Nanoparticles, their preparation and applications, and eye disease drugs containing them and their preparation

Abstract

This invention relates to a nanoparticle, its preparation method and application, and a drug comprising the nanoparticle for treating eye diseases and its preparation method. The nanoparticle comprises ribonucleic acid (RNA) and thiols, wherein the RNA comprises double-stranded RNA and RNA aptamers.

Description

Technical Field

[0001] This invention relates to the field of biopharmaceuticals, and particularly to a nanoparticle, its preparation method and application, as well as a medicament for treating eye diseases including the nanoparticle and its preparation method. Background Technology

[0002] According to Frost & Sullivan, the number of people suffering from four major retinal diseases in my country increased from 17.1 million in 2015 to 18.5 million in 2019, and is projected to reach 22 million by 2030. Therefore, the development and improvement of drugs for treating eye diseases is urgently needed.

[0003] Among these, degenerative diseases such as diabetic retinopathy (DR) and age-related macular degeneration (AMD) are the main causes of permanent and irreversible vision loss in the elderly, and their incidence has been increasing in recent years. Vascular malformations and proliferations in the retina and choroid are considered the main causes of DR, AMD, and other diseases.

[0004] Eye drops are an ideal treatment method that is easy to use and requires no advanced equipment. They have shown good therapeutic effects for anterior segment diseases. However, existing eye drops suffer from poor permeability, making them largely ineffective for posterior segment diseases. The main reasons for this may include the presence of multiple physiological barriers in the eye, including the corneal barrier, the blood-ocular barrier (blood-aqueous humor barrier, and blood-retinal barrier): the corneal epithelium blocks drugs with molecular weights greater than 500 Da from passing through; and the retinal capillary endothelial cells and their tight junctions further hinder the passage of hydrophilic compounds and large molecules. Therefore, enabling drugs to cross these barriers and reach the fundus through eye drops remains a challenge.

[0005] With the continuous development of biotechnology, the eye is considered an ideal site for gene therapy: the tight blood-eye barrier provides a relatively immune-immune environment, blocking the transfer of immune cells from the circulatory system to the eye and inhibiting inflammation; secondly, local gene therapy in the eye reduces the risks of systemic administration, and the accumulation of gene drugs in the eye due to barrier barriers improves drug utilization and efficacy, offering the possibility of long-term sustained expression of anti-angiogenic proteins with fewer dosing sessions. However, the susceptibility of nucleic acid drugs used in gene therapy to degradation in vivo hinders their practical application. Moreover, achieving effective and rapid delivery of nucleic acid drugs to the eye remains a challenge. Summary of the Invention

[0006] The purpose of this invention is to solve at least one technical problem of the prior art.

[0007] One embodiment of the present invention relates to a nanoparticle comprising: ribonucleic acid and thiol, wherein the ribonucleic acid includes double-stranded ribonucleic acid and ribonucleic acid aptamers.

[0008] In some embodiments, the nanoparticles exhibit negative charge in aqueous solution.

[0009] In some embodiments, the potential of the nanoparticles in aqueous solution is in the range of -5mV to -30mV.

[0010] In some embodiments, the nanoparticles are spherical.

[0011] In some embodiments, the particle size of the nanoparticles is in the range of 50 nanometers to 200 nanometers.

[0012] In some embodiments, the ribonucleic acid includes vascular endothelial growth factor small interfering ribonucleic acid (VEGF-MINER) and VEGF-MINER aptamers.

[0013] In some embodiments, the base sequence of the ribonucleic acid includes:

[0014] Justice chain (5'-3'): CGAUGAAGCCCUGGAGUGC, Antisense chain (3'-5'): GCACUCCAGGGCUUCAUCG;

[0015] Justice chain (5'-3'): Cy5-CGAUGAAGCCCUGGAGUGC, Antisense chain (3'-5'): GCACUCCAGGGCUUCAUCG;

[0016] (5'-3'): CGGAAUCAGUGAAUGCUUAUACAUCCG;

[0017] (5'-3'):

[0018] (5'-3'):

[0019] Justice chain (5'-3'): GGAGUACCCUGAUGAGAUC, Antisense chain (3'-5'): GAUCUCAUCAGGGUACUCC;

[0020] In the sequence, bold text indicates 2'F base modification, and italic text indicates 2'-Ome base modification.

[0021] In some embodiments, the molar ratio of nitrogen in the thiol to phosphorus in the ribonucleic acid is in the range of 10-40.

[0022] Another aspect of the present invention relates to a method for preparing nanoparticles as described in this application, comprising: mixing ribonucleic acid with thiol to obtain the nanoparticles.

[0023] In some embodiments, the ribonucleic acid is mixed with the thiol in nuclease-free water treated with diethyl pyrocarbonate (DEPC).

[0024] In some embodiments, the thiol is positively charged in aqueous solution.

[0025] Another aspect of the present invention relates to the use of nanoparticles as described in this application in the preparation of a medicament for treating eye diseases.

[0026] Another aspect of the present invention relates to a medicament for treating eye diseases, comprising nanoparticles as described in this application.

[0027] In some embodiments, the medication for treating eye diseases is eye drops.

[0028] In some embodiments, the medication for treating eye diseases is suitable for ocular surface instillation.

[0029] In some embodiments, the medication for treating eye diseases includes artificial tears.

[0030] In some embodiments, the pH of the drug for treating eye diseases is in the range of 5.5 to 8.0, and the osmotic pressure is in the range of 287 to 312 mmol / L.

[0031] In some embodiments, the drug for treating eye diseases includes sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride.

[0032] In some embodiments, the drug for treating eye diseases is suitable for treating fundus diseases caused by cell proliferation, angiogenesis, and leakage.

[0033] Another aspect of the present invention relates to a method for preparing a medicament for treating eye diseases as described in this application, comprising the following steps: preparing artificial tears; and mixing the thiol and the ribonucleic acid, and / or the nanoparticles with the artificial tears to obtain the medicament.

[0034] In some embodiments, sodium chloride, sodium bicarbonate, potassium chloride, calcium chloride, and nuclease-free water treated with diethyl pyrocarbonate (DEPC) are mixed to prepare the artificial tears.

[0035] In some embodiments, the calcium chloride is calcium chloride monohydrate powder.

