Bnahl15 gene and application thereof in regulating early flowering of plants

Abstract

The present application relates to BnAHL15 gene and its application in regulating early flowering of plants, especially the application of BnAHL15 gene of rapeseed in regulating early flowering of plants, and belongs to the technical field of biology.The present application firstly designs sgRNA which is specific to BnAHL15 gene, makes oligo dimer of the sgRNA, and constructs a gene editing vector with a Cas9 skeleton, and then introduces the gene editing vector into hypocotyl callus of Brassica napus by means of agrobacterium-mediated genetic transformation technology, and generates seedlings again, under the guidance of sgRNA, Cas9 nuclease edits BnAHL15 gene on the genome, produces a frameshift mutation, causes early termination of gene coding, and phenotype identification finds that the flowering period of homozygous mutant lines of rapeseed is advanced, and the size (yield) of seeds does not change obviously.

Description

TECHNICAL FIELD

[0001] The application of BnAHL15 gene in regulating early flowering of plants, in particular, the application of BnAHL15 gene in regulating early flowering of plants, belongs to the field of biotechnology. BACKGROUND

[0002] Rape belongs to Brassica, which is one of the important oil crops with the largest planting area and the widest distribution in China. According to the data of the National Bureau of Statistics, the oilseed planting area in China in 2020 was 13129 thousand mu, of which peanut accounted for 4731 thousand mu, and rapeseed accounted for 6765 thousand mu, accounting for 51.52% of the total area; the oil yield reached 3586.4 million tons, the peanut yield was 1799.3 million tons, but the rapeseed yield was only 1404.9 million tons, accounting for 39.17% of the total yield of oil crops, and a large amount of rapeseed still needs to be imported from abroad every year. Therefore, it is of great significance to develop rape production.

[0003] Flowering is one of the key steps to start the life cycle of plants, and the time of flowering directly affects the reproduction of plants. An important goal of breeding is to shorten the growth cycle of crops without affecting crop yield and increase other crop rotations. Studies have shown that overexpression of rice flowering locus T1 (RFT1) can bypass normal vegetative development to promote early flowering in rice, and some people have coordinated early flowering and high yield in rapeseed through hybridization, but there is no related research on specific editing of BnaAHL15 gene to create early flowering rapeseed germplasm resources by CRIAPR / Cas9 technology. Creating early flowering germplasm resources and breeding early-maturing varieties can provide materials for rapid reproduction of Brassica napus. SUMMARY

[0004] In view of some deficiencies in the prior art, the application provides the application of rapeseed BnAHL15 gene in regulating early flowering of plants, in particular, the application of rapeseed BnAHL15 gene in promoting early flowering of rapeseed.

[0005] To achieve the above technical purpose, the technical scheme adopted by the application is as follows:

[0006] The application first provides a rapeseed BnAHL15 gene for regulating early flowering of plants, and the nucleotide sequence of the rapeseed BnAHL15 gene is shown in SEQ ID No: 1.

[0007] Further, the regulation includes promoting early flowering of plants; and the plants include Brassica napus.

[0008] The application also provides an sgRNA for targeting editing of the gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID No: 2 and SEQ ID No: 3.

[0009] The application further provides a recombinant expression vector comprising the Brassica napus BnAHL15 gene.

[0010] Further, the recombinant expression vector comprises the vector pKSE401.

[0011] The application further provides a recombinant engineering bacterium comprising the Brassica napus BnAHL15 gene or the recombinant expression vector.

[0012] Further, the host bacterium of the recombinant engineering bacterium is Agrobacterium GV3101.

[0013] The application further provides an application of the gene, the recombinant expression vector or the recombinant engineering bacterium in promoting early flowering of Brassica napus.

[0014] The application provides an application of the BnAHL15 gene in promoting early flowering of Brassica napus, wherein the nucleotide sequence of the BnAHL15 gene is shown in SEQ ID No: 1.

[0015] Further, the application is specific editing of the BnaAHL15 gene by using CRIAPR / Cas9 technology.

[0016] Further, the sgRNA for specific targeting and editing of the BnaAHL15 gene in the application has a nucleotide sequence shown in SEQ ID No: 2 or SEQ ID No: 3.

[0017] Further, the application achieves insertion or deletion of target base by specific editing of the BnAHL15 gene; the mutant sequence obtained after the insertion or deletion of the target base is shown in SEQ ID No: 15.

[0018] The application further provides a mutant of the BnAHL15 gene, and the mutant sequence is shown in SEQ ID No: 15.

