Trichoderma harzianum HC8-23 and Its Application in the Extraction of Tricholoma matsutake Polysaccharide
By using the Trichoderma harzian HC8-23 strain for microbial fermentation, the degree of growth in matsutake mushroom was controlled, and the problem of low extraction efficiency of matsutake mushroom polysaccharides in the prior art was solved, and the effect of significantly improving the polysaccharide extraction rate was achieved.
Patent Information
- Application Number
- CN202311043656.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-18
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2043-08-18
AI Technical Summary
In the prior art, the yield rate of extracting polysaccharides from matsutake mushrooms is low, and there are problems such as long extraction time, many times and low efficiency.
The microbial fermentation of the Trichoderma harziana HC8-23 strain was used to control the growth degree of the strain, and a variety of hydrolytic enzymes were generated to hydrolyze the cell wall of Matsutake without decomposing soluble polysaccharides, thereby improving the polysaccharide extraction rate.
The extraction rate of Matsutake polysaccharide is significantly improved, and the extraction rate can be increased by 39.5% compared with the conventional methods without fermentation pretreatment.
Smart Images

Figure CN117070371B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial fermentation, and particularly to Trichoderma harzianum HC8-23 and its application in the extraction of Tricholoma matsutake polysaccharide. Background Art
[0002] Tricholoma matsutake, also known as Tricholoma matsutake and Tricholoma matsutake, belongs to the genus Tricholoma of the family Tricholomataceae, class Basidiomycetes, phylum Basidiomycota. Its fruiting body is the edible mushroom "Tricholoma matsutake" that we mentioned. Fresh Tricholoma matsutake is umbrella-shaped, with distinct color. The cap is brown, the stalk is white, the flesh is tender, plump, with a fine texture and a strong special aroma. Wild Tricholoma matsutake is extremely precious due to its low yield and high value, and is known as the "king of all mushrooms". Tricholoma matsutake contains rich nutritional components and active substances, mainly including polysaccharides, steroids, saponins, oils, triterpenes, various essential amino acids and vitamins. In terms of edible value, Tricholoma matsutake has a taste like abalone, is smooth and refreshing, has a delicious taste, and is extremely nutritious, and is deeply loved by people; in terms of medicinal value, it is recorded in "Chinese Herbal Medicine": Tricholoma matsutake is sweet, flat, non-toxic, can relax tendons and activate collaterals, regulate qi and resolve phlegm, promote diuresis and remove turbidity, and is mainly used for lumbago and leg pain, numbness of hands and feet, discomfort of meridians, excessive phlegm and shortness of breath, and dripping of urine. Modern pharmacological research shows that Tricholoma matsutake has various effects such as enhancing immunity, anti-cancer, treating diabetes, promoting gastrointestinal function, protecting the liver, improving cardiovascular diseases, and anti-aging and beautifying the skin.
[0003] Among the nutritional components contained in Tricholoma matsutake, the most concerned is the soluble polysaccharide, which has functions such as anti-tumor, treating diabetes, protecting the liver, whitening the skin, antioxidant, antibacterial, and immune enhancement, making Tricholoma matsutake considered as one of the edible mushroom resources with the most promising development prospects for health care functional foods and medicines.
[0004] At present, there are many research reports on the extraction methods of Tricholoma matsutake polysaccharide. The common method is the hot water extraction and ethanol precipitation method (abbreviated as "water extraction and alcohol precipitation method"). The conventional hot water extraction method has the advantages of simple operation and low cost, but has the disadvantages of long extraction time, multiple extraction times, and low extraction efficiency.
[0005] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of natural active substances. It has the advantages of mild conditions, little damage to the structure of active ingredients, and can significantly improve the extraction yield of products. In the enzymatic hydrolysis-assisted extraction method, the most used enzyme is cellulase, followed by pectinase and protease, or multiple enzymes are used simultaneously. The cell wall of plants or edible mushrooms consists of substances such as cellulose, hemicellulose, chitin, and pectin. Therefore, using a single enzyme alone has very limited effect on improving the extraction yield of products. Many studies use multiple enzymes (complex enzymes) simultaneously. If the amount of enzyme used is large, it will undoubtedly increase the extraction cost.
[0006] Natural substances in nature are decomposed and rotted by microorganisms. These microorganisms can produce various enzymes that decompose plant or edible (medicinal) mushroom tissues during their growth, including cellulase, hemicellulase, ligninase, pectinase, etc. These enzymes on the market are also produced by microbial fermentation. If microorganisms are directly used to ferment plant or edible mushroom extraction raw materials, not only the cost of enzymes is saved, but also the combined action of various enzymes produced by microorganisms has a better hydrolysis effect on the cell wall, and the extraction rate of active ingredients will inevitably be significantly improved. The technology of using microbial fermentation to improve the extraction rate of polysaccharide substances from Tricholoma matsutake has not been developed and applied at present. Summary of the Invention
[0007] Currently, the extraction rate of polysaccharide substances from Tricholoma matsutake is low. To solve this technical problem, the present invention provides a Trichoderma harzianum HC8-23 and its application in the extraction of Tricholoma matsutake polysaccharides.
[0008] One of the purposes of the present invention is to provide a new microbial strain, Trichoderma harzianum HC8-23. By inoculating this strain into Tricholoma matsutake for microbial fermentation, the extraction rate of polysaccharides in Tricholoma matsutake is greatly improved.
[0009] Another purpose of the present invention is to provide a method for the application of Trichoderma harzianum HC8-23 in the extraction of Tricholoma matsutake polysaccharides, that is, controlling the growth degree of Trichoderma harzianum HC8-23 to achieve the production of enzymes to hydrolyze the cell wall of Tricholoma matsutake, but not decomposing the soluble polysaccharides, thereby promoting the dissolution of Tricholoma matsutake polysaccharides and finally improving the extraction rate.