[0036] Where technical conditions permit, the technical solutions of the various embodiments in this application can be combined in any way.

[0037] The present application will be further described below with reference to the accompanying drawings. The same or similar abbreviations may be used in the drawings to refer to the same or similar materials in different embodiments, and descriptions of the same or similar materials, steps, effects, etc. in different embodiments, as well as descriptions of materials, steps, effects, etc. that are the same or similar to those in the prior art, may be omitted. Attached Figure Description

[0038] Figure 1 This is a schematic diagram illustrating the preparation and application of nanoparticles and drugs involved in the embodiments of the present invention.

[0039] Figure 2 This is a potential data graph of thiols in Experiment Example 1.

[0040] Figure 3 A, 3B, and 3C are data analysis graphs and scanning electron microscope images of the potential and particle size of mouse-derived VEGF siRNA-thiol particles in Experiment Example 2, respectively.

[0041] Figure 4 A and 4B are schematic diagrams of the separation and assembly ratio optimization verification of mouse-derived VEGF siRNA-thiol nanoparticles in Experiment Example 3, and particle size distribution diagrams for N / P = 20, 30, and 40, respectively.

[0042] Figure 5 Gel electrophoresis images of mouse-derived VEGF siRNA alone (VEGF siRNA alone) and mouse-derived VEGF siRNA-thiol nanoparticles (VEGF siRNA assembly) at time points of 0 h, 2 h, 8 h, 24 h, 36 h, and 50 h incubation in 50% fetal bovine serum, respectively, and gel electrophoresis images of control samples.

[0043] Figure 6 These are laser scanning fluorescence confocal microscopy images of the eyes of C57BL6J mice in Experiment Example 6 after instilling mouse-derived VEGF siRNA-Cy5 eye drops, mouse-derived VEGF siRNA-Cy5 and PEI-assembled nanoparticle eye drops, and mouse-derived VEGF siRNA-Cy5-thiol nanoparticle eye drops, respectively.

[0044] Figure 7 The images are optical coherence tomography (OCT) images of the fundus of mice in different groups at different treatment times in Experiment Example 7.

[0045] Figure 8 A and 8B are immunofluorescence confocal fluorescence imaging images and data statistics of the fundus neovascularization area of ​​mice in each group after treatment in Experiment Example 7, respectively.

[0046] Figure 9 These are fluorescein fundus angiography images of mice in each group at different times in Experiment Example 8.

[0047] Figure 10 A, 10B, and 10C are data analysis graphs and scanning electron microscope images of the potential and particle size of VEGF aptamer-thiol nanoparticles in Experimental Example 9, respectively.

[0048] Figure 11 It is an electrophoresis image from Experiment Example 9.

[0049] Figure 12 These are laser scanning fluorescence confocal microscopy images of tissue samples from different groups of C57BL6J mice in Experiment Example 10.

[0050] Figure 13 These are optical coherence tomography (OCT) images of the fundus of mice in different groups at different treatment times in Experiment Example 11.

[0051] Figure 14 A and 14B are immunofluorescence confocal fluorescence imaging images and data statistics of the fundus neovascularization area of ​​mice in each group after treatment in Experiment Example 11, respectively.

[0052] Figure 15 This is a potential data graph of human VEGF siRNA-thiol nanoparticles from Experiment Example 12.

[0053] Figure 16 This is a statistical graph showing the inhibition rate of human VEGF siRNA-thiol nanoparticles on the proliferation of A549 cells in Experiment Example 13. Detailed Implementation

[0054] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the present invention. Improvements and adjustments made by those skilled in the art based on the present invention in practical applications still fall within the scope of protection of the present invention.

[0055] One embodiment of the present invention relates to a nanoparticle comprising: ribonucleic acid (RNA) and thiols, wherein the RNA includes double-stranded RNA and RNA aptamers. The nanoparticles of the present invention exhibit good stability in serum, prolonging the degradation time of nucleic acid drugs comprising the nanoparticles in serum. They can effectively and rapidly penetrate the fundus from the ocular surface, making them suitable for treating eye diseases. They can inhibit angiogenesis and leakage, inhibit cell proliferation, and can be used to prepare eye drops. They can be used for treatments that are simple to operate and do not require advanced equipment. The nanoparticles of the present invention can effectively penetrate the fundus barrier, thereby interfering with the action of vascular endothelial growth factor (VEGF), reducing angiogenesis, and effectively treating diseases related to abnormal retinal vascular proliferation. The nanoparticles of the present invention can deliver nucleic acid drugs comprising the nanoparticles into the fundus through a non-invasive eye drop method to treat abnormal vascular proliferation diseases.

[0056] In some embodiments, the nanoparticles exhibit negative charge in aqueous solution. This contributes to the nanoparticles' good stability and resistance to degradation, facilitating their penetration into ocular tissues.

[0057] In some embodiments, the nanoparticles have a potential in aqueous solution ranging from -5 mV to -30 mV. This helps maintain the dispersibility of the nanoparticles under physiological conditions and facilitates their penetration into ocular tissues.

[0058] In some embodiments, the nanoparticles are spherical. This allows the nanoparticles to effectively and rapidly penetrate from the ocular surface to the fundus, making them suitable for treating eye diseases.

[0059] In some embodiments, the nanoparticles have a particle size ranging from 50 nanometers to 200 nanometers. This allows the nanoparticles to be used in the preparation of eye drops, facilitating thiol exchange-mediated tissue penetration between ocular surface tissues, enabling simple operation and treatment of eye diseases without the need for advanced equipment.

[0060] The ribonucleic acid (RNA) may be a ribonucleic acid capable of inhibiting the translation of VEGF messenger RNA (mRNA) or inhibiting VEGF function. The mRNA encoding VEGF is identified as XM_002733270.2 in the National Center for Biotechnology Information (NCBI) database.

[0061] The double-stranded ribonucleic acid (BRNA) may include double-stranded small interfering RNA (SMI). The ribonucleic acid aptamers may include fluorinated and methylated ribonucleic acid aptamers.

[0062] In some embodiments, the ribonucleic acid includes vascular endothelial growth factor small interfering ribonucleic acid (VEGF-MI) and VEGF-MI aptamers. This allows the nanoparticles to inhibit angiogenesis and leakage, and suppress abnormal retinal vascular proliferation.