[0019] The application further provides an application of the mutant in promoting early flowering of Brassica napus.

[0020] The application further provides a method for promoting early flowering of Brassica napus, and the specific steps are as follows:

[0021] Two sgRNAs specifically targeting BnAHL15 gene of Brassica napus were designed, which were constructed into a gene editing backbone containing Cas9 (i.e., pKSE401 plasmid), and then transformed into vectors to obtain regenerated seedlings by Agrobacterium-mediated genetic transformation technology. Under the guidance of the two sgRNAs, Cas9 nuclease edited the genomic sequence of BnAHL15, and the editing mutation was determined by sequencing the BnAHL15 gene sequence in the regenerated seedlings. The phenotype detection results show that the flowering period of the homozygous mutant line is about one week earlier than that of the wild type Brassica napus, and the seed size (yield) does not change.

[0022] Advantages of the present application:

[0023] The present application first clones a new flowering period related gene from Brassica napus, and the gene provided in the present application is edited in Brassica napus, and the flowering is earlier than that of the wild type. The BnAHL15 mutant system in the present application provides a valuable genetic resource for the cultivation of early flowering varieties, and has important significance for analyzing the molecular mechanism of early flowering of plants. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Two target sites of BnAHL15 gene.

[0025] Figure 2 Schematic diagram of gene editing vector CRISPR / Cas9.

[0026] Figure 3 Nucleotide sequence alignment results of the mutant obtained after gene editing and BnAHL15 reference gene.

[0027] Figure 4 Comparison of flowering period of wild type plants and mutant plants. CK is Brassica napus wild type, and BaAHL15-Cas9 is an independent Brassica napus mutant line. DETAILED DESCRIPTION

[0028] In order to make the skilled in the art better understand the technical scheme of the present application, the preferred embodiments of the present application are described in detail below, but the following embodiments do not limit the protection scope of the present application.

[0029] In the embodiments of the present application, those not described in detail are completed by using conventional experimental methods, and those not described in detail in the embodiments are understood and easily realized by those skilled in the art according to product instructions or basic knowledge in the art, so they are not described in detail.

[0030] Example 1: Design of target points of Brassica napus BnAHL15 gene CRISPR / Cas9 and construction of vector BnAHL15-Cas9

[0031] (1) Determination of target point

[0032] The nucleotide sequence of the cDNA of the BnAHL15 gene (Gene Accession No. LK033228 in the NCBI database) is shown as SEQ ID No: 1.

[0033] SEQ ID No: 1:

[0034] ATGGCGAATCCTTGGTGGGTAGGGAACGTTGCGATAGAAGGAGTGGAGAGTCCTGTGACGTCATCAGCTCCGTCTTTGCATCACAGAAGCAGCAATAACCCGAATATGACTCGGTCGGATCCAAGATTGGACCATGACTTCACCAACAACAGTGGAAGCCCTAACACTCATACTCAGAACAGCCAAGAGGAGCAGGACGAGTTACCCGCCGTCGAACATGGATCTGGATCCGGGTCTACGGGTCGACGTCCGCGGGGTAGACCTCCTGGTTCCAAGAACAAGCCCAAGAACCCAGTGGTTGTCGCCAAAGAAAGCCCCAACTCGCTGCAAAGCCATGTCCTCGAGATCGCCACGGGTGCTGACGTGGCGGAAAGCTTAAACGCGTTTGCTCGTAGACGCGGGAGAGGCGTTTCTGTTCTCAGCGGTAGCGGTTTGGTCACTAATGTCACTCTGCGTCAGCCTGCTGCATCTGGAGGAGTTGTGTCTCTTCGTGGTCAGTTTGAGATCTTGTCTATGTGCGGTGCTTTTCTTCCCACTTCTGGTTCTCCGGCTGCAGCTGCTGGTTTGACCATTTACTTAGCTGGAGCTCAGGGTCAAGTCTTGGGAGGTGGAGTCGCTGGACCGCTTATTGCATCTGGACCAGTTATTGTGATCGCTGCTACGTTTTGCAATGCTAGTTTCGAAAGGTTACCTATTGAAGATGAGCAACAACAACCACAAGTAGAAGAAGCGAAGGAGAAAGAGAATGATGATAACAAGAGTGGGAATGATGGAACTGAAGGGTCGATGCAGCCGATGTATAATATGACTCCTAACTTTGTACCAAATGGTCACCAAATGGCTCAACACGACGTGTTTTGGGGTGCTCCTCCGCCTCGTGCTCCTCCTTCATACTGA

[0035] PAM (proto adjacent motif) motif (NGG) is searched in the conservative region. Two target sequences sgRNA are designed in the application, the sequences of which are shown in SEQ ID No: 2 and SEQ ID No: 3, which can also be recorded as target sequence Target 1, Target 2, and the target site is shown in Figure 1 .