[0010] The specific technical solution of the present invention is as follows:
[0011] On the one hand, the present invention provides a Trichoderma harzianum HC8-23, and its preservation number is GDMCC No: 63393.
[0012] The strain HC8 was isolated from the microbial enrichment culture of Tricholoma matsutake powder in the present invention. After ultraviolet mutagenesis, the strain HC8-23, that is, Trichoderma harzianum HC8-23, was screened. This strain is preserved in the Guangdong Provincial Microbial Culture Collection Center, with the preservation number GDMCC No: 63393, the preservation date is April 24, 2023, and the address is: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province; Zip code 510070. The present invention provides a new microbial strain, Trichoderma harzianum HC8-23. By inoculating this strain into Tricholoma matsutake for microbial fermentation, the extraction rate of polysaccharides in Tricholoma matsutake is greatly improved.
[0013] Among them, the nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of Trichoderma harzianum HC8-23 is shown in SEQ ID NO.1.
[0014] On the other hand, the present invention provides the application of the above-mentioned Trichoderma harzianum HC8-23 in the extraction of matsutake polysaccharide.
[0015] The present invention provides a new microbial strain, Trichoderma harzianum HC8-23, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of matsutake and obtained through mutagenesis. Trichoderma harzianum HC8-23 can produce various enzymes for decomposing the cell wall of matsutake during growth, including cellulase, chitinase, protease, etc. Therefore, on the premise of screening the dominant strain applied to the extraction of polysaccharide from matsutake, directly fermenting the pretreated matsutake with this strain, as long as the growth degree is well controlled to achieve the production of enzymes to hydrolyze the cell wall of matsutake but without decomposing the soluble polysaccharide, the dissolution of matsutake polysaccharide can be promoted, and the extraction rate can be increased.
[0016] Specifically, the present invention also provides the method of the above application, including the following steps:
[0017] (1) Add the spore solution of Trichoderma harzianum HC8-23 to the matsutake powder, mix well and then ferment to obtain the matsutake fermented product;
[0018] (2) Add deionized water to the matsutake fermented product, stir well, then carry out heat preservation treatment and ultrasonic treatment, and after filtration and concentration, obtain the concentrated aqueous extract of matsutake;
[0019] (3) Add ethanol to the concentrated aqueous extract of matsutake to obtain a precipitate, and the precipitate is washed and dried to obtain matsutake polysaccharide.
[0020] Through the above steps (1) to (3), the extraction rate of polysaccharide during the ultrasonic aqueous extraction of matsutake powder can be significantly improved. In step (1), Trichoderma harzianum HC8-23 grows moderately in the matsutake powder added with sucrose and produces various hydrolytic enzymes; then, in step (2), the fermented matsutake powder is added with water for heat preservation, and substances such as cellulose in the cell wall are partially hydrolyzed, which helps the polysaccharide in the bound matsutake powder to dissolve during ultrasonic aqueous extraction, thereby significantly increasing the extraction rate of polysaccharide. Specifically:
[0021] In step (1), after inoculating the spore solution of Trichoderma harzianum HC8-23 into the matsutake powder, ferment to make the growth of Trichoderma harzianum HC8-23 just reach the appropriate degree for enzyme production.
[0022] In step (2), after adding deionized water to the matsutake fermented product, carry out heat preservation treatment and ultrasonic treatment to just reach the degree of hydrolyzing substances such as cellulose in the cell wall of matsutake but without decomposing the soluble polysaccharide.
[0023] As a preference of the above technical solution of the present invention, in step (1), the fermentation temperature is 28 - 32 °C and the time is 48 - 56 h.
[0024] After inoculating the Trichoderma harzianum HC8 - 23 spore liquid into the matsutake powder and fermenting at 28 - 32 °C for 48 - 56 h, the growth of Trichoderma harzianum HC8 - 23 can just reach the appropriate degree for enzyme production.
[0025] As a preference of the above technical solution of the present invention, based on the mass of the matsutake powder, in step (2), the added volume of deionized water is 20 - 30 mL / g; the temperature of the heat preservation treatment is 36 - 40 °C and the time is 3 - 5 h.
[0026] After adding deionized water to the matsutake powder fermented product and heat preserving at 36 - 40 °C for 3 - 5 h, it can just reach the degree of hydrolyzing substances such as cellulose in the matsutake powder cell wall but not decomposing soluble polysaccharides.
[0027] As a preference of the above technical solution of the present invention, in step (1), the concentration of the Trichoderma harzianum HC8 - 23 spore liquid is 1×10 7 ~2×10 7 CFU / mL.
[0028] As a preference of the above technical solution of the present invention, based on the mass of the matsutake powder, in step (1), the added amount of the Trichoderma harzianum HC8 - 23 spore liquid is 4 - 5 mL / g.
[0029] As a preference of the above technical solution of the present invention, the preparation method of the Trichoderma harzianum HC8 - 23 spore liquid is: inoculating Trichoderma harzianum HC8 - 23 spores on a potato dextrose agar plate medium, culturing at a constant temperature of 28 - 30 °C for 60 - 72 h to obtain a culture, and then adding a sterile sucrose aqueous solution to the culture and stirring to suspend the spores to obtain a spore liquid.
[0030] As a preference of the above technical solution of the present invention, in step (2), the temperature of the ultrasonic treatment is 86 - 94 °C, the power is 150 - 200 W, and the time is 40 - 60 min.
[0031] After adding deionized water to the matsutake fermented product for heat preservation treatment and then performing ultrasonic treatment, it is helpful to extract polysaccharides from the fermented product that has just reached the degree of hydrolyzing substances such as cellulose in the matsutake powder cell wall but not decomposing soluble polysaccharides.
