A heca gene non-expressing xenotransplant donor pig and a method of making

Abstract

The application provides a HECA gene non-expression xenotransplant donor pig and a preparation method thereof. The HECA gene can cause a xenogeneic immune rejection risk. In addition, the FNDC1 gene is knocked out by using a CRISPR / Cas9 system. It is verified that the non-expression of the HECA gene can effectively reduce the binding ability of organs, tissues and / or cells of the donor pig to IgG and IgM of a recipient, improve the ability of the organs, tissues and / or cells of the donor pig to resist complement-mediated cytotoxicity of the recipient, and can prolong the survival time of the organs, tissues and / or cells of the donor pig in the recipient.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of animal genetic engineering, and particularly relates to a HECA gene non-expressed xenotransplant donor pig and a preparation method thereof. BACKGROUND

[0002] Xenotransplantation of organs, tissues and cells from donors of different species can effectively solve the shortage of human donors. Xenotransplantation has more advantages than autotransplantation and homotransplantation, including supply on a predictable non-emergency basis, production in a controlled environment, and use for characterization and research before transplantation. It has been proved in many literatures that in xenotransplant donor animal models, pigs have become the focus of most research in the field of xenotransplantation because pigs share many anatomical and physiological characteristics with humans. Pigs also have a relatively short gestation period, can be bred in a pathogen-free environment, and may not present the same ethical issues related to animals that are not usually used as a food source. However, in current research results, when the organs of pigs are transplanted into humans, more severe immune rejection reactions than autotransplantation and homotransplantation occur, because there are many unknown risk factors causing immune rejection, affecting the long-term survival of the implanted tissues or organs of pigs, including the rejection of heterologous genes.

[0003] Current research on HECA gene is as follows: HECA is a highly basic cytoplasmic protein, belonging to a new class of cancer-related cell cycle and differentiation regulators, which plays an important role in some human cancers. HECA is involved in multiple cancer-related signaling pathways together with JAK / STAT and Wnt / β-catenin pathways, and it counteracts Wnt-induced proliferation of cancer cells by interacting with proteins that are major components of cell cycle machinery. The expression of HECA is negatively regulated by the Wnt pathway and TCF4 (Wnt-associated transcription factor that can bind to the HECA promoter). HECA interacts with cell cycle protein-dependent kinases CDK9, CDK2, cyclin A and cyclin K (direct transcriptional target of p53 tumor suppressor), antagonizing Wnt-mediated cancer cell proliferation and chemotherapy resistance. Tumor suppressors are antagonistic to Wnt-induced cell signaling, and HECA acts as a tumor suppressor by blocking the cell cycle of cancer cells. SUMMARY

[0004] The present application researches and finds that HECA gene can cause xenogeneic immune rejection risk, and the HECA gene not expressed can effectively reduce the binding ability of donor tissue and / or organ cells to human acceptor IgG and IgM, improve the ability of donor tissue and / or organ cells to resist human acceptor complement-mediated cytotoxicity, and can prolong the survival time of donor tissue and / or organ after xenotransplantation. According to the above, the present application provides a xenotransplantation donor pig, wherein the HECA gene is not expressed in the organs, tissues or cells of the donor pig, and the acceptor is a human.

[0005] The HECA gene not expressed in the present application can be realized by gene knockout, gene knock-in, point mutation, deletion mutation and their combinations.

[0006] The HECA gene not expressed in the present application can be realized by gene silencing.

[0007] The gene knockout in the present application is realized by a CRISPR-Cas9 gene knockout system, and the system comprises a HECA gene knockout vector, including vector one and vector two, the vector one is connected with sgRNA1, the specific targeting sequence of the sgRNA1 is GATCTGCAGCTTTGGGAGGC, the vector two is connected with sgRNA2, and the specific targeting sequence of the sgRNA2 is CAGCAGGGTTGTCAGTGCAC.

