A snx6 gene non-expressing xenograft donor and a method of making

Abstract

The present application provides a kind of SNX6 gene non-expression xenotransplant donor pig and its preparation method, SNX6 gene can cause xenogeneic immune rejection risk, also knockout SNX6 gene using CRISPR / Cas9 system, it is verified that SNX6 gene non-expression can effectively reduce the binding capacity of the organ, tissue and / or cell of donor pig with recipient IgG and IgM, improve the ability of the organ, tissue and / or cell of donor pig to resist recipient complement-mediated cytotoxicity, can prolong the survival time of the organ, tissue and / or pig cell of donor pig recipient.

Description

Technical Field

[0001] This application belongs to the field of animal genetic engineering, specifically relating to a xenotransplantation donor that does not express the SNX6 gene and its preparation method. Background Technology

[0002] Xenotransplantation of organs, tissues, and cells from different species can effectively address the shortage of human donors. The advantages of xenotransplantation over autotransplantation and allogeneic transplantation include predictable, non-emergency supply, production in controlled environments, and pre-transplantation characterization and research. Pigs have become the focus of most research in xenotransplantation as donor animal models, as evidenced by numerous studies, because they share many anatomical and physiological characteristics with humans. Pigs also have relatively short gestation periods, can be bred in pathogen-free environments, and may not present the same ethical issues associated with animals not typically used as food sources. However, current research indicates that transplanting pig organs into humans results in significantly more severe immune rejection than autotransplantation or allogeneic transplantation due to numerous unknown risk factors that affect the long-term survival of pig tissues or organs after implantation, including xenologous genes that trigger rejection.

[0003] Current research on the SNX6 gene is as follows: The SNX6 (sorting nexin 6) gene encodes a member of the sorting nexin family, which contains a phox (PX) domain, a phosphoinositol-binding domain involved in intracellular transport. It is associated with the long isoform of the leptin receptor, the transforming growth factor-β family of serine-threonine kinases, and the receptor tyrosine kinases of platelet-derived growth factor, insulin, and epidermal growth factor. SNX6 participates in several stages of intracellular transport. It may interact with membrane phosphatidylinositol 3,4-bisphosphate or phosphatidylinositol 4,5-bisphosphate, and is partly a component of the reverse transcriptase membrane-deformed SNX-BAR subcomplex. SNX-BAR reverse transcriptase mediates the retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and participates in membrane transport from endosomes to plasma for cargo protein recovery. Summary of the Invention

[0004] This invention has discovered that the SNX6 gene can induce xenogeneic immune rejection. The absence of SNX6 gene expression can effectively reduce the binding capacity of donor tissues and / or organ cells to recipient IgG and IgM, enhance the ability of donor tissues and / or organ cells to resist recipient complement-mediated cytotoxicity, and prolong the survival time of donor tissues and / or organs after xenotransplantation. According to the above, this invention provides a xenotransplantation donor pig, wherein the SNX6 gene is not expressed in the donor pig's organs, tissues, or cells, and the recipient is a human.

[0005] The non-expression of the SNX6 gene described in this invention can be achieved through gene knockout, gene knock-in, point mutation, deletion mutation, and combinations thereof.

[0006] The non-expression of the SNX6 gene described in this invention can be achieved through gene silencing.

[0007] The gene knockout described in this invention is achieved through a CRISPR-Cas9 gene knockout system, which includes an SNX6 gene knockout vector, comprising vector one and vector two. Vector one is linked to sgRNA1, and the specific target sequence of sgRNA1 is GTCGAAGATCTAGGTCACTA. Vector two is linked to sgRNA2, and the specific target sequence of sgRNA2 is CAAGAAGAGTTGC TGCATTC.

[0008] The method for constructing the SNX6 gene knockout vector described in this invention:

[0009] The nucleotide sequence encoding the sgRNA1 gene is shown in SEQ ID NO.1, and its complementary strand is shown in SEQ ID NO.2. The DNA sequence of the single-stranded sgRNA is then annealed to form an sgRNA1 oligonucleotide chain. The oligonucleotide is then ligated into the PX330 plasmid vector.

