Application of DNAJC9 in preparing drugs for treating heart failure, recombinant vector and drugs for treating heart failure

Abstract

The present invention discloses the application of DNAJC9 in the preparation of drugs for treating heart failure, recombinant vectors and drugs for treating heart failure, and belongs to the field of biomedicine technology. The present invention provides the application of DNAJC9 protein in the preparation of drugs for treating heart failure, using the coding gene containing the DNAJC9 protein as a recombinant vector, and when the circular vector of the recombinant vector is an AAV overexpression vector, it also includes adeno-associated virus packaging. The present invention proves that the drugs for treating heart failure prepared by DNAJC9 can treat or improve heart failure, especially have a good therapeutic effect on heart failure caused by ischemia-reperfusion injury; specifically, DNAJC9 has the effect of improving cardiac contractile dysfunction caused by myocardial ischemia-reperfusion injury for 3 weeks; overexpression of DNAJC9 can inhibit myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of DNAJC9 in preparing a drug for treating heart failure, a recombinant vector, and a drug for treating heart failure. Background Art

[0002] Cardiovascular disease is a global epidemic characterized by high rates of disability and mortality. Heart failure is the terminal stage of various cardiovascular diseases. Patients with heart failure require frequent hospitalization for intensive treatment, which increases the economic pressure on families and society. Acute myocardial infarction is one of the main causes of disability and mortality, and reperfusion therapy is a conventional treatment. However, reperfusion therapy is often accompanied by a series of pathophysiological reactions and increases the risk of heart failure in patients. However, there is currently a lack of effective treatments for heart failure in clinical practice. Therefore, it is of great significance to find new strategies for the prevention and treatment of heart failure.

[0003] Molecular chaperone proteins are a class of proteins responsible for protein folding, transport, maturation, and assembly. Their abnormal expression or altered post-transcriptional modifications are closely associated with the development and progression of diseases such as tumors, neurodegenerative diseases, and cardiovascular diseases. The DNAJC9 protein is a recently identified, highly evolutionarily conserved bimolecular chaperone that functions as both an H3-H4 histone chaperone and an HSP70 chaperone. In recent years, biopharmaceuticals have flourished. Compared with traditional small-molecule chemical drugs, biopharmaceuticals offer advantages such as greater efficacy, enhanced specificity, lower toxicity, fewer side effects, and more defined biological functions, demonstrating promising application prospects in disease treatment and vaccine development. Therefore, the discovery of a biological product with therapeutic effects on widespread ischemia-reperfusion injury is of great significance for the widespread treatment of heart failure caused by ischemia-reperfusion injury. Summary of the Invention

[0004] The purpose of the present invention is to provide the use of DNAJC9 in the preparation of a drug for treating heart failure, a recombinant vector and a drug for treating heart failure. The drug for treating heart failure prepared using DNAJC9 can treat or improve heart failure, especially has a good therapeutic effect on heart failure caused by ischemia-reperfusion injury.

[0005] The present invention provides use of DNAJC9 protein in preparing a drug for treating heart failure.

[0006] The present invention provides use of a recombinant vector comprising a gene encoding a DNAJC9 protein in the preparation of a drug for treating heart failure.

[0007] The present invention provides use of a reagent for overexpressing DNAJC9 protein in preparing a drug for treating heart failure.

[0008] Preferably, the heart failure includes acute heart failure or chronic heart failure.

[0009] Preferably, the therapeutic effects of the drug include at least one of the following: (1) improving cardiac systolic dysfunction and cardiac fibrosis caused by myocardial ischemia-reperfusion injury;

[0010] (2) Inhibit myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery.

[0011] The present invention provides a recombinant vector comprising a gene encoding a DNAJC9 protein, wherein the circular vector of the recombinant vector comprises an AAV overexpression vector.

[0012] Preferably, a myocardium-specific promoter is used to drive the expression of the encoding gene.

[0013] The present invention provides a medicine for treating heart failure, the active ingredient of which includes the above-mentioned recombinant vector.