[0032] As a preference of the above technical solution of the present invention, in step (2), the concentration condition is: concentrating under reduced pressure to 1 / 30 - 1 / 20 of the original volume.
[0033] As a preference of the above technical solution of the present invention, step (3) is: adding anhydrous ethanol with a volume 4 to 5 times that of the aqueous extract concentrate of Tricholoma matsutake to make the ethanol volume fraction of the system 80% - 83.3%, then standing for 10 - 14 h at 2 - 6 °C to obtain a precipitate, then washing the precipitate with anhydrous ethanol, and finally drying it to constant weight under vacuum to obtain Tricholoma matsutake polysaccharide.
[0034] Compared with the prior art, the present invention has the following technical effects:
[0035] The present invention provides a new microbial strain, Trichoderma harzianum HC8 - 23, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of Tricholoma matsutake and obtained through mutagenesis, and is applied to improve the extraction yield of Tricholoma matsutake polysaccharide with remarkable effects.
[0036] The present invention also provides an application method of Trichoderma harzianum HC8 - 23 in the extraction of Tricholoma matsutake polysaccharide. By using Trichoderma harzianum HC8 - 23 in Tricholoma matsutake powder added with sucrose and optimizing the fermentation conditions to make it grow moderately and produce various hydrolases, the cell wall of Tricholoma matsutake can be hydrolyzed by the produced enzymes without decomposing the soluble polysaccharide, and finally the extraction yield of polysaccharide is significantly improved. By applying this method, compared with the conventional ultrasonic extraction method without using Trichoderma harzianum HC8 - 23 fermentation pretreatment, the extraction yield of polysaccharide in Tricholoma matsutake can be increased by 39.5%. Description of the Drawings
[0037] Figure 1 The standard curve for determining polysaccharide by the phenol - sulfuric acid method with glucose as the standard.
[0038] Figure 2 The standard curve for determining glucose by the DNS method in Example 2 of the present invention.
[0039] Figure 3 The colony morphology photo of Trichoderma harzianum HC8 - 23 cultured on PDA at 28 °C for 3 d in Example 3 of the present invention. Detailed Embodiments
[0040] The present invention will be further described below in conjunction with the embodiments and the drawings. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only some embodiments of the present invention, rather than all embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention shall fall within the scope of protection of the present invention.
[0041] The matsutake used in the embodiments of the present invention is the fruiting body of the fungus Tricholoma matsutake of the family Tricholomataceae; the matsutake powder is the fine powder obtained by drying the matsutake at 85°C and then pulverizing it through a 60-mesh sieve.
[0042] In the embodiments and comparative examples of the present invention, the content of matsutake polysaccharide was determined by the phenol-sulfuric acid method. The specific method is as follows: The test sample solution was appropriately diluted with deionized water (estimating that the concentration of polysaccharide in the sample is within the range of the standard curve determination); the solid matsutake polysaccharide extract was formulated into a sample solution with a concentration of 0.1 mg / mL with deionized water as the test sample. 1 mL of the sample solution was pipetted into a 10-mL stoppered tube, 1 mL of a 5% aqueous phenol solution by volume was added, and after shaking well, 5 mL of concentrated sulfuric acid (mass concentration 98%) was quickly added. After shaking well, it was heated in a boiling water bath for 15 min and then cooled to room temperature. Using the same treatment with 1 mL of deionized water as the blank control as the reference, the absorbance (A 490 ) was measured at a wavelength of 490 nm. The A 490 of glucose samples with different concentrations was measured in the same way, and a glucose concentration - A 490 standard curve was plotted. As Figure 1 shown, the regression equation y = 0.0124x + 0.0057 (R 2 = 0.9990) was obtained, and the content of polysaccharide in the matsutake polysaccharide sample was calculated from the regression equation.
[0043] The extraction yield of matsutake polysaccharide was calculated as follows:
[0044]
[0045] Isolation and screening of microbial strains for fermented matsutake in Example 1
[0046] The microbial strains for fermented matsutake were obtained by isolation and screening according to the following steps:
[0047] (1) Add 5 g of matsutake powder to a 250-mL Erlenmeyer flask, then add 25 mL of sterile normal saline to moisten it, and incubate at 28°C for 72 h. The enriched culture covered with mold was diluted 1×10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8After dilution by [multiple], 0.1 mL of the diluted solution was respectively pipetted and spread on potato dextrose agar (PDA) plates. During the incubation at 28 °C for 60 h, mold colonies with different colors and morphologies were picked and transferred to fresh PDA plates, and then incubated at 28 °C for 72 h to obtain 9 pure culture strains. The numbers of each strain are shown in Table 1. Among them, the PDA plate medium is a ready-made potato dextrose agar medium (Qingdao Haibo Biotechnology Co., Ltd.), prepared with tap water at a concentration of 46 g / L, with a natural pH. It was placed in an Erlenmeyer flask, sealed with 8 layers of gauze, sterilized at 121 °C for 20 min by high-pressure steam, and poured into a sterile Petri dish with a diameter of 9 cm before solidification, 20 mL per dish.
[0048] (2) To the fresh plate cultures of the 9 strains, 10 mL of sterile sucrose aqueous solution was respectively added, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted with sterile sucrose aqueous solution so that the spore concentrations of different strains were between 1×10 7 ~2×10 7 spores / mL to obtain the spore suspensions of each strain. Among them, the concentration of the sterile sucrose aqueous solution was 10 g / L, and it was sterilized at 115 °C for 15 min by high-pressure steam.
[0049] (3) In 9 100-mL Erlenmeyer flasks sterilized at 160 °C for 2 h by dry heat, 2 g of matsutake powder was respectively added, and then 10 mL of each mold spore suspension prepared in step (2) was added respectively (the volume dosage was 5 mL / g based on the mass of matsutake powder). After stirring evenly, the Erlenmeyer flasks were sealed with 8 layers of gauze and cultured at 28 °C for 56 h to obtain matsutake fermented products.
