low temperature and used for Agrobacterium transformation.

[0123] Experimental Example 4 Obtaining transgenic plants and detecting chloride ion content

[0124] In this experimental example, the gene editing vector constructed in Experimental Example 3 was used to transform Agrobacterium, and then to transform tobacco plants to construct transgenic plants with NtNPF7.4 gene knockout. The specific implementation operations are as follows:

[0125] (1) Transformation of Agrobacterium

[0126] The specific method is the same as the step of Agrobacterium transformation in cell subcellular localization in Experimental Example 1.

[0127] (2) Transformation of tobacco plants

[0128] Take the leaves of K326 tobacco sterile seedlings grown for about one month, use a hole puncher to process the leaves into leaf disks with a diameter of 0.5 cm, and pre-culture the treated leaf disks on MS solid medium for 3 days; culture the transformed Agrobacterium engineering bacteria prepared above until OD 600 = about 0.6, centrifuge at 4000rpm for 5min to collect the bacteria, and then suspend the bacteria in 20mL of MS liquid culture medium; then place the leaf disc after the pre-culture in the bacterial solution and infect for 10min; use sterile filter paper to absorb the excess bacterial solution around the infected leaf disc, and dark culture on a solid culture medium of MS+6-BA (2mg / L)+NAA (0.5mg / L) for 3d; wash the leaf disc with sterile water containing Cef (400mg / L), and use sterile filter paper to absorb the excess liquid, transfer the leaf disc to an MS solid screening culture medium containing 6-BA (2mg / L), NAA (0.5mg / L), Cef (200mg / L) and Kan (50mg / L), and culture under light at 28℃; when the adventitious buds grow to 0.5cm, transfer them to an MS solid culture medium containing Cef (200mg / L) and Kan (50mg / L) for rooting.

[0129] (3) Identification of gene-edited strains

[0130] After the tobacco plants to be transformed have grown for about a month, a small amount of leaves are taken and DNA is extracted according to the instructions of the plant genome extraction kit. The positive transgenic strains and mutant forms are detected by PCR amplification, cloning and sequencing. The specific identification method is:

[0131] On the NtNPF7.4 genome, a pair of detection primers were designed, which were located on both sides of the knockout target site, specifically:

[0132] NtNPF7.4-JF:5'-ggagtgagtacggtgtgcCTTAACGGCTAATGCATG-3' (as shown in SEQ IDNO.14);

[0133] NtNPF7.4-JR: 5'-gagttggatgctggatggTCAATAACTGTTAAAGTTG-3' (shown in SEQ ID NO. 15).

[0134] Note: The lowercase bases here are the linker sequences.

[0135] PCR amplification was performed using the DNA template of the T0 transgenic strain. The reaction system was: 1 μL genomic DNA, 2 μL 10× buffer, 0.5 μL upstream and downstream primers, 3 μL dNTP, 0.5 μL EasyTaq enzyme, and ddH2O to 20 μL. The PCR conditions were: 94°C pre-denaturation for 4 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 40 s, for a total of 25 cycles; and 72°C final extension for 10 min. The PCR product was sent to Hi-tom for sequencing.

[0136] Analyze the sequencing results as Figure 5 As shown, two forms of mutations were detected in the NtNPF7.4 gene in 11 T0 generation plants, all of which occurred at the knockout target site, while no mutations were detected in the NtNPF7.4 gene of the wild-type plants, indicating that the NtNPF7.4 gene had been successfully knocked out in the T0 generation plants.

[0137] (4) Hydroponic test

[0138] The T1 generation of NtNPF7.4 gene-edited plants and the control K326 plants were planted in the plant culture room of the National Tobacco Gene Research Center. The culture conditions were: temperature (23±1)℃, relative humidity 60%±2%, 16h light culture, 8h dark culture. When the tobacco seedlings grew to the six true leaves stage, they were moved to Hoagland's nutrient solution for further culture. The nutrient solution was replaced once after 1 week, and the roots and leaves were taken after another 3 days of culture for subsequent determination of chloride ion content. When sampling the roots, they were rinsed with distilled water and dried with absorbent paper, then quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator. Three independent replicates were set for each strain, and at least three tobacco seedlings with consistent growth were selected for each replicate.

[0139] (5) Determination of chloride ion content

[0140] The preserved root and leaf samples were freeze-dried and ground into powder using a hybrid oscillating grinder. About 0.0500 g (accurate to 0.1 mg) of the powder was weighed and placed in 10 mL of 5% (volume fraction) acetic acid. The mixture was extracted at 30°C for 30 min and then filtered with qualitative filter paper. The filtrate was diluted and the chloride ion content was determined using an American Alalis MP6500 desktop pH meter.

[0141] The results are as follows Figure 6 As shown, after NtNPF7.4 gene knockout, the chloride ion content in roots and leaves increased significantly (** represents p < 0.01).

[0142] In summary, the present invention has found that the NtNPF7.4 protein is located on the cell membrane through the study of the tobacco NtNPF7.4 gene; the NtNPF7.4 gene knockout strain is obtained by gene editing technology, and after hydroponics, the chloride ion content in the roots and leaves increases significantly, and a tobacco plant with chloride ion accumulation is obtained. The NtNPF7.4 gene knockout strain constructed by the present invention can be applied to soils with low chloride ion content in my country, improve the low chloride content of flue-cured tobacco, and improve the quality of flue-cured tobacco.

[0143] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An application of a tobacco nitrate transporter encoding gene NtNPF7.4 in the cultivation of chloride ion enriched tobacco varieties, characterized in that: When the NtNPF7.4 gene is knocked out, the chloride ion content in tobacco roots and leaves is significantly increased; the nucleotide sequence of the NtNPF7.4 gene is shown in SEQ ID NO.

1.

2. Application of a gene editing vector in the cultivation of chloride ion-enriched tobacco varieties, characterized in that: The gene editing vector contains a target site knockout sequence designed according to the NtNPF7.4 gene, and the nucleotide sequence of the NtNPF7.4 gene is shown in SEQ ID NO.

1.

3. The use of the gene editing vector according to claim 2 in the breeding of chloride ion-enriched tobacco varieties, characterized in that: The knockout primer sequences designed based on the target site knockout sequences are as follows: NtNPF7.4-T1_F: GATTGATGGAAGTGTGGATAAGCA (as shown in SEQ ID NO. 12); NtNPF7.4-T1_R:AAACTGCTTATCCACACTTCCATC (as shown in SEQ ID NO.13).

4. The use of the gene editing vector according to claim 2 or 3 in the breeding of chloride ion-enriched tobacco varieties, characterized in that: The chloride ion-enriched tobacco variety is obtained by the following method: a gene editing vector is transformed into Agrobacterium as an infection liquid, and then the tobacco is transformed, and the chloride ion-enriched tobacco variety is obtained by screening and identification.

5. Application of NtNPF7.4 gene knockout tobacco plants in improving low chloride content in flue-cured tobacco in soil with low chloride ion content, characterized in that: The nucleotide sequence of the NtNPF7.4 gene is shown in SEQ ID NO.1.

Images