[0014] The present invention also provides a method for preparing the above-mentioned medicine, which comprises packaging the above-mentioned recombinant vector with adeno-associated virus.

[0015] Preferably, the adeno-associated virus comprises AAV9 virus.

[0016] Beneficial effects: The present invention provides the use of DNAJC9 protein in the preparation of drugs for treating heart failure. The present invention uses the coding gene containing the DNAJC9 protein as a recombinant vector, and stipulates that when the circular vector of the recombinant vector is an AAV overexpression vector, it also includes adeno-associated virus packaging. The adeno-associated virus described in the present invention does not participate in the occurrence of any disease, has low immunogenicity, and can sustain gene expression for more than half a year. Among them, the AAV9 virus has a strong affinity for cardiac tissue and can be used as a vector to stably and efficiently express the target gene sequence in cardiac tissue.

[0017] The present invention demonstrates through experiments that a drug for treating heart failure prepared by DNAJC9 can treat or improve heart failure, especially has a good therapeutic effect on heart failure caused by ischemia-reperfusion injury; specifically, DNAJC9 has the effect of improving cardiac contractile dysfunction caused by myocardial ischemia-reperfusion injury for 3 weeks; overexpression of DNAJC9 can inhibit myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Fluorescence quantitative PCR was used to detect that the expression of DNAJC9 in myocardial tissue was significantly upregulated after tail vein injection of DNAJC9 packaged by adeno-associated virus 9 (AAV9) driven by a myocardial-specific promoter (cTnT);

[0019] Figure 2Echocardiography was used to detect that intravenous injection of AAV9-packaged DNA overexpressing JC9 could improve cardiac contractile dysfunction caused by myocardial ischemia-reperfusion injury for 3 weeks;

[0020] Figure 3 Overexpression of DNAJC9 can resist OGD / R (oxygen glucose deprivation / recovery)-induced cardiomyocyte apoptosis in neonatal rats (n=6); Fugw, control vector treatment; DNAJC9 OE, DNAJC9 overexpression vector; TUNEL positivity indicates cardiomyocyte apoptosis; white arrows in the figure indicate cardiomyocyte apoptosis; α-Actinin, α-Actinin positivity indicates that the cell is a cardiomyocyte; Hoechst, indicates cell nucleus; *, p<0.05; **, p<0.01. DETAILED DESCRIPTION

[0021] The present invention provides use of DNAJC9 protein in preparing a drug for treating heart failure.

[0022] The Gene ID of the DNAJC9 described in the present invention is preferably 23234. Experiments in the present invention demonstrate that a drug for treating heart failure prepared from DNAJC9 can treat or improve heart failure, particularly heart failure caused by ischemia-reperfusion injury. Specifically, DNAJC9 improves cardiac systolic dysfunction caused by three weeks of myocardial ischemia-reperfusion injury, and overexpression of DNAJC9 inhibits myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery. The heart failure described in the present invention preferably includes acute heart failure or chronic heart failure, and more preferably includes heart failure caused by ischemia-reperfusion injury.

[0023] The therapeutic effects of the drug of the present invention preferably include at least one of the following: (1) improving cardiac systolic dysfunction and cardiac fibrosis caused by myocardial ischemia-reperfusion injury;

[0024] (2) Inhibit myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery.

[0025] The present invention provides use of a recombinant vector comprising a gene encoding a DNAJC9 protein in the preparation of a drug for treating heart failure.

[0026] The recombinant vector of the present invention preferably uses an AAV overexpression vector as a circular vector, and more preferably uses an AAV9 overexpression vector as a circular vector.

[0027] The present invention provides use of a reagent for overexpressing DNAJC9 protein in preparing a drug for treating heart failure.