[0050] (4) To all the matsutake powder fermented by each strain in step (3), 40 mL of deionized water was added respectively (the material-liquid ratio was 1 g:20 mL), stirred evenly, kept warm in a water bath at 36 °C for 5 h, and then transferred to an ultrasonic cleaner at 86 °C for ultrasonic extraction at 200 W for 40 min. After the ultrasonic water extraction was completed, it was filtered by Buchner funnel while it was hot. 1 mL of the filtrate was taken and placed in a 10-mL centrifuge tube, and then 5 mL of anhydrous ethanol was added (the ethanol volume fraction of the solution was 83.3%). After shaking well, it was left to stand at 6 °C for 14 h, centrifuged at 4 °C and 8000 r / min for 5 min, the supernatant was discarded, 5 mL of deionized water was added to dissolve it, and the phenol-sulfuric acid method was used to determine the content of soluble polysaccharides in the aqueous solution.
[0051] According to the methods of steps (3) and (4) above, 10 mL of sterile sucrose solution (concentration 10 g / L) was added to 2 g of matsutake powder as a blank fermentation control without inoculating mold; according to the method of step (4) above, 2 g of matsutake was directly extracted with 40 mL of deionized water to extract polysaccharides as an unfermented extraction control. The polysaccharide extraction yields of matsutake fermented by different strains and the control are shown in Table 1.
[0052] Table 1 Polysaccharide extraction yields of Tricholoma matsutake fermented by different strains and the control
[0053] Serial number Strain number and control Polysaccharide extraction rate (%) Increase rate (%) 1 HC1 9.32 1.97 2 HC2 9.66 5.69 3 HC3 9.28 1.53 4 HC4 8.61 -5.80 5 HC5 9.47 3.61 6 HC6 10.7 17.1 7 HC7 8.95 -2.08 8 HC8 11.2 22.5 9 HC9 9.93 8.64 10 Blank fermentation control 9.07 -0.766 11 Unfermented control 9.14 /
[0054] It can be seen from the data in Table 1 that for the blank fermentation control with sterile sucrose aqueous solution added but no mold inoculated, since almost no mold grew, the polysaccharide extraction yield decreased slightly compared to the unfermented control, but there was no significant difference; after fermentation of Tricholoma matsutake by most strains, the polysaccharide extraction yield did not increase significantly and even decreased; after fermentation of Tricholoma matsutake by strain HC8, the polysaccharide extraction yield was 11.2%, which was 22.5% higher than 9.14% of the unfermented control. Therefore, in the present invention, strain HC8 was selected as the microbial strain for fermenting Tricholoma matsutake for subsequent mutagenesis breeding to further increase the polysaccharide extraction yield.
[0055] Example 2 Mutagenesis breeding of the microbial strain for fermenting Tricholoma matsutake
[0056] Strain HC8 was subjected to mutagenesis breeding to screen for strains with better fermentation performance. The specific method was as follows:
[0057] (1) Preparation of spore suspension: Strain HC8 was activated and cultured on a PDA plate medium at 30 °C for 48 h, 5 mL of sterile normal saline was added, and the spores were suspended by stirring with an inoculation loop. 1 mL of the spore suspension was transferred to a triangular flask containing 50 mL of sterile normal saline (with 20 - 30 glass beads added), and shaken at room temperature for 15 min. The spore suspension was filtered to remove hyphae (a small mass of fluffy absorbent cotton was plugged at the bottom of the triangular funnel), the spores in the spore suspension were counted with a hemocytometer under a microscope, and appropriately diluted with sterile normal saline to adjust the spore concentration to 1.42×10 7 cells / mL;
[0058] (2) Mutagenesis: Under red light illumination, 1.5 mL of the above spore suspension and a sterile paper clip were respectively placed in 6 petri dishes with a diameter of 6 cm. The petri dishes were respectively placed on a magnetic stirrer, and irradiated at a distance of 30 cm from a 15 W ultraviolet lamp preheated for 30 min for 1, 2, 3, 4, 5, and 6 min respectively. 0.5 mL of the spore suspension after the above irradiation treatment was taken, appropriately diluted, and 0.1 mL was respectively transferred and spread on the PDA plate medium. With the same operation, the spore suspension without ultraviolet irradiation was diluted and spread on the plate as a control to calculate the lethality rate. The inoculated PDA plates were wrapped with black cloth and inverted and cultured at 28 °C for 48 h, the colonies on the plates were counted, and the lethality rate was calculated;
[0059] (3) Screening: Colonies on PDA plates with a lethality rate above 90% were picked and transferred to fresh PDA plate media, and cultured at 28 °C for 72 h to obtain 35 strains. In the fresh plate cultures of each strain, 10 mL of sterile normal saline was added respectively, and the spores were suspended by stirring with an inoculation loop to obtain the spore suspensions of each strain. 2.5 mL of the spore suspension of each strain was inoculated into 50 mL of enzyme-producing medium, and cultured with shaking at 30 °C and 200 r / min for 72 h. The fermentation broth was filtered by Buchner funnel, and the filtrate (i.e., crude enzyme solution) was collected, and the cellulase activity of the crude enzyme solution of each strain was determined. Ten strains with significantly increased enzyme production activity compared to the original strain HC8 were selected. Then, according to the method of Example 1, the spore suspensions of these strains were used to inoculate Tricholoma matsutake powder for fermentation, and polysaccharides were extracted by the method of water extraction and alcohol precipitation. The polysaccharide extraction yields of Tricholoma matsutake fermented by mutant strains and the control are shown in Table 2.