[0008] The construction method of the HECA gene knockout vector in the present application is as follows:

[0009] The nucleotide sequence of the coding gene of the sgRNA1 is shown in SEQ ID NO. 1, and the complementary strand is shown in SEQ ID NO. 2, then the DNA sequences of the single-stranded sgRNA are annealed to form sgRNA1 oligonucleotide chains; then the oligonucleotide is connected into a PX330 plasmid vector;

[0010] The nucleotide sequence of the coding gene of the sgRNA2 is shown in SEQ ID NO. 3, and the complementary strand is shown in SEQ ID NO. 4, then the DNA sequences of the single-stranded sgRNA are annealed to form sgRNA2 oligonucleotide chains; then the oligonucleotide is connected into a PX330 plasmid vector.

[0011] The HECA gene knockout vector in the present application is introduced into a transformed cell, and the transformed cell is used to prepare a donor pig for xenotransplantation, and the HECA gene is not expressed in the organs, tissues or cells of the donor pig.

[0012] The application also provides a preparation method of a xenotransplant donor, comprising transplanting the transformed cell into a denuded egg cell to form a nuclear transfer egg, and then transplanting the nuclear transfer egg into the oviduct of a surrogate mother.

[0013] The application also provides a method for delaying, reducing or preventing rejection, separation or adverse reactions of a human recipient to a xenotransplant organ or tissue, which comprises genetically modifying the HECA gene of the tissue or organ of a donor pig so that the HECA gene of the donor pig or the tissue or organ of the donor pig is not expressed.

[0014] The organ of the xenotransplant donor according to the application comprises a liver, a lung, a kidney or skin.

[0015] The tissue of the xenotransplant donor according to the application comprises a nerve.

[0016] The beneficial effects are as follows:

[0017] The application first discovers that the HECA gene can cause a risk of xenogeneic immune rejection, and provides a xenotransplant donor, in which the HECA gene is not expressed by gene knockout or gene silencing, so that the binding ability of the cells of the tissue and / or organ of the donor to IgG and IgM of a human recipient is effectively reduced, the ability of the cells of the tissue and / or organ of the donor to resist complement-mediated cytotoxicity of a human recipient is improved, and the survival time of the tissue and / or organ of the donor after xenotransplantation is prolonged.

[0018] The application uses the CRISPR / Cas9 system to design double sgRNA to knockout the HECA gene, and the obtained gene knockout cell line can be used as a donor for somatic cell nuclear transfer. After the HECA gene is knocked out, the binding ability of the cells of the pig kidney to IgG and IgM of a human recipient is effectively reduced, and the ability of the cells of the pig kidney to resist complement-mediated cytotoxicity of a human recipient is improved, thereby providing a favorable research tool for deep mining of the biological function of the HECA gene.

[0019] Knocking out of the risk factor HECA gene identified in the application increases the probability of survival of xenogeneic cells, and further improves the feasibility of xenotransplantation. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Figure for identification of positive clone cells for knocking out of the HECA gene;

[0021] Figure 2 Figure for cell survival of wild-type pig kidney cells and HECA-knocked-out pig kidney cells after incubation with human serum;

[0022] Figure 3 Figure for detection of the binding ability of wild-type pig kidney cells and HECA-knocked-out pig kidney cells to IgG and IgM of a human recipient. DETAILED DESCRIPTION

[0023] The present application is further described by the following examples, which do not limit the present application in any manner, and any modification or change made by those skilled in the art without departing from the technical solutions of the present application shall fall within the scope of claims of the present application.

[0024] Example 1, construction of HECA gene knockout vector.

[0025] Pig kidney cell HECA gene knockout is realized by using CRISPR / Cas9 system, and sgRNA used includes sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown as SEQ ID NO: 1, and the DNA sequence of the complementary strand is shown as SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown as SEQ ID NO: 3, and the DNA sequence of the complementary strand is shown as SEQ ID NO: 4.

[0026] Two sgRNA sequences targeting pig HECA gene (NCBI accession number: 100512023) are designed. The designed sgRNA sequence is synthesized as follows:

[0027] sgRNA-F1 sequence: 5-CACCGATCTGCAGCTTTGGGAGGC-3; SEQ ID NO: 1

[0028] sgRNA-R1 sequence: 5-AAACGCCTCCCAAAGCTGCAGATC-3; SEQ ID NO: 2

[0029] sgRNA-F2 sequence: 5-CACCCAGCAGGGTTGTCAGTGCAC-3; SEQ ID NO: 3

[0030] sgRNA-R2 sequence: 5-AAACGTGCACTGACAACCCTGCTG-3. SEQ ID NO: 4

[0031] The DNA sequences of four single-stranded sgRNAs are annealed to form two oligonucleotide chains targeting different sites of pig HECA gene; then the oligonucleotide is ligated into PX330 plasmid vector to obtain HECA gene knockout vector.