[0028] The reagent for overexpressing DNAJC9 protein of the present invention preferably includes the recombinant vector. When the circular vector of the recombinant vector is an AAV overexpression vector, the preparation method of the drug preferably includes adeno-associated virus packaging; the adeno-associated virus preferably includes AAV9 virus. The present invention has no special requirements for the packaging of the drug, and the operation method familiar to those skilled in the art can be used. The adeno-associated virus of the present invention is not involved in the occurrence of any disease, has low immunogenicity, and can sustain gene expression for more than half a year. Among them, the AAV9 virus has a strong affinity for cardiac tissue and can be used as a vector to stably and efficiently express the target gene sequence in cardiac tissue.

[0029] The present invention provides a recombinant vector comprising a gene encoding a DNAJC9 protein, wherein the circular vector of the recombinant vector comprises an AAV overexpression vector.

[0030] The present invention preferably utilizes a myocardium-specific promoter to drive the expression of the encoding gene, and the myocardium-specific promoter preferably includes cTnT.

[0031] The present invention provides a medicine for treating heart failure, the active ingredient of which includes the above-mentioned recombinant vector.

[0032] The present invention also provides a method for preparing the above-mentioned medicine, which comprises packaging the above-mentioned recombinant vector with adeno-associated virus.

[0033] The adeno-associated virus of the present invention preferably includes AAV9 virus.

[0034] To further illustrate the present invention, the use of DNAJC9 in the preparation of a drug for treating heart failure, the recombinant vector, and the drug for treating heart failure provided by the present invention are described in detail below with reference to the Examples. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1

[0036] 1. Construction of DNAJC9 overexpression virus (AAV9-cTnT-DNAJC9 OE)

[0037] ① The target vector was named pHBAAV-cTnT-MCS-ZsGreen (Hanheng Biotechnology), and the vector was double-digested with EcoRI and KpnI.

[0038] ② Obtaining the target gene, the target gene sequence is SEQ ID No.1: ATGGGGCTGCTGGAGCTGTGCGAGCAGGTGTTTGGCACCGCCGACCTCTACCAAGTGCTGGGCGTGCGGCGCGAGGCTTCGGACGGCGAGGTCCGACGCGGCTACCACAAAGTGTCCCTGCAAGTGCACCCCGACCGAGTAGAGGAGGACCAGAAAGAGGACGCCACCCGCCGCTTCCAGATCTTGGGAAGAGTCTACGCGGTTCTGAGTGACAAGGAACAGAAAGCAGTGTACGATGAACAGGGGACAGTGGACGAAGACTCTGCTGGCCTCAACCAAGACCGGGACTGGGATGCATATTGGAGATTACTCTTTAAAAAGATATCGCTAGAGGATATCCAAGCTTTTGAAAAGACATACAAAGGCTCCGAAGAAGAGCTAAACGATATTAAGCAGGCCTATCTGGACTTCAAGGGCGACATGGACCAGATCATGGAGTCTGTACTTTGTGTACAGTACACAGATGAACCCAGGATAAGAAACATCATTCAAAAAGCTATTGAATCCAAAGAGATTCCAGCCTACAGCGCCTTCGTCAAAGAGTCTAAACAAAAGATGAATGCAAGGAAAAGGAGGGCTCAGGAAGAGGCTAAAGAAGCAGAGTTGAGCAGAAAGGAGCTGGGACTGGAAGAAGGAGTGGATAACTTGAAAGCACTCATCCAGAGCAGACAAAAGGATCGGCAAAAGGAAATGGACAGTTTTCTGGCTCAAATGGAAGCAAAATACTGCAAACCTTCCAAAGGAGGGAAAAGAACAGCACTCAAGAAGGAAAAGAAATGA。

[0039] Using primers:

[0040] AAV-m-Dnajc9-K / E-F (SEQ ID No.2):

[0041] cgtgggacgatccccgaggtaccGCCACCATGGGGCTGCTGGAGCTGTG;

[0042] AAV-m-Dnajc9-K / ER (SEQ ID No. 3): atcgataagcttgatatcgaattcTCATTTCTTTTTCCTTCTTGAGTGC.