[0063] The formation of intraocular neovascularization is a common pathological feature of many eye diseases, such as diabetic retinopathy (DR) and age-related macular degeneration (AMD). The pathogenesis of many fundus diseases is related to the overexpression of vascular endothelial growth factor (VEGF). Physiologically secreted VEGF plays an important role in maintaining vascular integrity, but overexpression leads to abnormal angiogenesis. Therefore, the nanoparticles involved in the embodiments of this application, including VEGF small interfering RNA and VEGF RNA aptamers, can help eliminate VEGF at its source, effectively eradicating neovascularization and restoring eye function.

[0064] The double-stranded ribonucleic acid (BRNA) may include vascular endothelial growth factor (VEGF) double-stranded small interfering RNA. The ribonucleic acid aptamers may include fluorinated and methylated VEGF ribonucleic acid aptamers.

[0065] Examples of the ribonucleic acid base sequence may include, but are not limited to:

[0066] Justice chain (5'-3'): CGAUGAAGCCCUGGAGUGC, Antisense chain (3'-5'): GCACUCCAGGGCUUCAUCG;

[0067] Justice chain (5'-3'): Cy5-CGAUGAAGCCCUGGAGUGC, Antisense chain (3'-5'): GCACUCCAGGGCUUCAUCG;

[0068] (5'-3'): CGGAAUCAGUGAAUGCUUAUACAUCCG;

[0069] (5'-3'):

[0070] (5'-3'):

[0071] And the justice chain (5'-3'): GGAGUACCCUGAUGAGAUC, the antisense chain (3'-5'): GAUCUCAUCAGGGUACUCC.

[0072] In the sequence, bold text indicates 2'F base modification, and italic text indicates 2'-Ome base modification.

[0073] In some embodiments, the molar ratio of nitrogen in the thiol to phosphorus in the ribonucleic acid is in the range of 10-40. This results in the nanoparticles exhibiting good stability and being less prone to degradation.

[0074] Another aspect of the present invention relates to a method for preparing nanoparticles as described in this application, comprising: mixing ribonucleic acid with thiol to obtain the nanoparticles. The nanoparticle preparation method described in the embodiments of the present invention does not require large-scale equipment, has low cost, is simple in process, and is conducive to large-scale production.

[0075] The nanoparticles prepared in the embodiments of the present invention may be self-assembled through electrostatic interactions between the phosphate groups of nucleic acid bases and the guanidine groups of thiols.

[0076] When mixing ribonucleic acid (RNA) with thiols, methods such as shaking, sonication, vortexing, and microfluidic mixing can be used. After mixing, the RNA and thiols can be removed by ultrafiltration, dialysis, centrifugation, etc., to remove excess unassembled nucleic acid or thiols.

[0077] In some embodiments, the ribonucleic acid and the thiol are mixed in nuclease-free water treated with diethyl pyrocarbonate (DEPC). This allows for a less complex preparation method using fewer materials, simpler operation, and lower cost, while also reducing the degradation of the nucleic acid molecules carried by the nanoparticles, maintaining the structural and functional integrity of the nucleic acid molecules, and ensuring drug efficacy.

[0078] The thiol may have the general structural formula: |A|-R-|M|, where A is... R represents the carbon chain skeleton; M represents a positively charged group.

[0079] For example, the molecular structure of the thiol can be:

[0080] in,

[0081] M1 is a group that becomes positively charged after ionization under certain conditions, such as a primary amine group. secondary amine group tertiary amine group Quaternary ammonium group or guanidine

[0082] Specifically, examples of the structural formula of the thiol may include, but are not limited to:

[0083] In some embodiments, the thiol exhibits a positive charge in aqueous solution. This facilitates the smooth combination of the thiol with the ribonucleic acid to obtain the nanoparticles.

[0084] Another aspect of the present invention relates to the application of nanoparticles as described in this application in the preparation of medicaments for treating eye diseases. This allows the prepared medicaments for treating eye diseases to effectively and rapidly enter the fundus from the ocular surface, inhibiting angiogenesis and leakage, inhibiting cell proliferation, and enabling simple operation and treatment of eye diseases without the need for advanced equipment.

[0085] Another aspect of the present invention relates to a medicament for treating eye diseases, comprising nanoparticles as described in this application. The medicament for treating eye diseases described in the embodiments of the present invention can effectively and rapidly penetrate from the ocular surface to the fundus, inhibiting angiogenesis and leakage, and inhibiting cell proliferation.

[0086] In some embodiments, the medication for treating eye diseases is an eye drop. This allows for easy administration of the medication without the need for advanced equipment, enabling non-invasive drug delivery and significantly reducing patient discomfort and the risk of side effects such as intraocular infections.

[0087] In some embodiments, the medication for treating eye diseases is suitable for ocular surface instillation. This allows for easy administration of the medication without the need for advanced equipment, enabling non-invasive drug delivery and significantly reducing patient discomfort and the risk of side effects such as intraocular infections.

[0088] In some embodiments, the medication for treating eye diseases includes artificial tears. This helps to moisturize the eyes while treating the eye disease. Artificial tears can be liquids that are non-toxic to the eyes, highly biocompatible, safe, and do not affect the efficacy of the medication.

[0089] In some embodiments, the pH of the drug for treating eye diseases is in the range of 5.5 to 8.0, and the osmotic pressure is in the range of 287 to 312 mmol / L. This helps to minimize the drug's side effects on the eyes and helps maintain the integrity and functionality of the drug's nanostructure in solution.

[0090] In some embodiments, the drug for treating eye diseases includes sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride. This can help minimize the drug's side effects on the eyes and help maintain the integrity and functionality of the drug's nanostructure in solution.

[0091] In some embodiments, the medication for treating eye diseases is suitable for treating fundus diseases caused by cell proliferation, angiogenesis, and leakage. This can help meet the needs for treating fundus diseases.

[0092] Another aspect of the present invention relates to a method for preparing a medicament for treating eye diseases as described in this application, comprising the following steps: preparing artificial tears; and mixing the thiol and the ribonucleic acid, and / or the nanoparticles, with the artificial tears to obtain the medicament. This method contributes to a simpler process, fewer types of materials, relatively lower cost, and suitability for large-scale production.