[0010] The nucleotide sequence encoding the sgRNA2 gene is shown in SEQ ID NO.3, and its complementary strand is shown in SEQ ID NO.4. The DNA sequence of the single-stranded sgRNA is then annealed to form an sgRNA2 oligonucleotide chain. The oligonucleotide is then ligated into the PX330 plasmid vector.

[0011] The SNX6 gene knockout vector of the present invention is introduced into transformed cells, which are used to prepare donor pigs for xenotransplantation, wherein the SNX6 gene is not expressed in the organs, tissues or cells of the donor pigs.

[0012] The present invention also provides a method for preparing xenotransplantation donors, comprising transplanting the transformed cells into enucleated oocytes to form nuclear transfer oocytes, and then transplanting the nuclear transfer oocytes into the fallopian tubes of surrogate mothers.

[0013] The present invention also provides a method for delaying, reducing or preventing rejection, separation or adverse reactions to xenotransplanted organs or tissues in human recipients. The method includes genetically modifying the SNX6 gene of donor pig tissues or organs so that the SNX6 gene of the donor pig or its tissues or organs is not expressed.

[0014] The organs of the xenotransplant donors described in this invention include liver, lung, kidney, or skin.

[0015] The tissues of the xenotransplant donor described in this invention include nerves.

[0016] The beneficial effects are as follows:

[0017] This invention is the first to discover that the SNX6 gene can cause the risk of xenogeneic immune rejection. Based on this, a xenotransplantation donor is provided, in which the SNX6 gene is not expressed by gene knockout or gene silencing. The non-expression of the SNX6 gene can effectively reduce the binding ability of donor tissue and / or organ cells to human recipient IgG and IgM, improve the ability of donor tissue and / or organ cells to resist complement-mediated cytotoxicity of human recipient, and prolong the survival time of donor tissue and / or organ after xenotransplantation.

[0018] This invention utilizes the CRISPR / Cas9 system to design a double sgRNA knockout of the SNX6 gene. The resulting gene knockout cell line can be used as a donor for somatic cell nuclear transfer. SNX6 knockout can effectively reduce the binding ability of porcine kidney cells to human IgG and IgM, improve the ability of porcine kidney cells to resist human complement-mediated cytotoxicity, and provide a useful research tool for in-depth exploration of the biological function of the SNX6 gene.

[0019] The knockout of the SNX6 gene, a risk factor identified in this invention, increases the chances of xenogeneic cell survival and further improves the feasibility of xenotransplantation. Attached Figure Description

[0020] Figure 1 Identification diagram of positive clones with SNX6 gene knockout;

[0021] Figure 2 Figure showing cell survival of wild-type pig kidney cells and SNX6 knockout pig kidney cells after incubation with human serum;

[0022] Figure 3 The graph shows the binding ability of wild-type pig kidney cells and SNX6 knockout pig kidney cells to human IgG and IgM. Detailed Implementation

[0023] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention.

[0024] Example 1: Construction of SNX6 gene knockout vector.

[0025] The SNX6 gene knockout in porcine kidney cells was achieved using a CRISPR / Cas9 system, employing sgRNAs including sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0026] Two sgRNA sequences targeting the porcine SNX6 gene (NCBI accession number: 100154775): sgRNA-F1 sequence: 5-CACCGTCGAAGATCTAGGTCACTA-3; SEQ ID NO: 1; sgRNA-R1 sequence: 5-AAACTAGTGACCTAGATCTTCGAC-3; SEQ ID NO: 2; sgRNA-F2 sequence: 5-CACCCAAGAAGAGTTGCTGCATTC-3; SEQ ID NO: 3; sgRNA-R2 sequence: 5-AAACGAATGCAGCAACTCTTCTTG-3. SEQ ID NO: 4

[0027] The designed sgRNA sequence was synthesized as follows: the DNA sequences of the four single-stranded sgRNAs were annealed to form two oligonucleotide chains of sgRNAs targeting different sites of the porcine SNX6 gene; then the oligonucleotides were ligated into the PX330 plasmid vector to obtain the SNX6 gene knockout vector.