[0036] SEQ ID No: 2: GACTCGGTCGGATCCAAGAT

[0037] SEQ ID No: 3: TCATACTCAGAACAGCCAAG

[0038] Method for designing primers:

[0039] DT1-BsF: 5'-ATATATGGTCTCGATT+Target 1+GTT-3';

[0040] DT1-F0: 5'-T+Target 1+GTTTTAGAGCTAGAAATAGC-3';

[0041] DT2-R0: 5'-AAC+Target 2 reverse complementary sequence+AATCTCTTAGTCGACTCTAC-3';

[0042] DT2-BsR: 5'-ATTATTGGTCTCGAAAC+Target 2 reverse complementary sequence+AA-3'.

[0043] The four primers of the application amplify the same sequence, and the purpose is to simultaneously connect the two target sequence (Target 1, Target 2) on the pCBC-DT1T2 vector (publicly known and provided by Professor Guoliang of Huazhong Agricultural University), and the amplification object is the sequence between Target 1 and Target 2, and the nucleotide sequences of the primers (DT1-BsF, DT1-F0, DT2-R0 and DT2-BsR) are shown in SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6 and SEQ ID No: 7, respectively, which are synthesized by Shanghai Sangon Biological Engineering Co., Ltd.

[0044] DT1-BsF (SEQ ID No: 4):

[0045] ATATATGGTCTCGATTGACTCGGTCGGATCCAAGATGTT

[0046] DT1-F0 (SEQ ID No: 5): TGACTCGGTCGGATCCAAGATGTTTTAGAGCTAGAAATAGC

[0047] DT2-R0 (SEQ ID No: 6):

[0048] AACCTTGGCTGTTCTGAGTATGCAATCTCTTAGTCGACTCTAC

[0049] DT2-BsR (SEQ ID No: 7): ATTATTGGTCTCGAAACCTTGGCTGTTCTGAGTATGCAA

[0050] (2) Target and pCBC-DT1T2 vector connection

[0051] The four-primer PCR amplification was performed with 80 ng / μL pCBC-DT1T2 (publicly known and available material, provided by Professor Guoliang of Huazhong Agricultural University) as a template, and the two target sequences were connected upstream of sgRNA. The specific position relationship is shown in Figure 2 The primer concentration of DT1-BsF / DT2-BsR was 10 μm / μL, and the primer concentration of DT1-F0 / DT2-R0 was 0.5 μm / μL. The reaction system was as follows:

[0052] Table 1. Reaction system for connecting target and pCBC-DT1T2 vector

[0053] Reagents Amount (μL) pCBC-DT1T2 plasmid 1 DT1-BsF (10 μM) 1.5 DT1-F0 (0.5 μM) 1.5 DT1-R0 (0.5 μM) 1.5 DT1-BsR (10 μM) 1.5 10 x PCR Buffer for KOD plus 5 KOD plus 1 MgSO4(25 mM) 3 dNTPs (2 mM) 5 ddH2O 7

[0054] The PCR reaction program was as follows:

[0055] Table 2. Reaction program for connecting target and pCBC-DT1T2 vector

[0056]

[0057] The agarose gel electrophoresis was used for verification, and the band size should be about 626 bp. The fragments with correct size were recovered by cutting the gel.

[0058] (3) Target site connected to CRISPR terminal vector pKSE401

[0059] Next, the gel recovery product of step (2) was connected with pKSE401 vector, and the connection was performed according to the following system:

[0060] Table 3. Reaction system for connecting target site to CRISPR terminal vector pKSE401

[0061] Reagents Amount (μL) pKSE401 plasmid 2 Target fragment 2 10 x BSA 1.5 Bas I (NEB) 1 Solution I 5 ddH2O To 15

[0062] The following program was set on the PCR instrument for the reaction:

[0063] Table 4. Reaction program for connecting target sites to CRISPR final vector pKSE401

[0064] Reaction program Hold Hold Hold Temperature (°C) 37 50 80 Time 5h 5 min 10 min

[0065] After the reaction, the product (BnAHL15-Cas9) was transformed into E. coli competent cells DH5a, screened with solid LB medium containing 30 mg / mL Kan antibiotic, and PCR identified. The identification primer was:

[0066] U626-IDF (SEQ ID No: 8): TGTCCCAGGATTAGAATGATTAGGC;

[0067] U629-IDR (SEQ ID No: 9): AGCCCTCTTCTTTCGATCCATCAAC.