[0093] When the thiol and the ribonucleic acid are mixed with the artificial tears, the thiol and the ribonucleic acid can form the nanoparticles in the artificial tears.

[0094] When mixing the nanoparticles with the artificial tears, the nanoparticles can be mixed with the artificial tears after the thiol and the ribonucleic acid have formed the nanoparticles.

[0095] If necessary and conditions permit, the thiol, the ribonucleic acid, the nanoparticles, and the artificial tears can be mixed. That is, the nanoparticles in the drug include those formed before the thiol and ribonucleic acid are mixed with the artificial tears, as well as those formed after the thiol and ribonucleic acid are mixed with the artificial tears.

[0096] In some embodiments, sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride are mixed with nuclease-free water treated with diethyl pyrocarbonate (DEPC) to prepare the artificial tears. This allows for the preparation of the drug for treating eye diseases described in this application, using materials that are relatively readily available and inexpensive, and helps maintain the integrity and functionality of the drug's nanostructure in solution.

[0097] In some embodiments, the calcium chloride is calcium chloride monohydrate powder. This facilitates the transportation and storage of materials used in the preparation method of the drug for treating eye diseases described in this application.

[0098] Figure 1 This diagram illustrates the preparation and application of nanoparticles and drugs involved in the embodiments of the present invention. Please refer to [link / reference]. Figure 1 In the embodiments of this application, the phosphate groups of the bases of nucleic acid molecules such as double-stranded ribonucleic acid and ribonucleic acid aptamers may self-assemble with the guanidinium groups of thiols through electrostatic interactions. The resulting nucleic acid thiols nanoparticles have good stability and can effectively penetrate the ocular barrier to reach the fundus, such as the choroid layer. By inhibiting the activation of vascular epithelial growth factor (VEGF) receptors or knocking down VEGF expression, they can inhibit fundus angiogenesis and treat lesions related to angiogenesis.

[0099] The experimental examples in this application are primarily for the purpose of helping to understand the embodiments of the present invention and are not intended to limit the scope of the claims. As can be seen from the experimental examples described below, the nanoparticles assembled with various different sequences of ribonucleic acid in the embodiments of this application can all penetrate to the fundus through non-invasive ophthalmic drops or ocular surface instillation, and have significant inhibitory effects on angiogenesis, vascular permeability, and cell proliferation, demonstrating strong universality and promising prospects for clinical translation and application.

[0100] Experimental Example

[0101] Unless otherwise specified, the materials used in the experimental examples of this application and their sources are described below.

[0102] The ribonucleic acid (RNA) included murine vascular endothelial growth factor small interfering RNA (mutine VEGF siRNA), murine VEGF siRNA labeled with Cy5 fluorescence (mutine VEGF siRNA-Cy5), VEGF aptamer, VEGF aptamer labeled with Cy5 fluorescence (VEGF aptamer-Cy5), and human VEGF siRNA. The base sequences of each RNA are listed in Table 1 below.

[0103] Table 1.

[0104]

[0105] Note: Bold text in the sequence indicates 2'F base modification, and italic text indicates 2'-Ome base modification.

[0106] All ribonucleic acids (RNAs) were synthesized by Shanghai Sangon Biotech Co., Ltd. and purified by high-performance liquid chromatography (HPLC). Phosphate-buffered saline (PBS), 4% paraformaldehyde, ammonium persulfate, 30% acrylamide, and TBE buffer used in preparing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels, bovine serum albumin, sucrose, mounting medium used in tissue sample preparation, and the CCK8 kit used to measure cell proliferation were all purchased from Beyotime Biotech Ltd. Polyethyleneimine (PEI) used in the control experiments, tetramethylethylenediamine (TEMED) used in preparing SDS-PAGE gels, and Gel Red nucleic acid dye used in nucleic acid gel electrophoresis imaging were purchased from Sigma-Aldrich, USA. Tris phosphate-buffered saline (1x TBST) was purchased from CST Biotech, USA. Sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride monohydrate powder were purchased from Sinopharm Group. The GS-IB4 lectin dye used to determine the area of ​​neovascularization in the fundus was purchased from Thermo Fisher Scientific, USA. Optical Coherence Tomography (OCT) gels were purchased from SAKURA Pharmaceuticals, USA. Lipoic acid, 1',1-carbonyldiimidazole, anhydrous dichloromethane, ethylenediamine, anhydrous sodium sulfate, 1H-pyrazole-1-methylamidine hydrochloride, diethyl ether, and methanol were all purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd. Diethyl pyrocarbonate (DEPC)-treated nuclease-free water (DEPC water) was purchased from Shanghai Sangon Biotech Co., Ltd. Human non-small cell lung cancer cells (A549) were purchased from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. Mice were 6-8 week old C57BL6J strain mice purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0107] Experimental Example 1. Preparation and Characterization of Thiols

[0108] Weigh 2.352 g of lipoic acid and 2.436 g of N,N'-carbonyldiimidazole (CDI) and dissolve them in 70 mL of dichloromethane in a round-bottom flask. Then, place the round-bottom flask on a magnetic stirrer at 0 °C and simultaneously add 4 mL of anhydrous dichloromethane and 6 mL of ethylenediamine dropwise while stirring to obtain a mixture. After stirring, pour the mixture into a separatory funnel, recover the organic layer, remove water with anhydrous sodium sulfate, and then evaporate under reduced pressure to obtain an oily substance. Dissolve the obtained oily substance in an equimolar amount of a dichloromethane solution of 1H-pyrazole-1-formamidinium hydrochloride, distill under reduced pressure, dissolve the resulting precipitate in 1 mL of methanol, and wash the precipitate with 10 mL of diethyl ether to obtain a pale yellow solid thiol with the following structural formula:

[0109]

[0110] The potential of thiol in aqueous solution was measured to be positive, as shown in Figure 1. Figure 2 .