[0028] Example 2: Preparation of SNX6 gene knockout porcine kidney cells.

[0029] After sequencing verification of the constructed sgRNA expression vector, the target plasmid was extracted and precipitated with ethanol to purify the sgRNA expression vector to a certain concentration. This purified sgRNA expression vector was then introduced into porcine kidney cells via electroporation. After 12 hours of culture, the medium was changed. After 72 hours, the genome of each cell group was extracted. Cell clones were obtained using the limiting dilution method. PCR was then performed using specific primers. The sgRNA cleavage status of the cells was assessed by analyzing the sequencing peaks, obtaining positive and knockout clones. (See [link to documentation]). Figure 1 .

[0030] Example 3: Detection of the resistance of SNX6 knockout porcine kidney cells to human complement-mediated cytotoxicity.

[0031] When the confluence of wild-type and SNX6 knockout porcine kidney cells reached approximately 70% density, human serum was diluted 1:3 with DMEM and incubated for 45 minutes. The supernatant was discarded, and the cells were washed twice with PBS and stained with propidium iodide (PI) staining solution for 10 minutes. Subsequently, cell death was detected by flow cytometry (see [link to relevant documentation]). Figure 2 It can be seen that, compared with PK cells, SNX6 gene knockout cells, after incubation with 75% serum, can significantly reduce the toxicity of human serum to porcine cells.

[0032] Example 4: Detection of the binding ability of SNX6 knockout porcine kidney cells to human IgG and IgM.

[0033] Wild-type and SNX6 knockout porcine kidney cells were digested with trypsin into 1.5 mL centrifuge tubes and washed twice with PBS. Human serum inactivated at 56°C for 1 hour was diluted 1:4 with PBS and incubated at room temperature. After 30 minutes, the cells were washed twice with PBS, and a 1:200 dilution of fluorescently labeled human IgG or IgM antibody was added to the cells. The cells were incubated at room temperature for 30 minutes. After washing with PBS, the binding capacity of SNX6 knockout porcine kidney cells to human IgG and IgM was detected by flow cytometry (see [reference to previous text]). Figure 3 It can be seen that, compared with PK cells, the binding of SNX6 gene knockout porcine kidney cells to human IgG or IgM is significantly reduced.

[0034] As can be seen from the above examples, knocking out the SNX6 gene can effectively reduce the binding ability of porcine kidney cells to human IgG and IgM, and improve the ability of porcine kidney cells to resist human complement-mediated cytotoxicity.

[0035] The present invention also verified the resistance of SNX6 gene knockout porcine lung cells and porcine liver cells to human complement-mediated cytotoxicity and their binding ability to human IgG and IgM through examples, obtaining the same conclusions as the porcine kidney cell experiment.

[0036] The present invention also verified, through examples, the resistance of porcine kidney cells with silenced SNX6 gene to human complement-mediated cytotoxicity and their binding ability to human IgG and IgM, obtaining the same experimental conclusions as the gene knockout method.

[0037] The present invention also obtains transgenic pigs through a method for preparing transgenic pigs for xenotransplantation. SNX6 gene knockout pig kidney, lung or liver cells are transplanted into enucleated oocytes to form nuclear transfer oocytes, and the obtained nuclear transfer oocytes are transplanted into the oviducts of surrogate pigs. Transgenic piglets for xenotransplantation are born from pregnant sows, and the piglets are used as donor animals for interspecies organ and cell transplantation.

[0038] Therefore, the transgenic cloned pig of this invention can be used as a donor animal for interspecies organ and cell transplantation.

[0039] The vector of the present invention may contain primer sequences, for example, it may contain a CAG promoter. Furthermore, it may utilize promoters that are typically considered equivalent to the CAG promoter, such as the EF1α promoter, which are capable of expression in mammals. Additionally, it may use mammalian tissue-specific promoters such as the ICAM2 promoter, with the CAG promoter as one type of gene expression promoter, for expressing foreign genes.