[0060] Among them, the composition of the enzyme-producing medium is: wheat bran 50 g / L, (NH4)2SO4 6 g / L, peptone 4 g / L, KH2PO4 2 g / L, MgSO4·7H2O 1 g / L, CaCl2 0.5 g / L, the solvent is tap water, and the pH is 6.0. 50 mL of the enzyme-producing medium was filled in a 250 mL Erlenmeyer flask, sealed with 8 layers of gauze, and sterilized at 121 °C under high-pressure steam for 20 min.
[0061] Table 2 Polysaccharide extraction yields of Tricholoma matsutake fermented by mutant strains and the control
[0062]
[0063] It can be seen from the data in Table 2 that among the 10 selected strains, the strain numbered HC8-23 has a cellulase activity of 88.3 U / mL in fermentation, which is 33.0% higher than that of the wild strain HC8 (66.4 U / mL). After fermenting Tricholoma matsutake with this strain, the polysaccharide extraction yield is 12.7%, which is 13.4% higher than that of the wild strain HC8 (11.2%), and 38.9% higher than that of the non-fermented control (9.14%). Therefore, the present invention selects the HC8-23 strain as the microbial strain for fermenting Tricholoma matsutake, and optimizes the extraction conditions to improve the polysaccharide extraction yield.
[0064] Among them, the method for determining cellulase activity is as follows: 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (pH 6.0, prepared with 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were added to a 10 mL graduated test tube, incubated in a water bath at 50 °C for 30 min, then 3 mL of DNS reagent was added, boiled for 5 min, cooled with running water, and made up to 10 mL with deionized water and stirred evenly; the crude enzyme solution inactivated by boiling at 100 °C for 10 min was treated in the same way as a reference, and the absorbance (A 540 ) was measured at a wavelength of 540 nm with a spectrophotometer. From the glucose standard curve (such asFigure 2 Calculate the glucose concentration in the sample as shown, and then calculate the cellulase activity (U / mL). Definition of cellulase activity: Under the conditions of pH 6.0 and 50 °C, the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute is 1 enzyme activity unit (U).
[0065] The formula for calculating cellulase activity is: U = (CV1) / (TV2). Where, C is the glucose concentration (μmol / mL) calculated from the standard curve; V1 is the volume of the enzyme reaction system, which is 2 mL; T is the reaction time, which is 30 min; V2 is the volume of the crude enzyme solution, which is 0.5 mL.
[0066] Among them, for the drawing of the glucose standard curve: In 7 10-mL graduated test tubes, add 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of a standard glucose aqueous solution with a concentration of 5 μmol / mL respectively. Then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, and 0.8 mL of 0.2 mol / L phosphate buffer solution at pH 6.0 to each. Then add 3.0 mL of DNS solution to each. The mixed solution is boiled in a boiling water bath for 5 min, cooled with running water, and then made up to 10 mL with deionized water, stirred evenly. Using the color-developed solution in the test tube without glucose as the reference, measure A 540 , with the glucose concentration as the abscissa and A 540 as the ordinate to draw the standard curve. As Figure 2 shown, the regression equation is y = 0.25246x + 0.01487 (R 2 = 0.9995).
[0067] Among them, the preparation method of DNS reagent is: Add 6.3 g of 3,5-dinitrosalicylic acid and 262 mL of 2 mol / L NaOH aqueous solution to 500 mL of a hot aqueous solution containing 182 g of sodium tartrate. Then add 5 g of redistilled phenol and 5 g of sodium sulfite, stir to dissolve, cool, and make up to 1 L with deionized water. Store in a brown bottle and use after 7 days.
[0068] Example 3 Classification and Identification of Strain HC8-23
[0069] The strain HC8-23 was streaked on a PDA plate medium. After culturing at 28 °C for 1 day, white hyphae grew out, which were relatively thin. After 3 days, the colony was white and flocculent, relatively thick, and then yellowish to yellowish-green powdery spores were produced on the surface. The back of the colony was orange-yellow, and orange-yellow pigment diffused in the medium. The conidiophores grew from the lateral branches of the hyphae, opposite or alternate, and generally had 2-3 branches. The conidiogenous cells of the conidia were flask-shaped or conical, and the conidia were nearly spherical or oval, yellow when young, and gradually turned green later, with a smooth surface, and the size was 2.0-2.5 μm × 2.5-3.0 μm. Among them, the morphological photo of the colony of strain HC8-23 cultured on PDA at 28 °C for 3 days can be seen in Figure 3 ; among them, the composition and preparation method of the PDA plate medium were the same as those in Example 1.
[0070] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of strain HC8-23 was shown as SEQ ID NO.1. This sequence was subjected to BLAST alignment in NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov), and had a homology greater than 99.82% with the rDNA-ITS sequence of a known Trichoderma harzianum strain BDS2. The morphological characteristics of the colony of strain HC8-23 also conform to the morphological characteristics of Trichoderma harzianum. Therefore, the biological classification position of strain HC8-23 can be determined (refer to Mycobank, http: / / www.mycobank.org): Fungi, Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Hypocreaceae, Trichoderma, Trichoderma harzianum.
[0071] The rDNA-ITS nucleotide sequence of the said strain HC8-23 is as follows:
[0072] GGAAGTAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTGCTGGAACGCGCTTCGGCGCCCAAGAAACCCTTTGTGAACTTATACCTATTGTTGCCTCGGCGCAGGCCGGCCTCTTCACTGAGGCCCCCTGGAACAGGGAGCAGCCCGCCGGCGGCCAACCAAACTCTTGTTTCTACAGTGAATCTCTGAGTAAAAAACATAAATGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCTCTCTGACGAGAGCAGGCCCTGAAATCTATGGCGAGCTCGCTAGGACCCCGAGCGTAGTAGTTATATCTCGTTCTGGAAGGCCCTGGCGGTGCCCTGCCGTTAACCCCCAACTTCTGAAAATTTGACCTCGG。
[0073] In summary, strain HC8 was isolated from the microbial enrichment culture of Tricholoma matsutake powder. After ultraviolet mutagenesis, strain HC8-23 was screened and obtained, namely Trichoderma harzianum HC8-23. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63393, the deposit date of April 24, 2023, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode 510070.