[0111] Experimental Example 2. Preparation and Characterization of Mouse-Derived VEGF siRNA-Thiol Nanoparticles

[0112] 239.7 mM of thiol prepared as described in Experimental Example 1 was mixed with 20 μM of mouse-derived VEGF siRNA or mouse-derived VEGF siRNA-Cy5 in 90 μL of nuclease-free water treated with diethyl pyrocarbonate (DEPC). The mixture was shaken at room temperature for 40 min, allowed to stand for 20 min, and then centrifuged at 20,000 rpm for 30 min to remove excess thiol. The mixture was then resuspended in 90 μL of DEPC water to obtain a mouse-derived VEGF siRNA-thiol nanoparticle solution or a mouse-derived VEGF siRNA-Cy5-thiol nanoparticle solution with a nitrogen-to-phosphorus molar ratio of thiol (N / P) of 20. Data analysis graphs of the potential and particle size of the mouse-derived VEGF siRNA-thiol nanoparticles and images of the mouse-derived VEGF siRNA-thiol nanoparticles obtained by scanning electron microscopy are shown below. Figure 3 A, 3B, and 3C.

[0113] See Figure 3 A, 3B, and 3C: Mouse-derived VEGF siRNA and thiols were successfully assembled into spherical mouse-derived VEGF siRNA-thiol nanoparticles in DEPC water, which exhibited negative charge in solution. Figure 3 A), with a particle size of approximately 75 nm. Figure 3 B and Figure 3 C).

[0114] Experimental Example 3. Assembly Ratio of Mouse-Derived VEGF siRNA-Thiol Nanoparticles

[0115] Using thiols with nitrogen to phosphorus molar ratios of thiols to ribonucleic acid of 5, 10, 15, 20, 30, and 40, and mouse-derived VEGF siRNA, mouse-derived VEGF siRNA nanoparticles were synthesized according to the method in Experimental Example 2.

[0116] Mouse-derived VEGF siRNA-thiol nanoparticles with different N / P ratios were separated by electrophoresis on a 16% SDS-PAGE gel at 100V for 50 min to verify the assembly effect of mouse-derived VEGF siRNA and thiol. The separation results are compared with images of VEGF siRNA alone by electrophoresis on a 16% SDS-PAGE gel at 100V for 50 min, as shown below. Figure 4 As shown in Figure A, it can be seen that when N / P > 15, the assembly effect is relatively sufficient.

[0117] The particle size of spherical mouse-derived VEGF siRNA-thiol nanoparticles with N / P = 20, 30, and 40 was measured, and the data are shown in [the table / image]. Figure 4 B. As can be seen, the particle size of the nanoparticles ranges from 50 nm to 200 nm, and the particle size increases with increasing N / P ratio. Unless otherwise specified, subsequent experiments used mouse-derived VEGF siRNA-thiol nanoparticles with an N / P ratio of 20.

[0118] Experimental Example 4. Stability of mouse-derived VEGF siRNA-thiol nanoparticles in fetal bovine serum

[0119] Rat-derived VEGF siRNA (monolithic siRNA) and rat-derived VEGF siRNA-thiol nanoparticles (VEGF siRNA assemblies) were placed in 50% fetal bovine serum and incubated at 37°C. Samples were collected at 0, 2, 8, 24, 36, and 50 hours for band separation using a 16% SDS-PAGE gel at 100V for 50 min, followed by gel red staining for 30 min. The results are shown in [Figure / Image / Table]. Figure 5 .

[0120] As controls, mouse VEGF siRNA samples incubated for 0 hours without serum (0 hours serum-free VEGF siRNA), mouse VEGF siRNA samples incubated for 50 hours without serum (50 hours serum-free VEGF siRNA), and mouse VEGF siRNA-thiol nanoparticles incubated for 50 hours without serum (50 hours assembled without serum) were imaged by electrophoresis on a 16% SDS-PAGE gel at 100V for 50 min, followed by gel red staining for 30 min. The results are shown together. Figure 5 .

[0121] Please see Figure 5 As incubation time increased, for example, starting from the second hour, individual VEGF siRNAs were significantly degraded, while VEGF siRNA assemblies remained largely unaffected within 24 hours.

[0122] It is evident that mouse-derived VEGF siRNA-thiol nanoparticles exhibit better stability and are less susceptible to degradation by serum nucleases compared to mouse-derived VEGF siRNA.

[0123] Experimental Example 5. Preparation of Mouse-Derived VEGF siRNA-Thiol Nanoparticle Eye Drops

[0124] Sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride monohydrate powder were added to DEPC water and mixed thoroughly to obtain artificial tears. The pH of the artificial tears was 7.4-7.6, and the concentrations of each component were as follows: sodium chloride 116.02 mmol / L; sodium bicarbonate 25.95 mmol / L; potassium chloride 18.51 mmol / L; and calcium chloride 0.65 mmol / L.

[0125] Then, 7.8 mmol / L of thiol and 14 μmol / L of mouse-derived VEGF siRNA were thoroughly mixed in artificial tears (formulation solvent) to obtain eye drops.

[0126] Experimental Example 6. Mouse-derived VEGF siRNA-thiol nanoparticles spanning the retinal pigment epithelial cell layer and outer nuclear layer

[0127] To verify penetration, this example uses mouse-derived VEGF siRNA-Cy5-thiol nanoparticle eye drops, mouse-derived VEGF siRNA-Cy5 eye drops, and mouse-derived VEGF siRNA-Cy5 nanoparticle eye drops assembled with polyethyleneimine (PEI) prepared in accordance with Experimental Example 5.

[0128] Three hours after instilling mouse VEGF siRNA-Cy5 eye drops, mouse VEGF siRNA-Cy5 nanoparticles assembled with polyethyleneimine (PEI) eye drops, and mouse VEGF siRNA-Cy5-thiol nanoparticle eye drops into the eyes of C57BL6J mice in the siRNA group, siRNA-PEI nanoparticle group, and siRNA-thiol nanoparticle group, respectively, the mice were sacrificed and eyeball tissue samples were collected. The tissue samples were fixed on ice with 4% paraformaldehyde for 15 min, and then dehydrated with 30% sucrose solution. The tissue samples were then embedded in OCT gels and sectioned into 10 μm thick sections using a cryosectioning machine and mounted with mounting medium. Finally, the distribution of mouse VEGF siRNA-Cy5 in the tissue samples of the siRNA group, siRNA-PEI nanoparticle group, and siRNA-thiol nanoparticle group mice was imaged using laser scanning fluorescence confocal microscopy. The resulting images are shown below. Figure 6 .