[0068] The bacteria liquid identified as positive was sent to Shanghai Shenguo for sequencing. The primer used for sequencing was:

[0069] U626-IDF (SEQ ID No: 8): TGTCCCAGGATTAGAATGATTAGGC

[0070] U629-IDF (SEQ ID No: 10): TTAATCCAAACTACTGCAGCCTGAC.

[0071] Example 2: BnAHL15-Cas9 vector transformation of Agrobacterium GV3101

[0072] 1 μL of BnAHL15-Cas9 obtained in Example 1 was added to 33 μL of GV3101 Agrobacterium competent cells, mixed, and then ice bathed for 5 minutes, frozen in liquid nitrogen for 5 minutes, and then 37°C water bathed for 5 minutes. 700 μL of liquid LB medium was added, and the mixture was recovered at 28°C for 2 hours at 200 rpm. Centrifugation was performed at 6000 rpm for 1 min, the supernatant was discarded, and 100 μL of bacteria liquid was spread on LB solid culture dish containing 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampicin; 28°C culture for 36h, single colonies were picked and inoculated in LB liquid medium containing 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampicin, and cultured at 28°C at 200 rpm overnight, and then PCR identification was performed with the primer on the vector. Then the Agrobacterium bacteria liquid was mixed with 50% glycerol and stored in a -80°C ultra-low temperature refrigerator.

[0073] Example 3: Transformation of Brassica napus hypocotyl with Agrobacterium tumefaciens BnAHL15-Cas9

[0074] (1) Sowing

[0075] Soak rapeseed seeds (Y127 rapeseed seeds provided by Professor Hong Dengfeng of Huazhong Agricultural University) in an appropriate amount of 75% alcohol for 1 minute. Discard the alcohol and rinse thoroughly with sterile water 5-6 times. Discard the water and disinfect again with 15% bleach solution for 4-6 minutes. After disinfection, pour the disinfectant solution into a waste container. Then wash the seeds 5 times with an appropriate amount of sterile water. Use sterile forceps to sow the treated seeds onto M0 medium, sowing 20-25 seeds per dish. Place the dishes in a sterile culture box and incubate in the dark at 24℃ for 5-6 days.

[0076] (2) Activation and preparation of Agrobacterium

[0077] One day before inoculation, kanamycin (30 μg / mL), rifampin (50 μg / mL), and gentamicin (50 μg / mL) were added to 100 mL of sterilized liquid LB medium, respectively. Agrobacterium was then inoculated and cultured overnight at 28°C and 200 rpm with shaking. The OD value of the bacteria was measured (around 0.4-0.6 is preferred in LB medium, generally 16 hours is sufficient).

[0078] Divide the cultured bacterial suspension into two 2mL sterile centrifuge tubes and centrifuge at 5000rpm for 10min. Remove the supernatant from the centrifuge tubes and gently wash the cells with 2mL of DM (with added AS), then discard the supernatant. Add 2mL of DM and mix thoroughly by pipetting. This is the inoculation solution. Activate the inoculation solution on ice after preparation.

[0079] Simultaneously, use sterile forceps and a scalpel to vertically cut the hypocotyls of the seedlings cultured in the dark. Cut them in DM liquid. The optimal length of the explant (i.e., the cut explant) is 0.8-1.0 cm. Place the cut explants into a dish containing the target bacterial solution of a prepared concentration and immerse for 12-15 minutes. The number of explants in each dish should be about 150. Shake the dish 4-5 times at intervals.

[0080] After inoculation, the explants were gently removed with sterile forceps, and sterile filter paper was placed to remove excess bacterial solution from the surface. Then, the explants were placed on M1 medium with sterile forceps and cultured at 24°C in the dark for 48 hours.

[0081] (3) Selection of culture

[0082] After co-culture, the explants were transferred to M2 medium for selective culture for 15 days at 24°C, with 16 hours of daytime and 8 hours of nighttime culture.

[0083] (4) Differentiation culture

[0084] The explants after selection culture were transferred to M3 medium for differentiation culture, subcultured every 15 days or so until sprouting. The culture conditions were 24°C, 16 hours of day / 8 hours of night.