[0074] Example 4 Application of Trichoderma harzianum HC8-23 in the extraction of polysaccharides from Tricholoma matsutake
[0075] The application of Trichoderma harzianum HC8-23 in the extraction of polysaccharides from Tricholoma matsutake is operated according to the following steps:
[0076] (1) The spores of the PDA plate colony of Trichoderma harzianum HC8-23 stored at 4°C were inoculated on a fresh PDA plate medium and incubated at 28°C for 72 h. Add 10 mL of sterile sucrose aqueous solution to the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration to 1.64×107 1.57×10 spores / mL to obtain Trichoderma harzianum HC8-23 spore solution. The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 10 g / L, and it is sterilized at 115 °C for 15 min by high-pressure steam;
[0077] (2) Put 10 g of matsutake powder into a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h, add 50 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage is 5 mL / g based on the mass of matsutake powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and culture it at 28 °C for 56 h to obtain matsutake fermented product;
[0078] (3) Transfer all the matsutake fermented product in step (2) into a 500 mL beaker, add 200 mL of deionized water (the material-liquid ratio is 1 g:20 mL), stir evenly, and keep it warm in a water bath at 36 °C for 5 h. Then, transfer the beaker into an ultrasonic cleaner with a water temperature of 86 °C, extract with ultrasound at 200 W for 40 min, filter while it is hot with a Buchner funnel, and concentrate all the filtrate to 10 mL (1 / 20 of the original filtrate volume) under the conditions of 60 °C and -0.1 MPa to obtain a concentrated matsutake water extract;
[0079] (4) Add 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the volume fraction of ethanol in the system is 80%) to all the concentrated matsutake water extract obtained in step (3). After standing at 6 °C for 14 h, centrifuge at 4 °C and 8000 r / min for 10 min, discard the supernatant, wash the precipitate with 30 mL of absolute ethanol (the volume dosage is 3 mL / g based on the mass of matsutake powder) once, centrifuge again, and dry the precipitate in a vacuum at 65 °C and -0.1 MPa to constant weight to obtain a matsutake polysaccharide extract.
[0080] Example 5 Application of Trichoderma harzianum HC8-23 in the extraction of matsutake polysaccharide
[0081] The application of Trichoderma harzianum HC8-23 in the extraction of polysaccharides from matsutake is carried out according to the following steps:
[0082] (1) The PDA plate spores of Trichoderma harzianum HC8-23 stored at 4 °C are inoculated on a fresh PDA plate medium and cultured at a constant temperature of 30 °C for 66 h. Add 10 mL of sterile sucrose aqueous solution to the culture dish, stir with an inoculation loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration to 1.57×10 7 1.57×10 spores / mL to obtain Trichoderma harzianum HC8-23 spore solution. The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 12 g / L, and it is sterilized at 115 °C for 15 min by high-pressure steam;
[0083] (2) Place 10 g of matsutake powder into a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 45 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the matsutake powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze, and culture it at 30 °C for 52 h to obtain the matsutake fermented product;
[0084] (3) Transfer all of the matsutake fermented product from step (2) into a 500 mL beaker, add 250 mL of deionized water (the solid-liquid ratio is 1 g:25 mL), stir evenly, and then keep it warm in a water bath at 38 °C for 4 h. After that, transfer the beaker into an ultrasonic cleaner with a water temperature of 90 °C, extract with ultrasound at 175 W for 50 min, filter while it is hot with a Buchner funnel, and concentrate all of the filtrate under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated matsutake water extract;
[0085] (4) Add 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the volume fraction of ethanol in the system is 80%) to all of the concentrated matsutake water extract obtained in step (3). Let it stand at 4 °C for 12 h, then centrifuge at 4 °C and 8000 r / min for 10 min. Discard the supernatant, wash the precipitate once with 25 mL of absolute ethanol (the volume dosage is 2.5 mL / g based on the mass of the matsutake powder), centrifuge again, and dry the precipitate in a vacuum at 65 °C and -0.1 MPa until it reaches a constant weight to obtain the matsutake polysaccharide extract.
[0086] Example 6 Application of Trichoderma harzianum HC8-23 in the Extraction of Matsutake Polysaccharide
[0087] The application of Trichoderma harzianum HC8-23 in the extraction of polysaccharides from matsutake is carried out according to the following steps:
[0088] (1) The PDA plate spores of Trichoderma harzianum HC8-23 stored at 4 °C are inoculated onto a fresh PDA plate medium and cultured at a constant temperature of 30 °C for 60 h. Add 10 mL of a sterile sucrose aqueous solution to the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration to 1.38×10 7 spores / mL with a sterile sucrose aqueous solution to obtain the Trichoderma harzianum HC8-23 spore solution. The composition and preparation method of the PDA plate medium are the same as in Example 1; the concentration of the sterile sucrose aqueous solution is 14 g / L, and it is sterilized by high-pressure steam at 115 °C for 15 min;
[0089] (2) Place 10 g of matsutake powder into a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 40 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage is 4 mL / g based on the mass of the matsutake powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze, and culture it at 32 °C for 48 h to obtain the matsutake fermented product;
[0090] (3) All the fermented matsutake in step (2) were transferred to a 500 mL beaker, 300 mL of deionized water (solid-liquid ratio of 1 g:30 mL) was added, and after stirring evenly, the mixture was kept warm in a 40°C water bath for 3 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 94°C, and ultrasonic extraction was performed at 150 W for 60 min. The mixture was filtered with a Buchner funnel while hot, and all the filtrate was concentrated under reduced pressure at 60°C and -0.1 MPa to 10 mL (1 / 30 of the original filtrate volume) to obtain a matsutake water extract concentrate;
[0091] (4) Add 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%) to all the pine mushroom water extract concentrate obtained in step (3), let it stand for 10 h at 2°C, centrifuge it at 4°C and 8000 r / min for 10 min, discard the supernatant, add 20 mL of anhydrous ethanol (based on the mass of pine mushroom powder, the volume dosage is 2 mL / g) to wash the precipitate once, centrifuge it again, and dry the precipitate at 65°C and -0.1 MPa in a vacuum dry state to constant weight to obtain a pine mushroom polysaccharide extract.