[0043] PCR amplification of target fragment: 50μL PCR system: 2X PCR Buffer 25μL, dNTPs mix (10mM each) 1μL, F primer (10μM) 2μL, R primer (10μM) 2μL, template DNA (200ng / uL) 1μL, ddH2O 18μL, phanta Super-Fidelity DNA Polymerase 1μL. Target fragment is connected to the vector.

[0044] Use the HB infusion one-step cloning and ligation system (20 μL): target gene fragment X (≥100 ng), linearized vector Y (≥50 ng), 2×HB infusion™ Mastermix 10 μL, ddH2O (10-XY) μL.

[0045] The ligation reaction solution was reacted at 50°C for 30 minutes and then placed on ice for 5 minutes. After transformation, single clones were picked for Sanger sequencing. After successful sequencing, the plasmid was extracted by shaking, and then AAV9 virus packaging was performed.

[0046] 2. Construction of control virus (AAV9-cTnT-Ctrl)

[0047] The control virus was directly packaged into AAV9 virus using the empty vector pHBAAV-cTnT-MCS-ZsGreen without inserting the target sequence.

[0048] Example 2

[0049] 1. Myocardial Ischemia-Reperfusion Injury (I / R) Model Establishment: The I / R model employed the most severe myocardial injury. Myocardial ischemia was induced by ligating the left anterior descending coronary artery for 30 minutes, followed by reperfusion. Wild-type male mice aged 8 to 10 weeks were anesthetized with 2.0% isoflurane and supported by a ventilator. After anesthesia, the mice were secured to a thermostatic blanket with their abdomen facing upward using medical tape. A midline skin incision was made along the neck, and the muscle tissue was bluntly dissected. The trachea was exposed and opened, and mechanical ventilation was initiated by insertion of an endotracheal tube. The skin and muscle of the left chest were transversely incised, exposing the ribs. Under a stereoscope, microtweezers were carefully inserted into the fourth intercostal space. Intercostal tissue was bluntly dissected, and the pericardium was removed. A 7-0 suture needle with thread was inserted approximately 2 mm below the left atrial appendage using a needle holder. The left anterior descending coronary artery was ligated. Successful ligation was confirmed by the bleaching of tissue below the ligation site due to ischemia. After 30 minutes, the thread was untied, and blood supply was restored. The mouse's ribs, muscles, and skin were tightly sutured using 5-0 sutures, and the wounds were disinfected with iodine to prevent postoperative infection. The mice were then placed on a 37°C electric heating blanket and allowed to rest in cages after spontaneous breathing resumed. After three weeks of care, the mice were sacrificed, and their body weight, tibia length, and heart weight were measured. Samples were then retained for subsequent testing.

[0050] The sham operation described in this example is similar to the above-mentioned I / R operation, with the only difference being that the sham operation group only undergoes threading without ligation.

[0051] The experimental group is divided into 4 groups, specific group information:

[0052] Group 1: Sham group + control virus (AAV9-cTnT-Ctrl), sham surgery was performed on the mouse hearts, with a sample size of 8 mice;

[0053] Group 2: Sham group + DNAJC9 overexpression virus (AAV9-cTnT-DNAJC9 OE), mice underwent sham surgery, with a sample size of 8;

[0054] Group 3 I / R 3w surgery group (I / R 3w) + control virus (AAV9-cTnT-Ctrl), mice underwent cardiac I / R surgery, with a sample size of 12;

[0055] Group 4 I / R 3w+DNAJC9 overexpression virus (AAV9-cTnT-DNAJC9 OE), cardiac I / R surgery for mice, the number of samples was 11.

[0056] Three weeks after I / R or Sham surgery, the mice underwent cardiac color Doppler ultrasound examination. After the examination, the mice were killed and the mouse hearts were dissected. Fluorescence quantitative PCR was used to verify whether AAV9-cTnT-DNAJC9 OE successfully overexpressed DNAJC9 expression in the heart at the animal level.

