Cas3 / cascade protein complex, crisper / cas system and detection method and application thereof

Abstract

The application relates to the technical field of biological detection, and provides a Cas3 / Cascade protein complex derived from a thermophilic archaea, which comprises TsiCas3 and TsiCascade; the TsiCas3 comprises Cas3HD and Cas3HEL, and the TsiCascade comprises Cas5, Cas6, Cas7, Cas8 and Cas11. The application further provides a CRISPR / Cas system, a nucleic acid molecule detection method based on the CRISPR / Cas system and application. The CRISPR / Cas system comprises the TsiCas3 / Cascade protein complex, an ssDNA probe and a guide RNA; once the target nucleic acid is combined with the guide RNA through hybridization, the TsiCas3 / Cascade protein complex is activated, and can cut non-target single-stranded DNA in disorder, and the detection method is used for detection.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, and in particular to a Cas3 / Cascade protein complex derived from thermophilic archaea type I-A, a CRISPR / Cas system, and its nucleic acid molecular detection methods and applications. Background Technology

[0002] The clustered regularly interspaced short palindromic repeats (CRISPR) / clustered regularly interspaced short palindromic repeat-associated protein (CRISPR) system is an adaptive immune defense system developed by bacteria and archaea during biological evolution. Since the discovery of the "collateral cleavage" activity of Cas13 and Cas12 proteins and their application in rapid molecular detection, CRISPR / Cas-based nucleic acid detection technologies have seen rapid growth in applications such as pathogen detection, genetic disease detection, cancer detection, antimicrobial resistance detection, and environmental microbiology detection. Due to its advantages of speed, low cost, high sensitivity, and high specificity, the CRISPR / Cas system is considered a novel "next-generation molecular diagnostic system."

[0003] Currently, the Cas proteins used in CRISPR / Cas nucleic acid detection are mainly type V Cas12a, Cas12b, Cas12c, Cas12g, and Cas14, and type VI Cas13a and Cas13b. Among these, the Cas13-based SHERLOCK nucleic acid detection method can only specifically recognize RNA sequences, and the ease with which the RNA probe digested by the enzyme is hydrolyzed greatly limits the further application and development of Cas13. The DETECTR and HOLMES technologies developed based on Cas12 can detect both double-stranded and single-stranded DNA substrates, but they cannot be applied to RNA target detection. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a Cas3 / Cascade protein complex derived from thermophilic archaea (Thermococcus siculi, Tsi) type I-A, a CRISPR / Cas system, and a method and application for nucleic acid molecule detection thereof. The Cas3 / Cascade protein complex includes TsiCas3 and TsiCascade. In this invention, guide RNA and TsiCascade are co-expressed in situ to generate the protein complex, which is then incubated with TsiCas3 to form a TsiCas3 / Cascade-gRNA effector protein complex. The effector protein complex is targeted to a specific site in the target nucleic acid through base pairing between the guide RNA and the target sequence in the target nucleic acid molecule (dsDNA, ssDNA, ssRNA).

[0005] The present invention solves the above-mentioned technical problems by adopting the following technical solutions:

[0006] This invention provides a Cas3 / Cascade protein complex derived from thermophilic archaea, specifically the TsiCas3 / Cascade protein complex. The TsiCas3 / Cascade protein complex comprises TsiCas3 and TsiCascade. TsiCas3 includes Cas3HD and Cas3HEL proteins, while TsiCascade includes Cas5, Cas6, Cas7, Cas8, and Cas11 proteins.

[0007] As one of the preferred embodiments of the present invention, in the TsiCas3, the gene sequence corresponding to the Cas3HD protein is shown in SEQ ID NO.1, and the gene sequence corresponding to the Cas3HEL protein is shown in SEQ ID NO.2.

[0008] As one of the preferred embodiments of the present invention, in the TsiCascade, the gene sequences corresponding to the Cas5, Cas7, Cas8 and Cas11 proteins are shown as SEQ ID NO.3 to SEQ ID NO.6, respectively, and the gene sequence corresponding to the Cas6 protein corresponds to the target selection.

[0009] As one of the preferred embodiments of the present invention, the Cas3 / Cascade protein complex may also be other Cas3 / Cascade effector protein complexes having similar bypass single-strand DNA cleavage activity to the above-described TsiCas3 / Cascade protein complex.

[0010] As one of the preferred embodiments of the present invention, the Cas3 / Cascade, in addition to the above-mentioned TsiCas3 / Cascade, can also be PfuCas3 / Cascade, Mri / Cas3 / Cascade, Fpl / Cas3 / Cascade, Biz / Cas3 / Cascade, Pyn / Cas3 / Cascade, Lwl / Cas3 / Cascade, Ttd / Cas3 / Cascade, Tsg / Cas3 / Cascade, Tga / Cas3 / Cascade, Pfi / Cas3 / Cascade, Pyc / Cas3 / Cascade, MjaCas3 / Cascade, or Tsl / Cas3 / Cascade.

[0011] The present invention also provides a type I-A CRISPR / Cas system, comprising the above-mentioned Cas3 / Cascade protein complex.

[0012] As one of the preferred embodiments of the present invention, it includes a Cas3 / Cascade protein complex, a guide RNA, and an ssDNA probe; wherein the guide RNA is co-expressed in situ with Cascade in the Cas3 / Cascade protein complex, binds to the Cascade, and simultaneously binds to the target DNA / RNA hybridization sequence; the ssDNA probe does not hybridize with the guide RNA sequence.