[0092] Comparative Example 1
[0093] The main difference from Example 5 is that the fermentation pretreatment of Trichoderma harzianum HC8-23 is not performed before water extraction and alcohol precipitation, and the following steps are performed:
[0094] (1) 10g of matsutake powder was placed in a 500mL beaker, and 250mL of deionized water (solid-liquid ratio was 1g:25mL) was added. After stirring evenly, the mixture was kept in a 38℃ water bath for 4h. After that, the beaker was transferred to an ultrasonic cleaner at 90℃, and ultrasonic extraction was performed at 175W for 50min. The mixture was filtered with a Buchner funnel while hot, and the filtrate was concentrated to 10mL (1 / 25 of the original filtrate volume) under reduced pressure at 60℃ and -0.1MPa to obtain a matsutake water extract concentrate.
[0095] (2) To the entire pine mushroom water extract concentrate obtained in step (1), add 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%), let it stand at 4°C for 12 h, centrifuge it at 4°C and 8000 r / min for 10 min, discard the supernatant, add 25 mL of anhydrous ethanol (based on the mass of pine mushroom powder, the volume dosage is 2.5 mL / g) to wash the precipitate once, centrifuge it again, and dry the precipitate at 65°C and -0.1 MPa in a vacuum dryer until constant weight to obtain a pine mushroom polysaccharide extract.
[0096] Comparative Example 2
[0097] The main difference from Example 5 is that the fermentation temperature in step (2) is 25° C. The other steps are the same as those in Example 5, and step (2) is performed as follows:
[0098] 10 g of matsutake powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the matsutake powder) was added and stirred evenly. The mouth of the Erlenmeyer flask was tied with eight layers of gauze and cultured at 25 °C for 52 h to obtain the matsutake fermented product.
[0099] Comparative Example 3
[0100] The main difference from Example 5 was that: the fermentation temperature in step (2) was 35 °C. The other steps were the same as those in Example 5. Step (2) was operated according to the following method:
[0101] 10 g of matsutake powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the matsutake powder) was added and stirred evenly. The mouth of the Erlenmeyer flask was tied with eight layers of gauze and cultured at 35 °C for 52 h to obtain the matsutake fermented product.
[0102] Comparative Example 4
[0103] The main difference from Example 5 was that: the fermentation time in step (2) was 40 h. The other steps were the same as those in Example 5. Step (2) was operated according to the following steps: 10 g of matsutake powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the matsutake powder) was added and stirred evenly. The mouth of the Erlenmeyer flask was tied with eight layers of gauze and cultured at 30 °C for 40 h to obtain the matsutake fermented product.
[0104] Comparative Example 5
[0105] The main difference from Example 5 was that: the fermentation time in step (2) was 64 h. The other steps were the same as those in Example 5. Step (2) was operated according to the following steps: 10 g of matsutake powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the Trichoderma harzianum HC8-23 spore solution prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the matsutake powder) was added and stirred evenly. The mouth of the Erlenmeyer flask was tied with eight layers of gauze and cultured at 30 °C for 64 h to obtain the matsutake fermented product.
[0106] Comparative Example 6
[0107] The main difference from Example 5 was that: the heat preservation temperature in step (3) was 30 °C. The other steps were the same as those in Example 5. Step (3) was operated according to the following steps:
[0108] All the Tricholoma matsutake fermented products from step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 30 °C for 4 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 90 °C, and ultrasonic extraction was carried out at 175 W for 50 min. Immediately after that, it was filtered by a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated water extract of Tricholoma matsutake.
[0109] Comparative Example 7
[0110] The main difference from Example 5 was that: the insulation temperature in step (3) was 46 °C. Other steps were the same as those in Example 5, and step (3) was operated according to the following steps:
[0111] All the Tricholoma matsutake fermented products from step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 46 °C for 4 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 90 °C, and ultrasonic extraction was carried out at 175 W for 50 min. Immediately after that, it was filtered by a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated water extract of Tricholoma matsutake.
[0112] Comparative Example 8
[0113] The main difference from Example 5 was that: the insulation time in step (3) was 2 h. Other steps were the same as those in Example 5, and step (3) was operated according to the following steps:
[0114] All the Tricholoma matsutake fermented products from step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 38 °C for 2 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 90 °C, and ultrasonic extraction was carried out at 175 W for 50 min. Immediately after that, it was filtered by a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated water extract of Tricholoma matsutake.
[0115] Comparative Example 9
[0116] The main difference from Example 5 was that: the insulation time in step (3) was 6 h. Other steps were the same as those in Example 5, and step (3) was operated according to the following steps:
[0117] All the Tricholoma matsutake fermented products from step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g: 25 mL), and after stirring evenly, it was kept warm in a water bath at 38 °C for 6 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 90 °C, and ultrasonic extraction was carried out at 175 W for 50 min. Immediately after that, suction filtration was performed with a Buchner funnel while it was hot. All the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of Tricholoma matsutake.