[0129] from Figure 6 It can be seen that no Cy5 fluorescence signal of siRNA was observed in the siRNA group, while Cy5 fluorescence signals of siRNA with different intensities were observed between the retinal pigment epithelial cell layer and the outer nuclear layer in the mouse fundus of the siRNA-PEI nanoparticle group and the siRNA-thiol nanoparticle group.

[0130] Therefore, it can be seen that mouse-derived VEGF siRNA-Cy5 alone has virtually no ability to cross the ocular barrier, and siRNA-PEI nanoparticles have limited penetration ability, while siRNA-thiol nanoparticles have strong penetration ability and can effectively and quickly cross the retinal pigment epithelial cell layer of the fundus and distribute in the outer nuclear layer of the eyeball, with better barrier crossing ability and efficiency.

[0131] Experimental Example 7. Mouse-derived VEGF siRNA-thiol nanoparticles for the treatment of CNV mouse model

[0132] A mouse CNV model was constructed using a small animal retinal imaging system from Phoenix Research Labs, USA. Treatment began two days later: mouse-derived VEGF siRNA-Cy5 eye drops and prepared mouse-derived VEGF siRNA-Cy5-thiol nanoparticle eye drops were administered separately to the ocular surface of 6-8 week old C57BL6J mice (CNV mice) at a dosage of 0.28 nmol / eye per day, divided into three doses. On days 3 and 7 of treatment, optical coherence tomography (OCT) was used to image the fundus of each group of mice. Figure 7To observe the recovery process.

[0133] from Figure 7 It can be seen that murine VEGF siRNA-thiol nanoparticles have a good therapeutic effect on CNV mice. With continuous treatment with murine VEGF siRNA-thiol nanoparticles, the fundus of the corresponding group of mice continued to improve, and the fundus of the mice was basically recovered by the 7th day of treatment. However, murine VEGF siRNA alone could not play a therapeutic role, and the fundus cell tomolysis of the corresponding group of mice became more severe.

[0134] Eyeballs from CNV mice treated on day 7 were removed and fixed at 4°C for 24 hours. After fixation, the eyeballs were prepared under a stereomicroscope: the cornea and iris were removed using corneal scissors, the lens was removed, and the retina was dissected using micro-forceps, leaving the choroid. The eyeballs were then incubated with blocking solution (1x TBST) containing 5% bovine serum albumin (BSA) at room temperature for 2 hours with shaking, followed by overnight incubation with lectin GS-IB4 (1:200) at room temperature with shaking. The eyeballs were then washed three times with PBS for 10 minutes each time. Finally, the samples were placed on a glass slide and fluorescence imaging was performed using immunofluorescence confocal microscopy to observe fluorescence under 564 nm excitation. The resulting images are shown below. Figure 8 A. Next, the area of ​​the blood vessels was measured, and area statistics were performed at multiple points. The resulting data are shown in the table below. Figure 8 B.

[0135] like Figure 8 As shown in A and 8B, compared with mouse-derived VEGF siRNA alone, mouse-derived VEGF siRNA-thiol nanoparticles can effectively inhibit neovascularization in the fundus of CNV mice within the same treatment time, reduce angiogenesis, and decrease the size of new blood vessels.

[0136] Experimental Example 8. Mouse-derived VEGF siRNA-thiol nanoparticles for inhibiting retinal vascular leakage in mice.

[0137] A mouse CNV model was constructed using a small animal retinal imaging system from Phoenix Research Labs, USA. Treatment began two days later: mouse VEGF siRNA-Cy5 eye drops and mouse VEGF siRNA-Cy5-thiol nanoparticle eye drops were administered separately at a dose of 0.28 nmol / eye daily, divided into three doses, to the ocular surface of 6-8 week old C57BL6J mice (CNV mice) in the VEGF siRNA-only group and the VEGF siRNA nanoparticle group, respectively. On days 3 and 7 of treatment, the mice were anesthetized and injected intraperitoneally with sodium fluorescein solution. Within 3 minutes, fluorescein fundus angiography (FFA) was performed using the small animal retinal imaging system. The images are shown below. Figure 9 The leakage of retinal blood vessels in each group of mice was observed. Simultaneously, one untreated CNV model mouse (CNV control group) and the treated CNV mice had their FFA images acquired on days 3 and 7, respectively, and are presented together. Figure 9 .

[0138] like Figure 9 As shown, the CNV mouse model constructed alone did not spontaneously heal within 7 days. Compared with mouse-derived VEGF siRNA alone, mouse-derived VEGF siRNA-thiol nanoparticles could reduce the fluorescence intensity of sodium fluorescein at the modeling site within the same treatment time, indicating that mouse-derived VEGF siRNA-thiol nanoparticles effectively inhibited vascular leakage at the CNV mouse modeling site and reduced the degree of fundus vascular leakage in CNV mice.

[0139] Experimental Example 9. Preparation, characterization, and optimization of VEGF aptamer-thiol nanoparticles or VEGF aptamer-Cy5-thiol nanoparticles.

[0140] 239.7 mM thiols were mixed with 20 μM VEGF aptamer or VEGF aptamer-Cy5 in 90 μL of DEPC water. The mixture was shaken at room temperature for 40 min, allowed to stand for 20 min, and then centrifuged at 20,000 rpm for 30 min to remove excess thiols. The mixture was then resuspended in 90 μL of DEPC water to obtain either a VEGF aptamer-thiols nanoparticle solution or a VEGF aptamer-Cy5-thiols nanoparticle solution.

[0141] The data analysis graphs obtained from measuring the potential and particle size of VEGF aptamer-thiol nanoparticles and the images of VEGF aptamer-thiol nanoparticles taken using scanning electron microscopy are shown in the figure below. Figure 10 A, 10B, and 10C.

[0142] See Figure 10 A, 10B, and 10C, VEGF aptamer and thiols were successfully assembled into spherical VEGF aptamer-thiol nanoparticles in DEPC water, which exhibited negative charge in solution. Figure 10 A), with a particle size of approximately 65 nm. Figure 10 B and Figure 10 C).