[0013] This invention also provides a nucleic acid molecule detection method based on a type I-A CRISPR / Cas system, which uses the aforementioned CRISPR / Cas system and includes the following steps:

[0014] (1) Contact the target nucleic acid of the sample with the following substances:

[0015] (i) Cas3 / Cascade protein complex;

[0016] (ii) Guide RNA; the guide RNA is co-expressed in situ with Cascade, binds to Cascade, and simultaneously binds to the target nucleic acid hybridization sequence;

[0017] (iii) ssDNA probe; the ssDNA probe does not hybridize with the guide RNA sequence;

[0018] (2) Measure the detection signal generated by incubating the Cas3 / Cascade protein complex under certain time and appropriate temperature conditions and digesting the ssDNA probe with enzymes, thereby detecting the target nucleic acid of the sample.

[0019] As one of the preferred embodiments of the present invention, in step (1), the sample is saliva, oropharyngeal swab, nasopharyngeal swab, blood, serum, plasma, urine, feces, aspirate, biopsy tissue, eukaryotic cells, bacterial cells or archaea cells, etc.

[0020] As one of the preferred embodiments of the present invention, in step (1), the target nucleic acid of the sample is single-stranded DNA, double-stranded DNA or single-stranded RNA.

[0021] As one of the preferred embodiments of the present invention, in step (2), the time is 1 to 200 minutes.

[0022] As one of the preferred embodiments of the present invention, in step (2), the suitable temperature is 55℃~85℃.

[0023] As one of the preferred embodiments of the present invention, the detectable signals in step (2) include one or more of fluorescence polarization, colloidal phase transition / dispersion, detection of gold nanoparticles, electrochemical detection, semiconductor-based sensing, and chemiluminescence detection.

[0024] As one of the preferred embodiments of the present invention, the ssDNA probe comprises a pair of fluorescent dyes, and the ssDNA probe generates a first detectable signal before being cleaved and a second detectable signal after being cleaved.

[0025] As one of the preferred embodiments of the present invention, the fluorescent emitting dye pair is a quencher / fluorescent agent pair.

[0026] As one of the preferred embodiments of the present invention, the fluorescent emitting dye pair is a fluorescence resonance energy transfer (FRET) pair.

[0027] As one of the preferred embodiments of the present invention, the amount of detectable signal increases after the ssDNA probe is cleaved.

[0028] As one of the preferred embodiments of the present invention, the detection method further includes: amplifying the target nucleic acid in the sample. The amplification begins before the contact in step (1), or begins together with the contact in step (1).

[0029] As one of the preferred methods of the present invention, the amplification technology employs isothermal amplification or PCR amplification.

[0030] A nucleic acid detection method derived from the archaea type I-A TsiCas3 / Cascade effector protein complex, applied to the "direct detection of nucleic acids," includes the following steps:

[0031] Prepare a reaction system comprising: a type I-A TsiCas3 / Cascade-gRNA effector protein complex, an enzyme buffer system (magnesium ions, manganese ions, etc.), and an ssDNA probe;

[0032] The target nucleic acid to be tested is added to the reaction system, and the guide RNA binds complementary to the target sequence to be tested.

[0033] Place the reaction system at 55–85℃ for 1–200 min;

[0034] Read the signal.

[0035] A method for detecting the TsiCas3 / Cascade effector protein complex of archaea type I-A, comprising the following steps in conjunction with amplification techniques:

[0036] Method 1: One-step detection

[0037] Contact the nucleic acid population in the sample with the RPA amplification system, wherein the nucleic acid population contains target DNA and multiple non-target DNAs and RNA, and place the reaction system at 37℃~42℃ for 1~100min;

[0038] The amplified products were then contacted with the following substances:

[0039] (i) Type I-A Cas3 / Cascade protein complex;

[0040] (ii) Guide RNA; the guide RNA is co-expressed in situ with Cascade, binds to Cascade, and simultaneously binds to the target nucleic acid hybridization sequence;

[0041] (iii) ssDNA probe; the ssDNA probe does not hybridize with the guide RNA sequence;

[0042] Place the reaction system at 55℃~85℃ for 1~200 min;

[0043] Read the signal.

[0044] Method 2: Two-step detection

[0045] First, prepare an isothermal amplification reaction system or a PCR reaction system; add the nucleic acid to be tested to the amplification reaction system and amplify at 25–95℃ for 1–240 min;

[0046] Configure a reaction system comprising: a type I-A TsiCas3 / Cascade-gRNA effector protein complex, an ssDNA probe, and an enzyme buffer system (containing magnesium ions, manganese ions, etc.);

[0047] Add the amplification product to the reaction system at a volume ratio of 0.0001-1 / 5; incubate the reaction system at 55-85℃ for 1-200 min.

[0048] Read the signal.

[0049] The present invention also provides an application of the above-mentioned type I-A CRISPR / Cas system in the preparation of sample target nucleic acid detection kits.

[0050] As one of the preferred embodiments of the present invention, the kit is used to detect target DNA and RNA in a sample.

[0051] The present invention also provides a kit comprising the above-described CRISPR / Cas system and a nucleic acid amplification component.

[0052] The advantages of this invention compared to the prior art are:

[0053] (1) The type I-A TsiCas3 / Cascade protein complex of the present invention includes Cas3 (Cas3HEL, Cas3HD) and TsiCascade (Cas5, Cas6, Cas7, Cas8, Cas11); the CRISPR / Cas system includes the above-mentioned TsiCas3 / Cascade protein complex, ssDNA probe, and guide RNA generated by in situ co-expression with Cascade effector proteins. In practical applications, once the target nucleic acid in the sample hybridizes and binds to the guide RNA, the TsiCas3 / Cascade protein complex is activated and will randomly cleave non-target single-stranded DNA (ssDNA probe), which can be detected using any convenient detection method (e.g., using fluorescently labeled single-stranded detection reagent DNA).

[0054] (2) The method of the present invention can not only identify single-stranded DNA, double-stranded DNA and single-stranded RNA at the same time, but also has the characteristics of high enzyme digestion efficiency, high sensitivity, high specificity and high temperature resistance.