[0032] Example 2, preparation of HECA gene knockout pig kidney cells.

[0033] After the sgRNA expression vector is sequenced and verified, the target plasmid is extracted and ethanol precipitated, and the sgRNA expression vector with a certain concentration after purification is introduced into the pig kidney cells by electroporation transfection. After 12 hours of culture, the liquid is changed, and after 72 hours, the genomes of the cells in each group are extracted. The cell clones are obtained by limiting dilution method, and then specific primers are used for PCR reaction. The obtained PCR products are sequenced, and the sgRNA cutting condition of the cells is evaluated by analyzing the sequencing peak chart, so as to obtain positive and knockout clone cells Figure 1 .

[0034] Example 3, detecting the resistance of HECA knockout pig kidney cells to human complement-mediated cytotoxicity.

[0035] When the wild and HECA knockout pig kidney cells reach about 70% confluence, the human serum is diluted with DMEM at a ratio of 1:3 and incubated with the cells. After 45 minutes, the supernatant is discarded, and the cells are washed twice with PBS and then stained with PI iodinated propylbenzene for 10 minutes. Then, the cell death is detected by flow cytometry Figure 2 It can be seen that, compared with the PK cells, the HECA gene knockout cells can significantly reduce the toxicity of human serum to pig cells after incubation with 75% serum.

[0036] Example 4, detecting the binding ability of HECA knockout pig kidney cells to human IgG and IgM.

[0037] The wild and HECA knockout pig kidney cells are trypsinized into 1.5 mL centrifuge tubes and washed twice with PBS. The human serum inactivated at 56°C for 1 hour is diluted with PBS at a ratio of 1:4 and incubated with the cells at room temperature. After 30 minutes, the cells are washed twice with PBS and then 1:200 diluted human IgG or IgM fluorescent labeled antibody is added to the cells, which are incubated at room temperature for 30 minutes. After washing with PBS, the binding ability of HECA knockout pig kidney cells to human IgG and IgM is detected by flow cytometry Figure 3 It can be seen that, compared with the PK cells, the binding of HECA gene knockout cells to human IgG or IgM is reduced to a certain extent.

[0038] It can be seen from the above examples that knocking out the HECA gene can effectively reduce the binding ability of pig kidney cells to human IgG and IgM and improve the ability of pig kidney cells to resist human complement-mediated cytotoxicity.

[0039] The present application also verifies the resistance of HECA gene knockout pig lung cells and pig liver cells to human complement-mediated cytotoxicity and the binding ability to human IgG and IgM, and obtains the same conclusion as the pig kidney cell experiment.

[0040] The present application also verifies the resistance of the HECA gene-silenced pig kidney cells to human complement-mediated cytotoxicity and the ability to bind to human IgG and IgM through examples, and obtains the same experimental conclusion as the gene knockout method.

[0041] The present application also obtains a transgenic pig through the preparation method of the transgenic pig for xenogenic organ transplantation, transplants the HECA gene-knocked-out pig kidney, lung or liver cell into an enucleated egg cell to form a nuclear transfer egg, and transplants the obtained nuclear transfer egg into the oviduct of a surrogate sow, and delivers a transgenic piglet for xenogenic organ transplantation from the pregnant sow, and the piglet is used as a donor animal for xenogenic organ and cell transplantation.

[0042] Therefore, the transgenic cloned pig of the present application can be used as a donor animal for xenogenic organ and cell transplantation.

[0043] The vector of the present application can contain a primer sequence, for example, can contain a CAG promoter, and in addition, a promoter capable of expressing in mammals such as an EF1α promoter which is generally regarded as equivalent to the CAG promoter can also be used. Also, it can be a mammalian tissue-specific promoter such as an ICAM2 promoter, and the CAG promoter is used as one of the gene expression promoters for expressing a foreign gene.