[0143] VEGF aptamer and thiols were assembled at N / P ratios of 5, 10, 15, 20, 30, and 40, and separated by electrophoresis on a 16% SDS-PAGE gel at 100V for 50 min to verify the effects of different assembly ratios. The resulting images are shown below. Figure 11 VEGFaptamer alone was used as a control for whether nanoparticles were successfully assembled. Electrophoresis was performed on a 16% SDS-PAGE gel at 100V for 50 min. The resulting images are shown below. Figure 11 .

[0144] from Figure 11 As can be seen, successful assembly is achieved when N / P ≥ 10, and the nanoparticles remain trapped in the channels instead of flowing out through the gel. Unless otherwise specified, subsequent experiments will use VEGF aptamer-thiol nanoparticles with N / P = 20.

[0145] Experimental Example 10. VEGF aptamer-thiol nanoparticles span the retinal pigment epithelial cell layer and outer nuclear layer.

[0146] To verify penetration, this example used VEGF aptamer eye drops and VEGF aptamer-Cy5-thiol nanoparticle eye drops labeled with Cy5 fluorescence. After instilling the eye drops into the eyes of C57BL6J mice in the aptamer group and the aptamer-thiol nanoparticle group, respectively, for 3 hours, the mice were sacrificed and eyeball tissue samples were collected. The tissue samples were fixed on ice with 4% paraformaldehyde for 15 min, followed by dehydration with 30% sucrose solution. Then, the tissue samples were embedded in OTC gel, sectioned into 10 μm thick sections using a cryosectioning machine, and mounted with mounting medium. Finally, the distribution of VEGF aptamer-Cy5 fluorescence in the tissue samples was imaged using laser scanning fluorescence confocal microscopy. The resulting images are shown below. Figure 12 .

[0147] from Figure 12 It can be seen that no Cy5 fluorescence signal of VEGF aptamer was observed in the sample tissues of the aptamer group mice, while Cy5 fluorescence signal of aptamer was observed in the fundus between the retinal pigment epithelial cell layer and the outer nuclear layer of the sample tissues of the aptamer-thiol nanoparticle group mice.

[0148] Therefore, it can be seen that VEGF aptamer-Cy5 alone has virtually no ability to cross the ocular barrier, while aptamer-thiol nanoparticles have strong penetrability and can effectively and quickly cross the retinal pigment epithelial cell layer at the fundus and distribute in the outer nuclear layer of the eyeball, showing good barrier crossing ability and efficiency.

[0149] Experimental Example 11. VEGF aptamer-thiol nanoparticles for the treatment of CNV mouse model

[0150] A mouse CNV model was constructed using a small animal retinal imaging system from Phoenix Research Labs, USA. Treatment began two days later: VEGF aptamer-Cy5 eye drops and VEGF aptamer-Cy5-thiol nanoparticle eye drops were administered separately to the ocular surface of 6-8 week old C57BL6J mice (CNV mice) at a dosage of 0.28 nmol / eye daily, divided into three doses. Fundus imaging of each group of mice was performed using OCT on days 3 and 7 of treatment. The results are shown in [images / images]. Figure 13 To observe the recovery of the fundus of mice in each group.

[0151] from Figure 13 It can be seen that VEGF aptamer-thiol nanoparticles have a good therapeutic effect on CNV mice, and can effectively heal the cell layers penetrated by laser in the mouse fundus. By the 7th day of treatment, the fundus has basically recovered. On the other hand, VEGF aptamer alone has no significant therapeutic effect.

[0152] Eyeballs from CNV mice treated on day 7 were removed and fixed at 4°C for 24 hours. After fixation, the eyeballs were prepared under a stereomicroscope: the cornea and iris were removed using corneal scissors, the lens was removed, and the retina was dissected using micro-forceps, leaving the choroid. The eyeballs were then incubated with a blocking solution containing 5% BSA (1x TBST) at room temperature with shaking for 2 hours, followed by overnight incubation with lectin GS-IB4 (1:200) at room temperature with shaking. The eyeballs were then washed three times with PBS for 10 minutes each time. Finally, the samples were placed on a glass slide for immunofluorescence confocal fluorescence imaging. Figure 14 A. To observe fluorescence under 564nm excitation and measure the area of ​​blood vessels, multiple data points were collected for area statistics, and the data analysis is shown below. Figure 14 B.

[0153] like Figure 14 As shown in Figure A, compared to VEGF aptamer alone, VEGF aptamer-thiol nanoparticles can reduce the size of neovascularization within the same treatment time.

[0154] Combination Figure 14 As can be seen from B, VEGF aptamer-thiol nanoparticles can reduce fundus vascular proliferation in CNV mice and effectively inhibit neovascularization in the fundus of mice.

[0155] Experimental Example 12. Preparation of Human VEGF siRNA-Thiol Nanoparticles

[0156] 239.7 mM thiol and 20 μM human VEGF siRNA were mixed in 90 μL of DEPC water, shaken at room temperature for 40 min, and then allowed to stand for 20 min. After centrifugation at 20,000 rpm for 30 min to remove excess thiol, the mixture was resuspended in 90 μL of DEPC water to obtain a human VEGF siRNA-thiol nanoparticle solution.

[0157] The potential of human VEGF siRNA-thiol nanoparticles was measured, and the resulting data analysis is illustrated in the figure below. Figure 15 See also Figure 15 Human VEGF siRNA and thiol were successfully assembled into spherical human VEGF siRNA-thiol nanoparticles in DEPC water. The particles exhibited negative charge in solution.

[0158] Experimental Example 13. Human VEGF siRNA-thiol nanoparticles inhibit cell proliferation

[0159] To verify that human VEGF siRNA-thiol nanoparticles can inhibit VEGF expression and affect cell proliferation and growth, this example uses A549 cells expressing VEGF as a model. Human VEGF siRNA-thiol nanoparticles were co-cultured with A549 cells, and the inhibition rate was measured using a CCK8 kit, verifying that human VEGF siRNA-thiol nanoparticles have a concentration-dependent inhibitory effect on A549 cell proliferation.

[0160] Specifically: A549 cells were inoculated into 96-well plates at a rate of 4000 cells / well and cultured for 24 hours. The original culture medium was then removed. Human VEGF siRNA-thiol nanoparticle solution was serially diluted to 1 μM, 0.8 μM, and 0.4 μM and added to the 96-well plates. The plates were cultured for 48 hours, and finally, CCK8 reagent was added and the plates were incubated for 2 hours. The optical density (OD) was measured at 450 nm and statistically analyzed. The inhibition rate data are summarized as follows: Figure 16 As shown.