[0055] (3) Through extensive and in-depth research, this invention has developed a technical solution for target nucleic acid detection by studying the enzyme cleavage characteristics of the TsiCas3 / Cascade protein complex. This technical solution has been successfully used for rapid detection of HPV types 16 and 18. Attached Figure Description

[0056] Figure 1This invention presents a diagram illustrating the homology of the thermophilic archaea Tsi and Pfu (Figure a shows the gene structure of Pyrococcus kukullanii NCB100; Figure b shows the sequence similarity comparison of Pfu and pku proteins; Figure c shows the sequence alignment of the Cas6 bound cleavage sites of Pfu and Tsi; Figure d shows the SDS characterization of Cas3HEL and Cas3HD of Pku, Pfu, and Tsi; Figure e shows the sequence similarity comparison of Cas3HD proteins of Pku, Pfu, and Tsi).

[0057] Figure 2 This invention presents a diagram illustrating the source of the thermophilic archaea Tsi and its enzyme activity characteristics (Figure a is a phylogenetic tree of the CRISPR system type IA; Figure b is the gene structure diagram of Thermococcus siculi RG-20; Figure c is the gene structure diagram of Pyrococcus furiousus DSM 3686; Figure d is a comparison of the optimal activity temperatures of Pku, Pfu, and Tsi; Figure e is a comparison of the sequence similarity of cas11, cas7, cas5, HEL, HD, cas8, and cas6 proteins of Pfu and Tsi; Figure f is a comparison of the accessory cleavage performance of Pku, Pfu, and Tsi at 65°C).

[0058] Figure 3 This is a diagram of the purification process of the TsiCas3 / Cascade protein complex of the present invention (Figures a-c are schematic diagrams of the Cas6 restriction sites of Pku, Pfu and Tsi; Figure d is a schematic diagram of the entire purification process of the Tsi complex protein; Figure e is the SEC elution pattern of the purified Tsi complex; Figure f is the SEC peak composition diagram characterized by SDS).

[0059] Figure 4 This invention demonstrates how the TsiCas3 / Cascade protein complex, relying on guide RNA, can target three types of nucleic acid molecules (Figure a shows a schematic diagram of a nucleic acid detection platform based on TsiCas3 / Cascade; Figure b shows the nuclease activity of Cas3, Cascade, and the Cas3 / Cascade complex when binding DNA targets, characterized by urea-SDS denaturing gel; Figure c shows the nuclease activity of Cas3, Cascade, and the Cas3 / Cascade complex, characterized by real-time fluorescence; Figure d shows the auxiliary enzyme digestion performance at different incubation times when targeting dsDNA, ssRNA, and ssDNA, characterized by urea-SDS denaturing gel; Figure e shows the auxiliary enzyme digestion performance when targeting dsDNA, ssRNA, and ssDNA, characterized by real-time fluorescence).

[0060] Figure 5This is a diagram showing the optimization of conditions for the CRISPR / Cas system and detection method of this invention (Figure a shows the optimal activity temperature for fluorescence spectroscopy analysis of the Cas3 / Cascade complex; Figure b shows the optimal activity temperature for urea-SDS denaturing gel characterization of the Cas3 / Cascade complex; Figure c shows the types of metal ions that the Cas3 / Cascade complex depends on; Figure d shows the effect of 2mM ATP on the enzyme activity of the Cas3 / Cascade complex; Figure e shows the effect of ATP concentration on the enzyme activity of the Cas3 / Cascade complex; Figure f shows the visual characterization of the base sequence of the Cas3 / Cascade complex enzyme digestion probe; Figure g shows the quantitative characterization of the base sequence of the Cas3 / Cascade complex enzyme digestion probe using fluorescence spectroscopy).

[0061] Figure 6 This is a diagram showing the limit of detection (LOD) of the CRISPR / Cas system and detection method of this invention. (Figure a shows the urea-SDS denaturing gel analysis of Cas3 / Cascade complex cleaving ssDNA substrate (200 nM) activated by three dsDNA, ssDNA, and ssRNA targets at different concentrations (0, 0.1, 1, 10, 100, 500 nM); Figure b shows the fluorescence analysis of Cas3 / Cascade complex cleaving ssDNA substrate (200 nM) activated by three dsDNA, ssDNA, and ssRNA targets at different concentrations (0, 0.1, 1, 10, 100, 500 nM); Figure c shows the nuclease activity of Cas3, Cascade, and Cas3 / Cascade complexes when binding RNA targets, characterized by urea-SDS denaturing gel; Figure d shows the fluorescence spectroscopy analysis of nuclease activity of Cas3, Cascade, and Cas3 / Cascade complexes when binding RNA targets).

[0062] Figure 7 This is a kinetic diagram of the TsiCas3 / Cascade protein complex of the present invention (Figure a shows the real-time fluorescence of the Cas3 / Cascade complex cleaving ssDNA probes of different concentrations by three targets: dsDNA, ssDNA, and ssRNA; Figure b shows the Michaelis constants of dsDNA, ssDNA, and ssRNA binding to the Cas3 / Cascade complex).

[0063] Figure 8This is a performance comparison chart of the TsiCas3 / Cascade protein complex and Cas12a of the present invention (Figure a shows SDS-PAGE characterization of Cas12a and the TsiCas3 / Cascade complex; Figure b shows real-time fluorescence comparison of the LbaCas12 system and the TsiCas3 / Cascade complex; Figure c shows the activity of the LbaCas12 system at different SDS concentrations; Figure d shows the activity of the TsiCas3 / Cascade complex at different SDS concentrations; Figure e shows the activity of the LbaCas12 system at different pH levels; Figure f shows the activity of the TsiCas3 / Cascade complex at different pH levels).