[0085] (5) Rooting culture and transplanting

[0086] After differentiation sprouting to see obvious growth points, the sprouts were carefully cut from the callus with sterile forceps and dissecting knife, avoiding to take extra callus and to hurt the growth points, and then transferred to M4 medium for rooting. The vitrified sprouts need to be cultured for a period of time before turning to normal and then rooting to obtain transformed seedlings.

[0087] (6) Preparation method of transformation medium

[0088] Sowing medium M0: 1L medium added with MS medium 4.42g, sucrose 30g, agar 8g, pH adjusted to 5.84-5.88.

[0089] Bacterial liquid activation medium DM: 1L medium added with MS 4.42g, sucrose 30g, pH adjusted to 5.84-5.88, after sterilization added with AS 1mL (100mmol / mL).

[0090] Co-culture medium M1: 1L medium added with MS 4.42g, sucrose 30g, mannitol 15g, 2,4-D 2mL (0.5mg / mL), KT 0.3mL (1mg / mL), AS 1mL (100mmol / mL) pH adjusted to 5.84-5.88.

[0091] Selection medium M2: 1L medium added with ms 4.42g, sucrose 30g, mannitol 15g, 2,4-D 1mL (1mg / mL), KT 0.3mL (1mg / mL), pH adjusted to 5.84-5.88, after sterilization added with STS 1.5mL (0.1mm / l), timentin 1mL (300mg / mL), 800μL kanamycin (30mg / mL).

[0092] Differentiation medium M3: 1 L medium with MS 4.42 g, glucose 10 g, xylose 0.25 g, MES 0.6 g, pH adjusted to 5.84-5.88, after sterilization, add ZT (0.5 mg / mL) 4 mL, iaa 200 μL (0.5 mg / mL), timentin 1 mL (300 mg / mL), 500 μL kanamycin (50 mg / mL).

[0093] Rooting medium M4: 1 L medium with MS 4.42 g, sucrose 10 g, agar 8 g, after sterilization, add timentin 500 μL (300 mg / mL).

[0094] Liquid LB medium: 1 L medium with sodium chloride 10 g, peptone 10 g, yeast 5 g.

[0095] Solid LB medium: 1 L medium with sodium chloride 10 g, peptone 10 g, yeast 5 g, agar 8 g.

[0096] Example 4: Transgenic plant mutation detection

[0097] (1) Transgenic plant screening and detection

[0098] The leaf of BnAHL15-Cas9 transformed seedling was taken, and the plant DNA was extracted by CTAB method, and U626-IDF (SEQ ID No: 8), U629-IDR (SEQ ID No: 9)

[0099] and Cas9-F (SEQ ID No: 11): TGCAGGAGATTTTCTCCAACGA;

[0100] Cas9-R (SEQ ID No: 12): AGCCTTCGTAATCTCGGTGTTCA.

[0101] Both pairs of primers were identified, and those that could amplify the target band were transgenic positive plants.

[0102] The reaction system was as follows:

[0103]

[0104]

[0105] The reaction procedure was as follows:

[0106]

[0107] (2) Editing of transgenic positive plants

[0108] The plant DNA obtained in step (1) was amplified with BnAHL15-F (SEQ ID No: 13): CACCATGGCGAATCCTTGGTGGGTAGGGAAC;

[0109] BnAHL15-R (SEQ ID No: 14): GTATGAAGGAGGAGCACGAGGCGGAGGAG.

[0110] The primers were used for amplification (reaction system and procedure as follows), and the product (i.e. BnAHLL5 gene fragment) was about 900 bp. The product was connected with pMD19-T vector and transformed into E. coli, and was sent to Shanghai Shengong for sequencing and alignment with the BnAHL15 reference sequence gene. The sequencing results showed that in the BnAHL15-Cas9 positive transformation plant, there was a base insertion at the 124th position of the first target site of BnAHL15, and a 4-base deletion at the 180-183th position of the second target site, which caused premature termination of the gene coding, and the edited sequence is shown as SEQ ID No. 15. This editing condition has the highest proportion. There was also a case of deleting one base at the first target site, and a case of deleting 2 and 3 bases at the second target site, and a case of deleting 99 base sequences between the first and second target sites. The nucleotide sequence of the site is shown as SEQ ID No. 15. Figure 3

[0111] SEQ ID NO: 15:

[0112] ATGGCGAATCCTTGGTGGGTAGGGAACGTTGCGATAGGAGTGGAGAGTCCTGTGACGTC

[0113] ATCAGCTCCGTCTTTGCATCACAGAAGCAGCAATAACCCGAATATGACTCGGTCGGATCC

[0114] AAAGATTGGACCATGACTTCACCAACAACAGTGGAAGCCCTAACACTCATACTCAGAAC

[0115] AAGAGGAGCAGGACGAGTTACCCGCCGTCGAACATGGATCTGGATCCGGGTCTACGGG

[0116] TCGACGTCCGCGGGGTAGACCTCCTGGTTCCAAGAACAAGCCCAAGAACCCAGTGGTT

[0117] ​GTCACCAAAGAAAGCCCCAACTCGCTGCAAAGCCATGTCCTCGAGATCGCCACTGGTG

[0118] CTGACGTGGCGGAAAGCTTAAACGCGTTTGCTCGTAGACGAGGGAGAGGCGTTTCTGT

[0119] TCTGAGCGGTAGCGGTTTGGTCACTAATGTCACTCTGCGTCAGCCTGCTGCATCTGGAG

[0120] GAGTTGTGTCTCTTCGTGGTCAGTTTGAGATCTTGTCTATGTGCGGTGCTTTTCTTCCCAC

[0121] TTCTGGTTCTCCGGCTGCAGCTGCTGGTTTAACCATTTACTTAGCTGGAGCTCAGGGTCA

[0122] AGTCTTGGGAGGTGGAGTCGCTGGACCGCTTATTGCATCTGGACCGGTTATTGTAATCGC

[0123] TGCTACGTTTTGCAATGCTAGTTTCGAAAGGTTACCTATTGAAGATGAGCAACAACAACCACAAGTAGAAGAAGCGAAGGAGAAAGAGAATGATGATAACAAGAGTGGGAATGATGGAACTGAAGGGTCGATGCAGCCGATGTATAATATGACTCCTAACTTTATGCCAAATGGTCACCAAATGGCTCAACACGACGTGTTTTGGGGTGCTCCTCCGCCTCGTGCTCCTCCTTCATAC

[0124] The reaction system is as follows:

[0125] Reaction system Amount (μL) Rape genome 1 KOD plus 1 10 x PCR Buffer for KOD plus 5 BnAHL15-F 1.5 BnAHL15-R 1.5 MgSO4 3 dNTPs 5 ddH2O To 50

[0126] The reaction procedure is as follows:

[0127]

[0128] Example 5: Phenotype observation of transgenic t1 generation plants

[0129] BnAHL15-Cas9 has a single base insertion at the first target site and a base deletion at the second target site. The t0 generation seeds are collected and planted to grow the t1 generation. PCR detection and sequencing are performed using BnAHL15-F and BnAHL15-R primers (the reaction system and reaction procedure are the same as those described in part (2) of Example 4). The results show that the BnAHL15 is edited, which is consistent with the t0 generation mutation. Five t1 generation Brassica napus mutant plants and five wild type plants are selected and planted in the medium (vermiculite: nutrient soil is mixed at a volume ratio of 2:1), and cultured for two months at 22°C in an environment of 16h light / 8h dark alternation.

[0130] When the mutant Brassica napus flowers under the same growth conditions, the wild type Brassica napus has not yet bolted. The statistical results show that 60% of the BnAHL15 mutant system has a flowering time that is significantly earlier (about one week earlier) than the wild type. After growing for 60 days, the BnAHL15 mutant system has already flowered, while the wild type has no signs of flowering. Figure 4 ).

[0131] According to the above data, it can be seen that, relative to its receptor parent, BnAHL15-Cas9 can cause the flowering time of Brassica napus to be advanced, which provides excellent germplasm resources and theoretical and technical support for the improvement of early-maturing Brassica napus varieties.

Claims

1. Application of the BnAHL15 gene in promoting early flowering of rapeseed; the nucleotide sequence of the BnAHL15 gene is shown in SEQ ID No: 1; the application is to promote early flowering of rapeseed through gene knockout technology.

2. A method for promoting early flowering of rapeseed, characterized in that, The method includes: specifically editing the BnaAHL15 gene using CRIAPR / Cas9 technology; The method includes: Design sgRNA to target and edit the BnAHL15 gene, construct it into a gene editing backbone containing Cas9, then transform it into a vector, and obtain regenerated seedlings through Agrobacterium-mediated genetic transformation technology; The nucleotide sequences of the sgRNA that specifically targets and edits the BnaAHL15 gene are shown in SEQ ID No: 2 and SEQ ID No: 3; The edited BnaAHL15 gene was subjected to a frameshift mutation to obtain a mutant BnaAHL15 gene, the nucleotide sequence of which is shown in SEQ ID No: 15.

Images