[0118] Evaluation of fermentation results
[0119] In Examples 4 to 6 and Comparative Examples 1 to 9, the mass of the polysaccharide extract obtained from 10 g of Tricholoma matsutake, the mass of Tricholoma matsutake polysaccharide, the percentage content of Tricholoma matsutake polysaccharide, and the extraction yield of Tricholoma matsutake polysaccharide are shown in Table 3. Among them, the percentage content of Tricholoma matsutake polysaccharide is the percentage of the mass of Tricholoma matsutake polysaccharide in the mass of the obtained polysaccharide extract.
[0120] Table 3 Yields of extracting Tricholoma matsutake polysaccharide in Examples 4 to 6 and Comparative Examples 1 to 9
[0121]
[0122] It can be seen from the data in Table 3 that:
[0123] ① Comparing Comparative Example 1 with Example 5, before conventional water extraction and alcohol precipitation, fermentation pretreatment with Trichoderma harzianum HC8-23 was carried out, and the extraction yield of polysaccharide was greatly improved, indicating the excellent effect of fermentation pretreatment with Trichoderma harzianum HC8-23 on improving the extraction yield of polysaccharide before water extraction and alcohol precipitation. Analyzing the reason, Trichoderma harzianum HC8-23 can produce a variety of hydrolases to hydrolyze the cell wall of Tricholoma matsutake, and finally the extraction yield of polysaccharide is significantly improved. The extraction yield of Example 5 with fermentation pretreatment of Trichoderma harzianum HC8-23 was 12.4%, which was 39.5% higher than that of Comparative Example 1 without treatment.
[0124] ② By comparative analysis of Comparative Examples 2 to 5 and Example 5, the fermentation temperature or time of Comparative Examples 2 to 5 was different from that of Example 5, and their polysaccharide extraction yields decreased, indicating that when Trichoderma harzianum HC8-23 was applied to the extraction of Tricholoma matsutake polysaccharide, after adding Trichoderma harzianum HC8-23 spore liquid to Tricholoma matsutake powder, fermenting at 28 - 32 °C for 48 - 56 h had a good effect on improving the polysaccharide extraction of Tricholoma matsutake powder. Analyzing the reason, after adding Trichoderma harzianum HC8-23 spore liquid to Tricholoma matsutake powder and fermenting at 28 - 32 °C for 48 - 56 h, the growth of Trichoderma harzianum HC8-23 just reached the appropriate degree for enzyme production, and the polysaccharide extraction effect was better.
[0125] ③It can be seen from the comparative analysis of Comparative Examples 6-9 and Example 5 that the temperature or time of water extraction in Comparative Examples 6-9 is different from that in Example 5, and the polysaccharide extraction rate is reduced. This shows that when Trichoderma harzianum HC8-23 is applied to the polysaccharide extraction of Tricholoma matsutake, adding deionized water to the Tricholoma matsutake ferment and then incubating at 36-40 °C for 3-5 h for water extraction has a good effect on improving the polysaccharide extraction of Tricholoma matsutake. The reason may be that adding deionized water to the Tricholoma matsutake ferment and then incubating at 36-40 °C for 3-5 h for water extraction can just hydrolyze substances such as cellulose in the cell wall of Tricholoma matsutake without decomposing soluble polysaccharides, so the polysaccharide extraction effect is better.
[0126] Unless otherwise specified, the raw materials and equipment used in the present invention are all common raw materials and equipment in the art; unless otherwise specified, the methods used in the present invention are all conventional methods in the art.
[0127] The above are only the preferred embodiments of the present invention, and do not limit the present invention in any way. Any simple modifications, changes and equivalent transformations made to the above embodiments according to the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention.
Claims
1. A strain of Trichoderma harzianum ( Trichoderma harzianum ), HC8-23, characterized in that: It is preserved in the Guangdong Provincial Microbial Culture Collection Center, with the preservation number of GDMCC No: 63393, the preservation date of April 24, 2023, and the preservation address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province.
2. Application of Trichoderma harzianum HC8-23 as described in claim 1 in the extraction of matsutake polysaccharide.
3. The application according to claim 2, characterized in that: The method of the application includes the following steps: (1) Add the spore solution of Trichoderma harzianum HC8-23 to the matsutake powder, mix evenly and then ferment to obtain the matsutake ferment; (2) Add deionized water to the matsutake ferment, stir evenly and then carry out heat preservation treatment and ultrasonic treatment. After filtration and concentration, obtain the concentrated matsutake water extract; (3) Add ethanol to the concentrated matsutake water extract to obtain a precipitate. The precipitate is washed and dried to obtain matsutake polysaccharide.
4. The application according to claim 3, wherein: Based on the mass of the matsutake powder, in step (1), the addition amount of the Trichoderma harzianum HC8-23 spore liquid is 4-5 mL / g; the concentration of the Trichoderma harzianum HC8-23 spore liquid is 1×10 7 ~2×10 7 CFU / mL.
5. The application according to claim 3, wherein: In step (1), the temperature of the fermentation is 28-32 °C, and the time of the fermentation is 48-56 h.
6. The application according to claim 3, wherein: Calculated by the mass of the matsutake powder, in step (2), the addition amount of the deionized water is 20-30 mL / g.
7. The application according to claim 3, characterized in that: In step (2), the temperature of the heat preservation treatment is 36-40 °C, and the time of the heat preservation treatment is 3-5 h.
8. The application according to claim 3, wherein: In step (2), the temperature of the ultrasonic treatment is 86-94 °C, the power is 150-200 W, and the time is 40-60 min.
9. The application according to claim 3, wherein: In step (2), it is concentrated to 1 / 30-1 / 20 of the original volume, and the concentration method is vacuum concentration.
Citation Information
Patent Citations
Method for screening high-yield cellulase filamentous fungi through self-adaptive mutagenesis
CN112877323A
Strain of microscopic fungus trichoderma viride BOCG 63 / 300 as producer of cellulases and hemicellulases
RU2213138C2