[0064] Figure 9 This invention presents a diagram illustrating the PAM sequence of the TsiCas3 / Cascade protein complex (Figure a shows a schematic diagram of the TsiCas3 / Cascade complex binding to a double-stranded target in a PAM-dependent manner; Figure b shows a PAM sequence prediction diagram; Figure c shows the effect of fluorescence analysis on the enzyme activity of the TsiCas3 / Cascade complex using nine different PAM sequence targets; Figure d shows the effect of urea-SDS denaturing gel characterization on the enzyme activity of the TsiCas3 / Cascade complex; Figure e shows a schematic diagram of the TsiCas3 / Cascade complex recognizing targets in a PAM-dependent manner; Figures e and f show the differences in PAM sequence recognition sites between PfuCas8 and TsiCas8).

[0065] Figure 10 This invention presents a diagram exploring the homology of PAM recognition between the Tsi and Pfu systems (Figure a shows the sequence diagrams of 9 different PAM sequences in target 1 and target 2; Figure b shows the effect of fluorescence analysis on the target recognition activity of TsiCas3 / Cascade; Figure c shows a schematic diagram comparing the PAM structural positions recognized by PfuCas3 / Cascade and TsiCas3 / Cascade respectively; Figure d shows a diagram comparing the sequence similarity of PfuCas8 and TsiCas8 proteins).

[0066] Figure 11 This is a flowchart of the PAM screening process for the TsiCas3 / Cascade protein complex of the present invention (Figure a is a schematic diagram of PAM sequence screening; Figure b is an agarose gel electrophoresis diagram of PAM probes digested with different concentrations of TsiCas3 / Cascade enzymes; Figure c is a PCR amplification product diagram of channels 4-7 in agarose gel electrophoresis; Figure d is an analysis diagram of the band sequencing results in channels 4-7; Figure e is the PAM sequence diagram corresponding to Figure d).

[0067] Figure 12This is a diagram illustrating the study of the TsiCas3 / Cascade protein complex in base mutations according to the present invention (Figure a shows the locations of single and double base mutations in target 1; Figure b shows the fluorescence analysis of single and double base mutations; Figure c shows the locations of single and double base mutations in target 2; Figure d shows the fluorescence analysis of single and double base mutations).

[0068] Figure 13 This is a diagram showing the application of the CRISPR / Cas system and detection method of the present invention in clinical samples of HPV16 / 18 (Figure a is a schematic diagram of the entire process of HAVE system detection of clinical samples; Figure b is a result of reverse dot blot hybridization detection of HPV16 / HPV18; Figure c is a result of HAVE system detection of HPV16 / HPV18). Detailed Implementation

[0069] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.

[0070] This invention relates to terminology:

[0071] Guide RNA (gRNA): RNA that guides the TsiCas3 / Cascade protein complex to bind to the target DNA / RNA sequence.

[0072] Cascade: A CRISPR-associated protein complex, which is a related protein in the CRISPR system (this invention includes Cas5, Cas6, Cas7, Cas8, and Cas11).

[0073] Cas3: A CRISPR-associated protein complex, which is a related protein in the CRISPR system (this invention includes Cas3HEL and Cas3HD).

[0074] TsiCas3 / Cascade: A guide RNA-dependent endonuclease complex system, classified as type I-A in the CRISPR system.

[0075] PAM: protospacer-adjacent motif, is essential for TsiCas3 / Cascade cleavage. The PAM of TsiCas3 / Cascade is the CCN sequence.

[0076] Example 1

[0077] One Cas3 / Cascade protein complex in this embodiment is derived from thermophilic archaea and is a TsiCas3 / Cascade protein complex.

[0078] The TsiCas3 / Cascade protein complex includes TsiCas3 and TsiCascade; wherein TsiCas3 includes Cas3HD and Cas3HEL proteins, and TsiCascade includes Cas5, Cas6, Cas7, Cas8 and Cas11 proteins.

[0079] In the TsiCas3, Cas3HD and Cas3HEL are proteins with fixed sequences, and their corresponding gene sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0080] In the TsiCascade, Cas5, Cas7, Cas8 and Cas11 are proteins with fixed sequences, and their corresponding gene sequences are shown in SEQ ID NO.3 to SEQ ID NO.6, respectively; the gene sequence corresponding to the Cas6 protein is corresponding to the target selection.

[0081] Example 2

[0082] The purification steps of the TsiCas3 / Cascade protein complex in this embodiment are as follows:

[0083] The sequences of Cas3HD and Cas3HEL were constructed into plasmid pRSFduet, and the sequence of the Cascade complex was constructed into plasmid pETduet.

[0084] Expression and purification of Cas3 and Cascade protein complexes: Cas3HD, Cas3HEL, and Cascade protein complex expression plasmids were transformed into competent cells, plated, and cultured overnight. Single colonies were selected for expansion culture. When the OD600 of the bacterial culture reached 1–1.5 h, protein expression was induced with 0.2 mM IPTG. After overnight culture, the culture was collected by centrifugation and resuspended in lysis buffer + protease inhibitor. Cells were sonicated and centrifuged at 28000 x g for 20 min at 4 °C. The supernatant was added to a Ni-NTA resin column and purified by FPLC using an imidazole gradient (50 mM–500 mM). After SDS-PAGE gel electrophoresis and concentration, the Cas3 and Cascade protein complexes were dialyzed. The purified protein was obtained as shown in the figure. Figure 3 f).

[0085] Example 3

[0086] This embodiment of a type I-A CRISPR / Cas system includes:

[0087] TsiCas3 / Cascade protein complex: The TsiCas3 / Cascade protein complex, as shown in Example 1, includes TsiCas3 (Cas3HD, Cas3HEL proteins) and TsiCascade (Cas5, Cas6, Cas7, Cas8 and Cas11 proteins);

[0088] Guide RNA: The guide RNA is co-expressed in situ with Cascade in the TsiCas3 / Cascade protein complex, binds to Cascade, and simultaneously binds to the target DNA / RNA hybridization sequence;

[0089] ssDNA probe: The ssDNA probe does not hybridize with the guide RNA sequence.