[0057] 2. qPCR detection of DNAJC9 expression changes

[0058] Three weeks after I / R or Sham surgery, mice were subjected to cardiac color Doppler ultrasound examination. After the examination, the mice were killed and the hearts were dissected. Total RNA from the heart tissue was extracted using Trizol lysis buffer, and cDNA was obtained using a reverse transcription kit. DNAJC9 expression was detected by qPCR, and 2 -ΔCT The expression changes of DNAJC9 were analyzed by computational analysis.

[0059] qPCR reaction system (10 μL): SYBR Green 5 μL, upstream primer F and downstream primer R (10 μM) 0.5 μL each, ddH2O 2.5 μL, cDNA diluent 2 μL;

[0060] The sequences of upstream primer F and downstream primer R used in the qPCR reaction are as follows:

[0061] Upstream primer F (SEQ ID NO. 4): 5′-CATACAAAGGCTCCGAAGAAGAG-3′;

[0062] Downstream primer R (SEQ ID NO. 5): 5'-GCTGAGATGTGCTAGGAACAACA-3'.

[0063] Using 18S as the internal reference gene:

[0064] Upstream primer F (SEQ ID No. 6): TCAAGAACGAAAGTCGGAGG;

[0065] Downstream primer R (SEQ ID No. 7): GGACATCTAAGGGCATCAC.

[0066] The qPCR reaction procedure was as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds, 40 times.

[0067] The results are as follows Figure 1 As shown in the figure, a total of 39 mouse hearts were tested for DNAJC9 expression. The specific data are:

[0068] The values of 8 mice in group 1 were 1.082037, 0.891156, 0.935461, 1.159699, 0.846012, 0.925786, 0.995677, and 1.225822;

[0069] The values of 8 mice in group 2 were 1.9302, 1.751693, 1.838781, 1.903626, 2.14169, 1.763877, 1.86445, and 1.83242;

[0070] The values of 12 mice in group 3 were 0.641157, 0.739053, 0.90047, 0.897355, 0.891156, 0.602382, 0.571866, 0.733948, 0.565951, 0.711408, 0.843085, and 0.846012;

[0071] The values of 11 mice in Group 4 were 1.143733, 1.059769, 1.108609, 1.437687, 1.309259, 1.200595, 1.634387, 1.692024, 1.462818, 1.139776, and 1.147704.

[0072] In summary, DNAJC9 expression was downregulated 3 weeks after I / R surgical reconstruction, while DNAJC9 was successfully overexpressed after AAV9-cTnT-DNAJC9OE treatment.

[0073] Example 3

[0074] The same grouping and treatment methods as in Example 2 were used to select C57BL / 6J adult male mice for ligation of the left anterior descending coronary artery. The ligation was released 30 minutes later, and three weeks after the I / R surgery, cardiac ultrasound was performed to measure cardiac function-related indicators (ejection fraction (EF)) of the above four groups. Small animal cardiac ultrasound was used to measure the cardiac function of mice: after depilating the chest of the mice, the mice were anesthetized with isoflurane inhalation anesthesia, the limbs of the mice were fixed on the ultrasound plate, and an appropriate amount of chelating agent was applied to the heart of the mouse abdomen. The mouse heart was found with a probe, and when the heart rate stabilized at 400-500 beats / minute, the long axis and short axis of the left ventricle beside the sternum were taken for examination, and the cardiac function was measured and calculated to obtain cardiac function-related indicators: left ventricular ejection fraction EF. The results are as follows Figure 2 The specific data are as follows:

[0075] The EF (%) values of 8 mice in group 1 were 68.08933, 56.78895, 62.14628, 69.67081, 72.16652, 67.53276, 56.54445, and 61.123;

[0076] The EF (%) values of 8 mice in group 2 were 70.90605, 58.30046, 65.31185, 66.20446, 60.72826, 67.09329, 63.47389, and 67.9642;

[0077] The EF (%) values of 12 mice in group 3 were 40.65377, 48.67792, 49.36217, 45.62219, 46.63407, 42.96584, 40.54406, 46.13629, 47.39755, 40.80363, 48.32557, and 45.61282;

[0078] The EF (%) values of the 11 mice in Group 4 were 57.92004, 69.87295, 57.59986, 57.9814, 63.07707, 55.86535, 62.34476, 58.74433, 63.70982, 62.2489, and 65.85295.