[0044] In the present application, "transgene" means a process of introducing DNA into a host and enabling it to replicate as an extrachromosomal element or by chromosomal integration. The transgene includes any method of introducing a nucleic acid molecule into an organism, a cell, a tissue, or an organ, and can be performed according to appropriate standard techniques known in the relevant art for the host cell, for example, including electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol, DEAE-dextran, cationic liposome, and lithium acetate-dimethyl sulfoxide, but is not limited thereto. In order to distinguish the transformation of eukaryotic cells by plasmid or non-plasmid type naked DNA from the meaning of transformation as the tumorigenesis of cells, it is also called "transfection", and the same meaning is used in the present application.

[0045] The present application provides a preparation method of a transgenic pig for xenogenic organ transplantation and a transgenic cloned pig for xenogenic organ transplantation produced by the above method, including the steps of transplanting the transformed cell into an enucleated egg cell to form a nuclear transfer egg; and transplanting the nuclear transfer egg into the oviduct of a surrogate sow.

[0046] In the present application, "nuclear transfer" means a genetic manipulation technique of artificially combining the nuclear DNA of other cells with a cell without a nucleus to form the same traits, and a method known in the art to which the present application pertains can be used.

[0047] In the present application, the "nucleus-transferred egg" is an egg cell into which a donor somatic cell is introduced or fused.

[0048] In the present application, the "enucleated egg cell" refers to an egg cell from which the nucleus of the egg cell is removed.

[0049] In the present application, the term "organ" refers to a collection of tissues connected in a structural unit to perform a common function. The organ can be a solid organ. The solid organ is an internal organ having a fixed histological consistency, which is neither hollow (e.g., a gastrointestinal organ) nor liquid (e.g., blood). Examples of the solid organ include the heart, kidney, liver, lung, pancreas, spleen, and adrenal gland.

[0050] In the present application, the term "tissue" refers to an intermediate of the cellular organization level between the cell and the organ. The tissue is a mass of similar cells from the same origin that work together to perform a specific function. Then, the organs are formed by the functional aggregation of multiple tissues. Examples of the tissue contemplated in the present application include, but are not limited to, connective tissue, muscle tissue, nervous tissue, epithelial tissue, and mineralized tissue. Blood, bone, tendon, ligament, fat, and honeycomb tissue are examples of connective tissue, which can also be classified into fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is classified into three different categories: visceral or smooth muscle, which is present in the inner walls of organs; skeletal muscle, which is usually attached to bones and produces large-scale movement; and cardiac muscle, which is present in the heart, which contracts to pump blood through the organism. Cells comprising the central nervous system and the peripheral nervous system are classified as nervous (or neural) tissue. In the central nervous system, nervous tissue forms the brain and spinal cord. In the peripheral nervous system, nervous tissue forms cranial and spinal nerves, including motor neurons.

[0051] In the present application, the terms "transformation" and "transfection" refer to the process by which exogenous nucleic acids are transferred or introduced into a host cell. The "transformed" cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. The cell includes a subject primary cell and its progeny.

[0052] Hereinafter, the present application will be described in detail by examples. The following examples are merely for exemplification of the present application, and the present application is not limited by the following examples.

Claims

1. A method of making a transgenic donor pig for xenotransplantation, comprising: transplanting the transformed cells to an enucleated oocyte to form a nuclear transfer egg, and transplanting the nuclear transfer egg to the oviduct of a surrogate sow; The transformed cells have introduced into them HECA a gene knockout vector, the transformed cells being used to make a donor pig for xenotransplantation, the donor pig having HECA a gene that is not expressed; The HECA Gene non-expression is achieved by gene knockout; The HECA The gene knockout vector comprises carrier one and carrier two: the carrier one is connected with sgRNA1, and the specific targeting sequence is GATCTGCAGCTTTGGGAGGC; the carrier two is connected with sgRNA2, and the specific targeting sequence is CAGCAGGGTTGTCAGTGCAC. The recipient of the organ, tissue or cell of the donor pig for xenotransplantation is a human.

2. The method of claim 1, wherein: The organ includes a liver, a lung, a kidney or a skin.

3. The method of claim 1, wherein: The tissue includes a nerve.

Images