[0090] It should be noted that the Cas6 protein is co-expressed in situ with the guide RNA. When specifically used for the detection of HPV16 and 18, the corresponding Cas6e gene sequences (Cas6e for gRNA processing, i.e., Cas6+ guide RNA) are shown in SEQ ID NO.7 (cas6e-HPV16) and SEQ ID NO.8 (cas6e-HPV18), respectively. The ssDNA probe can be a sequence that does not hybridize with the guide RNA sequence.

[0091] Example 4

[0092] This embodiment presents a nucleic acid molecular detection method based on a type I-A CRISPR / Cas system. The method uses the type I-A CRISPR / Cas system from Example 3 and is applied to "direct detection of nucleic acids," comprising the following steps:

[0093] (1) Preparation of the reaction system

[0094] The reaction system includes: TsiCas3 / Cascade protein complex, guide RNA, ssDNA probe, and enzyme buffer system (magnesium ions, manganese ions, etc.);

[0095] (2) The target nucleic acid of the sample to be tested is added to the above reaction system, and the guide RNA binds complementary to the target sequence to be detected;

[0096] (3) Place the reaction system at 55℃ for 200 min;

[0097] (4) Read the signal.

[0098] The samples include, but are not limited to, saliva, oropharyngeal swabs, nasopharyngeal swabs, blood, serum, plasma, urine, feces, aspirates, biopsy tissue, eukaryotic cells, bacterial cells, and archaea cells.

[0099] The target nucleic acid of the sample is single-stranded DNA, double-stranded DNA, or single-stranded RNA.

[0100] The detection signal includes one or more of fluorescence polarization, colloidal phase transition / dispersion, detection of gold nanoparticles, electrochemical detection, semiconductor-based sensing, and chemiluminescence detection, preferably fluorescence polarization.

[0101] When fluorescence polarization signal detection is specifically used, the ssDNA probe contains a quencher / fluorescent agent pair (fluorescent emission dye pair); the ssDNA probe generates a first detectable signal before being cleaved and a second detectable signal after being cleaved, and the amount of detectable signal increases after the ssDNA probe is cleaved.

[0102] Example 5

[0103] The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system in this embodiment is basically the same as that in Example 4, except that the reaction system is placed at 70°C for 100 min and the ssDNA probe contains a fluorescence resonance energy transfer pair (fluorescent emission dye pair).

[0104] Example 6

[0105] This embodiment of the nucleic acid molecular detection method based on the type I-A CRISPR / Cas system is basically the same as that in Example 4, except that the reaction system is placed at 85°C for 1 min and the ssDNA probe contains a fluorescence resonance energy transfer pair (fluorescent emission dye pair).

[0106] Example 7

[0107] This embodiment presents a nucleic acid molecular detection method based on a type I-A CRISPR / Cas system. The method uses the type I-A CRISPR / Cas system from Example 3 and is applied to "one-step nucleic acid detection combined with amplification technology," comprising the following steps:

[0108] (1) Contact the nucleic acid population in the sample with the RPA amplification system, wherein the nucleic acid population contains target DNA and multiple non-target DNA and RNA, and place the reaction system at 37°C for 10 min;

[0109] (2) Contact the above amplification products with the following substances:

[0110] (i) TsiCas3 / Cascade protein complex;

[0111] (ii) Guide RNA; the guide RNA is co-expressed in situ with Cascade, binds to Cascade, and simultaneously binds to the target nucleic acid hybridization sequence;

[0112] (iii) ssDNA probe; the ssDNA probe does not hybridize with the guide RNA sequence;

[0113] (3) Place the reaction system at 85℃ for 15 min;

[0114] (4) Read the signal.

[0115] The samples include, but are not limited to, saliva, oropharyngeal swabs, nasopharyngeal swabs, blood, serum, plasma, urine, feces, aspirates, biopsy tissue, eukaryotic cells, bacterial cells, and archaea cells.

[0116] The detection signal includes one or more of fluorescence polarization, colloidal phase transition / dispersion, detection of gold nanoparticles, electrochemical detection, semiconductor-based sensing, and chemiluminescence detection, preferably fluorescence polarization.

[0117] When fluorescence polarization signal detection is specifically used, the ssDNA probe contains a quencher / fluorescent agent pair, or a fluorescence resonance energy transfer pair; the ssDNA probe generates a first detectable signal before being cleaved, generates a second detectable signal after being cleaved, and the amount of detectable signal increases after the ssDNA probe is cleaved.

[0118] Example 8

[0119] This embodiment presents a nucleic acid molecular detection method based on a type I-A CRISPR / Cas system. The CRISPR / Cas system described in Example 3 is used and applied to a "two-step nucleic acid detection method combined with amplification technology," comprising the following steps:

[0120] (1) First, prepare the isothermal amplification reaction system or PCR reaction system.

[0121] The nucleic acid of the sample to be tested was added to the amplification reaction system and amplified at 37°C for 10 min.

[0122] (2) Configure the reaction system

[0123] The reaction system includes: TsiCas3 / Cascade protein complex, guide RNA, ssDNA probe, and enzyme buffer system (magnesium ions, manganese ions, etc.);

[0124] (3) Add the amplification product to the reaction system, with a volume ratio of 0.0001-1 / 5 between the amplification product and the reaction system; incubate the reaction system at 85℃ for 15 min.

[0125] (4) Read the signal.

[0126] The samples include, but are not limited to, saliva, oropharyngeal swabs, nasopharyngeal swabs, blood, serum, plasma, urine, feces, aspirates, biopsy tissue, eukaryotic cells, bacterial cells, and archaea cells.