[0079] The statistical results are as follows Figure 2 As shown in the figure, **P<0.01, DNAJC9 treatment can improve cardiac systolic dysfunction caused by myocardial ischemia-reperfusion injury for 3 weeks.

[0080] Example 4

[0081] Establishment of the cardiomyocyte oxygen-glucose deprivation recovery (OGD / R) model and plasmid transfection: NRCMs were cultured in normal cardiomyocyte culture medium. When cells reached 70-80% density, they were switched to serum-free medium and starved for 6-8 hours. Solution A was then prepared by adding 6 μg of Lipo2000 to 100 μl of serum-free medium and gently pipetting to mix thoroughly. Solution B was prepared by adding 2 μg of plasmid DNA to 100 μl of serum-free medium and gently pipetting to mix thoroughly. Both solutions A and B were allowed to stand for 5 minutes, then mixed thoroughly. After another 20 minutes, 100 μl was added to each well of a 96-well plate. After 6-8 hours of transfection, the transfection medium was discarded and replaced with serum-free medium. Culture was continued in a 37°C, 5% CO2 incubator. Twenty hours after the medium change, the cell culture medium was replaced with glucose-free medium, and the cell plates were placed in an oxygen-depleted chamber for incubation for 8 hours. After 8 h, the cell plate was removed from the hypoxia box for reoxygenation and replaced with complete culture medium, and incubated in an incubator for 12 h until the end of the experiment.

[0082] Neonatal rat cardiomyocytes were transfected with a recombinant DNAJC9 overexpression vector (0.02 mg / L). Cells were harvested 72 hours after treatment and subjected to an OGD / R model (8 hours of oxygen-glucose deprivation followed by 12 hours of reoxygenation and re-glucose resorption) 20 hours before the experimental endpoint for gain-of-function experiments. The groups were divided into: 1) control group (lentiviral overexpression vector Fugw), 2) control group (lentiviral overexpression vector Fugw) + OGD / R treatment group, 3) DNAJC9 overexpression group (lentiviral overexpression DNAJC9 OE), and 4) DNAJC9 overexpression group (lentiviral overexpression DNAJC9 OE) + OGD / R treatment group. The protective effect of DNAJC9 against cardiomyocyte apoptosis was assessed by co-staining with Tunel and α-actinin / Hoechst immunofluorescence.

[0083] Depend on Figure 3 It can be seen that in the OGD / R model, the NRCM apoptosis level was significantly increased compared with the control group; and overexpression of DNAJC9 at the basal level had no effect on apoptosis; however, in the OGD / R model, overexpression of DNAJC9 could protect NRCM from apoptosis caused by oxygen / glucose deprivation recovery experimental damage.

[0084] Specifically,

[0085] The apoptosis rates (%) of group 1 were 2.700804, 1.905089, 2.579482, 3.735947, 2.456718, and 1.66458;

[0086] The apoptosis rates (%) of group 2 were 1.146596, 1.538814, 1.13373, 2.063613, 1.68944, and 2.935943;

[0087] The apoptosis rates (%) of group 3 were 8.932909, 8.702829, 8.866713, 9.480224, 9.015655, and 10.39077;

[0088] The apoptosis rates (%) of group 4 were 3.548041, 2.934612, 3.355803, 2.884852, 3.013297, and 4.549674.

[0089] In summary, increasing DNAJC9 can improve cardiac contractile dysfunction caused by myocardial ischemia-reperfusion injury for 3 weeks; overexpression of DNAJC9 can inhibit myocardial cell apoptosis induced by oxygen-glucose deprivation / recovery.

[0090] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of an adeno-associated virus overexpressing DNAJC9 in the preparation of a drug for treating heart failure, characterized in that: The heart failure is caused by myocardial ischemia-reperfusion injury, and the sequence of the DNAJC9 is shown as SEQ ID No.1.

Images