Bacillus mograbiae and application thereof

Abstract

The present application relates to the technical field of microorganism, and in particular to a bacillus mojavensis and application thereof.The bacillus mojavensis HNWQ05-1 provided by the present application is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.24971.The bacillus mojavensis HNWQ05-1 can play a sustained effect in plants, has a high-efficiency inhibitory effect on plant pathogenic bacteria, has a combined treatment effect on plant diseases such as real rot disease and scab disease, has a high prevention effect, has a yield-increasing and growth-promoting effect, has a good application prospect in plant disease control, and lays a foundation for developing a high-efficiency biocontrol agent.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more particularly to a strain of Bacillus moghavae and its applications. Background Technology

[0002] Plant disease control and yield promotion are crucial aspects of plant cultivation and key factors influencing plant yield and quality. In large-scale plant cultivation, these two aspects are particularly important. Taking fruit tree cultivation as an example, the cultivation process is relatively long, and the risk of disease is high. Inadequate disease control measures can easily lead to serious losses. While traditional chemical pesticides may achieve good results, they inevitably leave harmful residues, leading to a decline in fruit quality and safety. Biological control technologies for fruit tree diseases can effectively avoid these problems.

[0003] With the advancement of technology, biological control has become the preferred method for managing fruit tree diseases, playing a crucial role in their prevention and control. The natural world contains a vast array of microorganisms, making the development of beneficial microorganisms for biological control both practically valuable and significant. The main goal of using antagonistic microbial agents to replace chemical pesticides in disease control is to establish a green, environmentally friendly, pollution-free, and sustainable green production system that pursues higher economic benefits, and to gradually promote the application of this technology to various fruit trees and other economic crops.

[0004] As one of the oldest fruit trees in China, the peach tree has seen its cultivation scale expand continuously in recent years due to increasing demand. However, peach diseases such as peach fruit rot and peach scab have seriously hindered the development of the peach industry.

[0005] The pathogen of peach fruit rot is *Phomopsis amygdalina*, which primarily affects the fruit. After infection, the peach fruit begins to turn brown from the top, accompanied by water-soaked lesions, which then rapidly expand, turning the edges brown. The flesh in the infected area also turns black, softens, and has a fermented smell. In the early stages of infection, no mycelium is visible on the fruit; later, the fruit often loses water and shrivels, forming a mummified fruit covered with dense, grayish-white mycelium. The disease worsens as the fruit nears maturity, severely impacting yield and fruit quality. Besides peaches, this pathogen can also infect chestnuts, eggplants, tomatoes, and other fruits.

[0006] The pathogen of peach scab is *Venturia carpophila*. Peach scab primarily affects the fruit, but also leaves and twigs. When fruit is affected, symptoms often appear on the shoulder of the fruit. Initially, small, dark green, circular spots appear, which later enlarge into dark brown, mole-like lesions. In severe cases, the lesions coalesce, forming scab-like patches. The lesions are confined to the peel and do not penetrate the flesh. After the epidermal tissue dies, the infection continues to grow inside the fruit, causing cracks on the surface, but the cracks are shallow and small, and the fruit generally does not rot. Affected fruit stalks turn brown and dry out, often causing fruit drop. On leaves, irregular or polygonal grayish-green to purplish-red lesions appear on the underside of the leaves; these lesions later dry out and fall off, leaving perforations. On twigs, slightly raised, oblong, light brown to dark brown lesions appear, accompanied by gumming; the surface of the lesions may be densely covered with small black dots. Rainy and humid weather favors the spread of the disease. Because peach scab has a long incubation period, symptoms are fully exposed at harvest time in mid-to-late-maturing varieties, leading to severe disease. Besides peach trees, this pathogen can also infect stone fruit trees such as plum, apricot, and succulent.