[0127] The detection signal includes one or more of fluorescence polarization, colloidal phase transition / dispersion, detection of gold nanoparticles, electrochemical detection, semiconductor-based sensing, and chemiluminescence detection, preferably fluorescence polarization.

[0128] When fluorescence polarization signal detection is specifically used, the ssDNA probe contains a quencher / fluorescent agent pair, or a fluorescence resonance energy transfer pair; the ssDNA probe generates a first detectable signal before being cleaved, generates a second detectable signal after being cleaved, and the amount of detectable signal increases after the ssDNA probe is cleaved.

[0129] Example 9

[0130] This embodiment of the kit includes the type I-A CRISPR / Cas system described in Example 3 above, and also includes corresponding nucleic acid amplification components. The kit is used to detect target DNA and RNA in a sample, and the detection method is as shown in Examples 4-8.

[0131] Experimental Example

[0132] This experimental example is used to investigate the process and mechanism of the type I-A CRISPR / Cas system and detection method (abbreviated as "HAVE diagnostic system") of this invention.

[0133] I. Selection of TsiCas3 / Cascade protein complex

[0134] According to bioinformatics analysis research ( Figure 1 and Figure 2 This invention preferentially selects the TsiCas3 / Cascade protein complex. We plan to construct plasmids containing different protein tags (plasmid types are shown in Table 1, and the purification process is as follows). Figure 3 As shown in the figure, a high-purity TsiCas3 / Cascade protein complex was purified by co-transfer plasmid.

[0135] Research indicates that the TsiCas3 / Cascade protein complex possesses trans-cleavage activity, meaning that once the target DNA or RNA and the TsiCas3 / Cascade-gRNA effector protein complex form a complex, they will cleave other single-stranded DNA (bypass DNA) in the system. Based on this principle, a specific DNA or RNA detection method was designed. First, the bypass DNA was designed as a fluorescent probe, consisting of a 27nt random sequence (Probe27-FQ, see Table 2), labeled with the fluorescent group FAM at the 5' end and the quencher group BHQ1 at the 3' end. When the system contains the target DNA fragment, a complex of the target DNA or RNA and the TsiCas3 / Cascade-gRNA effector protein complex will form. At this point, the bypass probe is cleaved, and the FAM fluorescent group will emit fluorescence (excitation light 485nM, emission light 525nM) detected by a fluorescence detector (e.g., ...). Figure 4 (as shown in a).

[0136] Table 1. Types of plasmids used in this invention

[0137] plasmid name carrier resistant Cas11-Cas7-Cas5 pETduet-1 Amp Cas8 pCDFDuet-1 Stp Cas6e-HPV16-gRNA pRSFDuet-1 Kana Cas6e-HPV16-gRNA pRSFDuet-1 Kana Cas3HD pRSFDuet-1 Kana Cas3-HEL pRSFDuet-1 Kana

[0138] Table 2. Probes used in this invention

[0139]

[0140]

[0141] II. Investigation of Target Nucleic Acid Molecular Types

[0142] The effects of the TsiCas3 / Cascade-gRNA effector protein complex on the types of target nucleic acid molecules were investigated.

[0143] like Figure 4 As shown in the PAGE denaturing gel, the TsiCas3 / Cascade-gRNA effector protein complex can target three nucleic acid molecules: dsDNA, ssDNA, and ssRNA. When targeting dsDNA, it exhibits the strongest cis-cleavage performance of ssDNA (Substrate-FAM is FAM-labeled SSDNA, the sequence of which is shown in Table 2), and the target nucleic acid molecules are ssDNA and ssRNA in turn.

[0144] III. Optimization Test of Reaction Conditions

[0145] like Figure 5As shown, the TsiCas3 / Cascade-gRNA effector protein complex exhibits enzymatic cleavage activity at temperatures ranging from 55℃ to 85℃, with the optimal operating temperature being 85℃. ATP molecules play an inhibitory role in this reaction system. Studies have shown that suitable concentrations of divalent manganese, magnesium, and calcium ions can activate this reaction system. Furthermore, we synthesized probes with different base types to investigate the TsiCas3 / Cascade cleavage activity (PolyA-FQ, PolyT-FQ, PolyG-FQ, PolyC-FQ, sequences shown in Table 2). The results indicate that the activated TsiCas3 / Cascade-gRNA effector protein complex tends to cleave single-stranded DNA probes containing purine base sequences.

[0146] IV. Response Sensitivity Test:

[0147] The sensitivity of the TsiCas3 / Cascade-gRNA effector protein complex to three target molecules was tested, that is, the lowest concentration of target molecules that can elicit a response was examined.

[0148] The results are as follows Figure 6 As shown, when the test target is added directly, all three target DNAs at concentrations above 0.1 nM can respond.

[0149] V. Michaelis-Menten Analysis

[0150] like Figure 7 As shown, probes of different concentrations (0.001 μM, 0.010 μM, 0.100 μM, 0.250 μM, 0.500 μM, 1.000 μM, 2.000 μM, 5.000 μM) were added to a reaction system containing a TsiCas3 / Cascade-gRNA (100 nM) effector protein complex and a target dsDNA (50 nM). The reaction was incubated at 85 °C for 30 min on a real-time PCR instrument, with fluorescence acquisition performed at regular intervals (λex: 485 nm; λem: 525 nm). The initial velocity (V0) was calculated by fitting a linear regression, and the Michaelis-Menten constant was determined by plotting against the substrate concentration according to the following equation (GraphPad software): Y = (V max The transform number (k) is calculated as (×X) / (Km+X), where X is the substrate concentration and Y is the enzyme rate. cat ): k cat =Vmax / Et, where E t =0.1nM.

[0151] VI. Comparison test with Cas12a effector protein

[0152] The activities of the TsiCas3 / Cascade-gRNA effector protein complex and Cas12a in their respective reaction buffer systems were tested under different concentrations of SDS and different pH conditions.