[0161] from Figure 16It is evident that human VEGF siRNA-thiol nanoparticles can effectively inhibit cell growth, and the higher the concentration, the higher the inhibition rate. Human VEGF siRNA-thiol nanoparticles at a concentration of 0.8 μM can effectively inhibit cell growth.

[0162] The various specific embodiments described above and shown in the accompanying drawings are for illustrative purposes only and do not represent the entirety of the invention. Any modifications made by those skilled in the art within the scope of the basic technical concept of this invention are within the protection scope of this invention. sequence list <110> Suzhou Weiyi Biotechnology Co., Ltd. <120> Nanoparticles, their preparation and applications, and eye disease drugs containing them and their preparation <130> MP22011066 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 38 <212> RNA <213> Artificial Sequence <400> 1 cgaugaagcc cuggagugcg cacuccaggg cuucaucg 38 <210> 2 <211> 40 <212> RNA <213> Artificial Sequence <400> 2 cycgaugaag cccuggagug cgcacuccag ggcuucaucg 40 <210> 3 <211> 27 <212> RNA <213> Artificial Sequence <400> 3 cggaaucagu gaaugcuuau acauccg 27 <210> 4 <211> 27 <212> RNA <213> Artificial Sequence <400> 4 cggaaucagu gaaugcuuau acauccg 27 <210> 5 <211> 29 <212> RNA <213> Artificial Sequence <400> 5 cycggaauca gugaaugcuu auacauccg 29 <210> 6 <211> 38 <212> RNA <213> Artificial Sequence <400> 6 ggaguacccu gaugagaucg aucucaucag gguacucc 38

Claims

1. A nanoparticle, characterized in that, include: The ribonucleic acid (RNA) and thiols, wherein the RNA includes vascular endothelial growth factor small interfering RNA and vascular endothelial growth factor RNA aptamers, and the thiols have the following structural formula: The nanoparticles can be delivered to the fundus of the eye via non-invasive eye drops to treat fundus diseases.

2. The nanoparticles as described in claim 1, characterized in that, The nanoparticles exhibit negative charge in aqueous solution.

3. The nanoparticles as described in claim 1, characterized in that, The potential of the nanoparticles in aqueous solution is in the range of -5 mV to -30 mV.

4. The nanoparticles as described in claim 1, characterized in that, The nanoparticles are spherical.

5. The nanoparticles as described in claim 1, characterized in that, The particle size of the nanoparticles ranges from 50 nanometers to 200 nanometers.

6. The nanoparticles as described in claim 1, characterized in that, The base sequence of the ribonucleic acid includes: Justice chain 5'-3': CGAUGAAGCCCUGGAGUGCdTdT, Antisense chain 3'-5': GCACUCCAGGGCUUCAUCGdTdT; Justice chain 5'-3': Cy5-CGAUGAAGCCCUGGAGUGCdTdT, Antisense chain 3'-5': GCACUCCAGGGCUUCAUCGdTdT; 5'-3': CGGAAUCAGUGAAUGCUUAUACAUCCG; 5'-3':C GG AAUC AG The GAA The G CCU A The A C A UCC G ; 5'-3':Cy5-C GG AAUC AG The GAA The G CCU A The A C A UCC G ; Justice chain 5'-3': GGAGUACCCUGAUGAGAUCdTdT, Antisense chain 3'-5': GAUCUCAUCAGGGUACUCCdTdT; In the sequence, bold text indicates base modification at 2'F. italic font This represents the base modification 2'-Ome.

7. The nanoparticles as described in claim 1, characterized in that, The molar ratio of nitrogen in the thiol to phosphorus in the ribonucleic acid is in the range of 10-40.

8. The nanoparticles as described in claim 1, characterized in that, The molar ratio of nitrogen in the thiol to phosphorus in the ribonucleic acid is in the range of >15.

9. A method for preparing nanoparticles as described in any one of claims 1-8, characterized in that, include: The ribonucleic acid is mixed with the thiol to obtain the nanoparticles.

10. The method for preparing nanoparticles as described in claim 9, characterized in that, The ribonucleic acid and the thiol were mixed in nuclease-free water treated with diethyl pyrocarbonate (DEPC).

11. The method for preparing nanoparticles as described in claim 9, characterized in that, The thiol exhibits positive charge in aqueous solution.

12. The use of the nanoparticles as described in any one of claims 1 to 8 in the preparation of a medicament for treating fundus diseases, wherein the medicament for treating fundus diseases is suitable for ocular surface instillation.

13. A drug for treating fundus diseases, characterized in that, Including the nanoparticles as described in any one of claims 1-8, the medicament for treating fundus diseases is suitable for ocular surface instillation.

14. The medicament for treating fundus diseases as described in claim 13, characterized in that, It is an eye drop solution.

15. The medicament for treating fundus diseases as described in claim 13, characterized in that, Including artificial tears.

16. The medicament for treating fundus diseases as described in claim 13, characterized in that, pH range of 5.5 to 8.0, osmotic pressure range of 287 to 312 mmol / L.

17. The medicament for treating fundus diseases as described in claim 13, characterized in that, This includes sodium chloride, sodium bicarbonate, potassium chloride, and calcium chloride.

18. The medicament for treating fundus diseases as described in any one of claims 13-17, characterized in that, It is suitable for treating fundus diseases caused by cell proliferation, angiogenesis, and leakage.

19. A method for preparing a medicament for treating fundus diseases as described in any one of claims 13-18, characterized in that, Includes the following steps: Preparation of artificial tears; as well as The thiol and the ribonucleic acid, and / or the nanoparticles, are mixed with the artificial tears to obtain the drug for treating fundus diseases.

20. The method for preparing a medicament for treating fundus diseases as described in claim 19, characterized in that, The artificial tears were prepared by mixing sodium chloride, sodium bicarbonate, potassium chloride, calcium chloride, and nuclease-free water treated with diethyl pyrocarbonate.

21. The method for preparing a medicament for treating fundus diseases as described in claim 20, characterized in that, The calcium chloride is calcium chloride monohydrate powder.

Images