[0040] In this invention, "transgenic" refers to the process of introducing DNA into a host and enabling the DNA to replicate as an extrachromosomal factor or through chromosomal integration. Transgenic includes any method of introducing nucleic acid molecules into an organism, cell, tissue, or organ, and can be carried out using appropriate standard techniques known in the relevant field, depending on the host cell, such as electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol, DEAE-dextran, cationic liposomes, and lithium acetate-dimethyl sulfoxide, but is not limited to these. To distinguish between transformation of eukaryotic cells using plasmid or non-plasmid naked DNA and transformation as a form of cell tumorigenesis, the term "transfection" is also used, and both have the same meaning in this invention.

[0041] The present invention provides a method for preparing transgenic pigs for xenotransplantation and transgenic cloned pigs for xenotransplantation produced by the above method, including the steps of transplanting the above-mentioned transformed cells into enucleated oocytes to form nuclear transfer oocytes; and the steps of transplanting the above-mentioned nuclear transfer oocytes into the fallopian tubes of surrogate mothers.

[0042] In this invention, "nuclear transplantation" refers to a gene manipulation technique that artificially combines the nuclear DNA of other cells with a cell without a nucleus to form the same traits, and can use methods known in the technical field to which this invention pertains.

[0043] In this invention, "nuclear transplanted egg" refers to an egg cell that has been introduced or fused with donor cells.

[0044] In this invention, "enucleated oocyte" refers to an oocyte whose nucleus has been removed.

[0045] In this invention, the term "organ" refers to a collection of tissues connected by structural units to perform a common function. An organ can be a solid organ. A solid organ is an internal organ with fixed tissue consistency, neither hollow (e.g., gastrointestinal organs) nor liquid (e.g., blood). Examples of solid organs include the heart, kidneys, liver, lungs, pancreas, spleen, and adrenal glands.

[0046] In this invention, the term "tissue" refers to a cellular-organic intermediate between cells and organs. A tissue is a population of similar cells originating from the same source and performing a specific function. Organs are then formed through the functional aggregation of multiple tissues. Examples of tissues considered in this invention include, but are not limited to, connective tissue, muscle tissue, nervous tissue, epithelial tissue, and mineralized tissue. Blood, bone, tendons, ligaments, fat, and cellular tissue are examples of connective tissue, which can be further classified as fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is divided into three distinct categories: visceral or smooth muscle, present on the inner walls of organs; skeletal muscle, typically attached to bones, producing large-amplitude movements; and cardiac muscle, present in the heart, which contracts to pump blood through the body. Cells containing central and peripheral nerve cells are classified as neural (or neuronal) tissue. In the central nervous system, neural tissue forms the brain and spinal cord. In the peripheral nervous system, neural tissue forms cranial and spinal nerves, including motor neurons.

[0047] In this invention, the terms "transformation" and "transfection" refer to the process of transferring or introducing exogenous nucleic acids into host cells. "Transformed" cells are cells that have been transfected, transformed, or transduced using exogenous nucleic acids. These cells include primary cells of the subject and their progeny.

[0048] The present invention will now be described in detail through embodiments. These embodiments are merely illustrative and the invention is not limited thereto.

Claims

1. A method for producing a transgenic donor pig for xenotransplantation, characterized by: comprising transplanting the transformed cells to enucleated oocytes to form nuclear transfer eggs, and transplanting the nuclear transfer eggs to oviducts of surrogate sows; The transformed cell has introduced into it SNX6 a gene knockout vector, the transformed cell being used to make a donor pig for xenotransplantation, the donor pig having SNX6 a gene not expressed; The described SNX6 Gene non-expression is achieved by gene knockout, gene knock-in, point mutation, deletion mutation, and combinations thereof, or by gene silencing; The SNX6 The gene knockout vector comprises a carrier one and a carrier two: the carrier one is connected with sgRNA1, and the specific targeting sequence is GTCGAAGATCTAGGTCACTA; the carrier two is connected with sgRNA2, and the specific targeting sequence is CAAGAAGAGTTGCTGCATTC; The recipient of the organ, tissue or cell of the donor pig for xenotransplantation is a human.

2. The method of claim 1, wherein: The organ includes liver, lung, kidney or skin.

3. The method of claim 1, wherein: The tissue includes nerve.

Images