[0153] The results are as follows Figure 8 As shown, the TsiCas3 / Cascade-gRNA effector protein complex can tolerate higher concentrations of SDS. Furthermore, Cas12a effector proteins tend to exhibit stronger activity in alkaline environments, while the TsiCas3 / Cascade-gRNA effector protein complex prefers acidic buffer systems.

[0154] VII. Investigation of PAM Sequences

[0155] like Figures 9-11 As shown, the TsiCas3 / Cascade-gRNA effector protein complex depends on the PAM structure for recognizing both dsDNA and ssDNA targets.

[0156] Through in vitro PAM sequence sequencing experiments and the TS and NTS of nine artificially synthesized different PAM sequences (sequences are shown in Table 3), it was found that the PAM recognition sequence of the TsiCas3 / Cascade-gRNA effector protein complex tends to be the CCN base sequence.

[0157] Table 3. PAM Sequence Study

[0158]

[0159] VIII. Base Mutation Test

[0160] like Figure 12 As shown, target-1 and target-2 were selected as targets, and single-base and adjacent double-base mutations were performed on positions 1-36 after the PAM region, respectively (see Tables 4 and 5).

[0161] The results showed that, regardless of whether it was a single-base mutation or a double mutation, the mutation closer to the PAM region had a greater impact on the activity of TsiCas3 / Cascade.

[0162] Table 4 Target 1 Mutation Study Sequences

[0163]

[0164]

[0165]

[0166]

[0167] Table 5. Sequences studied for Target2 mutations.

[0168]

[0169]

[0170]

[0171] Application examples

[0172] This application example illustrates a method for detecting HPV types 16 and 18 DNA viruses using RPA in combination with the system and method of this invention.

[0173] 1. Materials

[0174] 1.1 Target:

[0175] L gene, the target nucleic acid of HPV-16;

[0176] L gene of HPV-18 target nucleic acid.

[0177] 1.2 RPA primers:

[0178] HPV-16 forward primer: agitatcaggattacaatacagggtatttaga;

[0179] HPV-16 reverse primer: ctagcattttctgtgtcatccaatttattt;

[0180] HPV-18 forward primer: agtatcaggattacaatacagggtatttaga;

[0181] HPV-18 reverse primer: ctagcattttctgtgtcatccaatttattt.

[0182] 1.3 TsiCas3 / Cascade-gRNA (already contains crRNA sequence):

[0183] HPV-16-gRNA region: AUUGAAACaacuguuacaaccaguuaaggguuuggggaagcacuGAGUUCCCCGCGCCAGCGGGG;

[0184] HPV-18-gRNA region: AUUGAAACcaagcagugccuuuagcccaguguuccccaauagcaGAGUUCCCCGCGCCAGCGGGG.

[0185] 1.4 HPV16 / 18TS and NTS sequences:

[0186] HPV16 Target-NTS:

[0187] atatggatccggcatccccaataagtttggttttcctgacacctcattttataatcgtcgacctcgagatata;

[0188] HPV16 Target-TS:

[0189] tatatctcgaggtcgacgattataaaatgaggtgtcaggaaaaccaaacttattggggatgccggatccatat;

[0190] HPV18 Target-NTS:

[0191] ggctgtgcccctgctattggggaacactgggctaaaggcactgcttgtaaatcgcgtcct;

[0192] HPV18 Target-TS:

[0193] aggacgcgatttacaagcagtgcctttagcccagtgttccccaatagcaggggcacagcc.

[0194] 1.5 Single-stranded DNA probe: 5'-FAM-ATTTAGGGATCCGTTATTCGGATCCCTTTT-BHQ-3'.

[0195] 2. Specific testing steps:

[0196] Step 1: Configuration of the RPA amplification system:

[0197] Buffer V: 25 μL;

[0198] HPV-16 forward primer (10μM): 2μL;

[0199] HPV-16 reverse primer (10μM): 2μL;

[0200] Purified water: 16 μL;

[0201] Template: 2μL;

[0202] Magnesium acetate: 3 μL;

[0203] or,

[0204] HPV-18 forward primer (10μM): 2μL;

[0205] HPV-18 reverse primer (10μM): 2μL;

[0206] Purified water: 16 μL;

[0207] Template: 2μL;

[0208] Magnesium acetate: 3 μL.

[0209] Step 2: Preparation and addition of the enzyme digestion reaction system:

[0210] Take a 100 μL PCR tube, add 18 μL of reaction solution, 1 μL of TsiCas3 / Cascade-gRNA (final concentration approximately 0.01–1 μM) complex, 1 μL of probe (final concentration approximately 0.01–1 μM), and 2 μL of LPA amplification product. Gently pipette to mix.

[0211] Step 4: Incubation

[0212] Incubate the prepared enzyme digestion reaction system at 55℃~85℃ for 10~30 min.

[0213] Step 5: Test Results

[0214] Use a portable fluorescence detector (such as a portable fluorescence analyzer manufactured by Hangzhou Ruicheng Instrument Co., Ltd.) or a fluorescence quantitative PCR instrument to detect fluorescence signal values.

[0215] Step 6: Compare with the gold standard results

[0216] Of the 30 clinical samples tested, 11 were positive and 19 were negative. Using PCR reverse dot blot hybridization as the gold standard, the comparison results of this system are as follows: Figure 13 As shown.

[0217] Conclusion: Compared with reverse dot blot hybridization, this detection method can detect HPV16 and 18 virus samples, with a sensitivity of 91.67% and a specificity of 100.00%. This method has advantages such as speed, high sensitivity, and good specificity, and possesses performance and potential for clinical diagnostic applications.

[0218] In summary, this invention provides a highly specific and rapid detection method for target nucleic acid molecules. Once the target DNA (single-stranded or double-stranded) or single-stranded RNA and the TsiCas3 / Cascade-gRNA effector protein complex form a complex, this complex cleaves other single-stranded DNA molecules in the system. Guide RNA is designed to target the target nucleic acid (the DNA or RNA sequence to be detected); the TsiCas3 / Cascade-gRNA complex is added to the detection system; when the target DNA or RNA is present, the TsiCas3 / Cascade-gRNA forms a complex with the target DNA or RNA, and simultaneously, this complex exercises its cis-cleavage activity, cleaving fluorescently labeled single-stranded DNA (with luminescent and quencher groups attached to both ends; the luminescent group emits light after cleavage), thus emitting fluorescence. Therefore, the presence of target DNA or RNA molecules in the detection system can be determined by detecting the fluorescence. Using the method of this invention, the presence of specific DNA or RNA sequences in a sample can be rapidly detected. By combining this method with isothermal amplification or PCR techniques, the sensitivity of this detection method can be significantly improved.

[0219] Furthermore, it should be noted that the Cas3 / Cascade protein complex of the present invention can be the aforementioned TsiCas3 / Cascade, or it can be other Cas3 / Cascade effector protein complexes having similar bypass single-strand DNA cleavage activity to the aforementioned TsiCas3 / Cascade protein complex.

[0220] At the same time, in addition to the above-mentioned TsiCas3 / Cascade, Cas3 / Cascade can also be PfuCas3 / Cascade, Mri / Cas3 / Cascade, Fpl / Cas3 / Cascade, Biz / Cas3 / Cascade, Pyn / Cas3 / Cascade, Lwl / Ca s3 / Cascade, Ttd / Cas3 / Cascade, Tsg / Cas3 / Cascade, Tga / Cas3 / Cascade, Pfi / Cas3 / Cascade, Pyc / Cas3 / Cascade, MjaCas3 / Cascade, Tsl / Cas3 / Cascade.

[0221] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A Cas3 / Cascade protein complex, characterized in that, Derived from thermophilic archaea, including TsiCas3 and TsiCascade; wherein, TsiCas3 includes Cas3HD and Cas3HEL proteins, the gene sequence of Cas3HD protein is shown in SEQ ID NO.1, and the gene sequence of Cas3HEL protein is shown in SEQ ID NO.2; TsiCascade includes Cas5, Cas6, Cas7, Cas8 and Cas11 proteins, the gene sequences of Cas5, Cas7, Cas8 and Cas11 proteins are shown in SEQ ID NO.3~SEQ ID NO.6 respectively, and Cas6 protein is co-expressed in situ with guide RNA.

2. A type I-A CRISPR / Cas system, characterized in that, Includes the Cas3 / Cascade protein complex as described in claim 1.

3. The type I-A CRISPR / Cas system according to claim 2, characterized in that, The invention includes a Cas3 / Cascade protein complex, a guide RNA, and an ssDNA probe; wherein the guide RNA is co-expressed in situ with Cascade in the Cas3 / Cascade protein complex, binds to Cascade, and simultaneously binds to the target DNA / RNA hybridization sequence; the ssDNA probe does not hybridize with the guide RNA sequence.

4. A nucleic acid molecular detection method based on a type I-A CRISPR / Cas system for non-disease diagnosis and treatment purposes, characterized in that, The CRISPR / Cas system as described in any one of claims 2 to 3 includes the following steps: (1) Contact the target nucleic acid of the sample with the following substances: (i) Cas3 / Cascade protein complex; (ii) Guide RNA; the guide RNA is co-expressed in situ with Cascade, binds to Cascade, and simultaneously binds to the target nucleic acid hybridization sequence; (iii) ssDNA probe; the ssDNA probe does not hybridize with the guide RNA sequence; (2) Measure the detection signal generated by incubating the Cas3 / Cascade protein complex under certain time and appropriate temperature conditions and digesting the ssDNA probe with enzymes, thereby detecting the target nucleic acid of the sample.

5. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 4, characterized in that, In step (1), the target nucleic acid of the sample is single-stranded DNA, double-stranded DNA, or single-stranded RNA.

6. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 4, characterized in that, In step (2), the time is 1 to 200 minutes.

7. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 4, characterized in that, In step (2), the suitable temperature is 55℃~85℃.

8. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 4, characterized in that, In step (2), the detectable signals include one or more of the following: fluorescence polarization, colloidal phase transition / dispersion, detection of gold nanoparticles, electrochemical detection, semiconductor-based sensing, and chemiluminescence detection.

9. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 4, characterized in that, The ssDNA probe contains a pair of fluorescent dyes, and the ssDNA probe generates a first detectable signal before being cleaved and a second detectable signal after being cleaved.

10. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 9, characterized in that, The fluorescent emitting dye pair is a quencher / fluorescent agent pair.

11. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 9, characterized in that, The fluorescent emitting dye pair is a fluorescence resonance energy transfer pair.

12. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 9, characterized in that, After the ssDNA probe is cleaved, the amount of detectable signal increases.

13. The nucleic acid molecular detection method based on a type I-A CRISPR / Cas system according to any one of claims 4 to 12, characterized in that, The detection method further includes: amplifying the target nucleic acid in the sample.

14. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 13, characterized in that, The amplification begins before the contact in step (1), or together with the contact in step (1).

15. The nucleic acid molecular detection method based on the type I-A CRISPR / Cas system according to claim 13, characterized in that, The amplification techniques used are isothermal amplification or PCR amplification.

16. The application of the type I-A CRISPR / Cas system as described in any one of claims 2 to 3 in the preparation of a sample target nucleic acid detection kit.

17. The application of the type I-A CRISPR / Cas system according to claim 16 in the preparation of a reagent kit for detecting target nucleic acids in samples, characterized in that, The kit is used to detect target DNA and RNA in samples.

Images