[0007] Different biocontrol bacteria have varying antibacterial spectra, target pathogens, control efficacy, and persistence. Therefore, it is necessary to screen for biocontrol bacteria that effectively target these pathogens. Currently, there are no biocontrol bacteria in existing technologies that can efficiently inhibit *Phomopsisamygdalina*, *Venturia carpophila*, and their corresponding diseases. Therefore, screening for biocontrol bacteria that can effectively control these diseases is of great significance for crop disease control and yield improvement. Summary of the Invention

[0008] This invention provides a strain of Bacillus moghaves and its applications.

[0009] This invention isolated endophytic bacteria from peach trees for disease control and yield promotion. The bacteria were identified as *Bacillus mojavensis* and named *Bacillus mojavensis* HNWQ05-1. *Bacillus mojavensis* HNWQ05-1 effectively inhibits *Phomopsisamygdalina* and *Venturia carpophila*, demonstrating high efficacy against plant diseases caused by these pathogens. Simultaneously, *Bacillus mojavensis* HNWQ05-1 exhibits good effects in promoting plant growth, increasing yield, and improving quality.

[0010] Specifically, the present invention provides the following technical solutions:

[0011] This invention provides Bacillus mojavensis HNWQ05-1, which was deposited on May 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and is classified as Bacillus mojavensis, with accession number CGMCC No. 24971.

[0012] Bacillus mogarbhae HNWQ05-1 is a Gram-positive, aerobic bacterium with rod-shaped cells that appear pale yellow under a microscope. Its colonies are milky white with rounded, slightly transparent edges and a smooth, slightly raised surface. Bacillus mogarbhae HNWQ05-1 can grow in culture media containing conventional carbon and nitrogen sources (e.g., modified LB medium), with an optimal culture temperature of 23–32°C and a pH of 6.3–7.2.

[0013] The 16S rDNA gene sequence of Bacillus mojavensis HNWQ05-1 is shown in SEQ ID NO.1. The gyrA gene sequence of Bacillus mojavensis HNWQ05-1 is shown in SEQ ID NO.2. The phoPR gene sequence of Bacillus mojavensis HNWQ05-1 is shown in SEQ ID NO.3.

[0014] The present invention provides a microbial preparation comprising Bacillus moghaves HNWQ05-1.

[0015] The aforementioned microbial preparations may be solid or liquid formulations.

[0016] The aforementioned microbial preparations may also contain carriers or excipients permitted in the field of microbial preparations, including but not limited to freeze-drying protectants (such as glycerin), rice husk powder, peat moss, calcium carbonate, talc, attapulgite, diatomaceous earth, etc.

[0017] The present invention provides a biocontrol agent comprising Bacillus mogarbhae HNWQ05-1, or comprising one or more selected from Bacillus mogarbhae HNWQ05-1 fermentation supernatant and fermentation broth extract.

[0018] The active ingredients of the biocontrol agents described above may consist of one or more of Bacillus mogavus HNWQ05-1, its fermentation supernatant, and fermentation broth extract, or may contain other microorganisms, compounds, or plant extracts that have the effect of inhibiting plant pathogens.

[0019] The present invention provides a method for preparing the microbial preparation or biocontrol preparation, the method comprising the step of culturing the Bacillus moghaves at 23-32°C, pH 6.3-7.2 and under aeration conditions to obtain a live bacterial culture.

[0020] As one embodiment of the present invention, the preparation method of the microbial preparation or the biocontrol preparation includes the following steps:

[0021] (1) Activation of bacterial strain: Bacillus mogavus HNWQ05-1 was inoculated onto modified LB solid medium and streaked continuously at 27-30℃. Single colonies were picked and placed in modified LB liquid medium and cultured at 23-32℃ and 130-180 rpm for 36-48 h to obtain activated bacterial solution.

[0022] (2) Seed culture: In a fermenter containing seed culture medium, inoculate the activated bacterial solution obtained in step (1) at a volume ratio of 1:9, and culture at 23-32℃ and 130-180 rpm for 24-36 h to obtain liquid seed;

[0023] (3) Fermentation culture: Inoculate the liquid seed obtained in step (2) into the seed culture medium at an inoculation amount of 10-20% by volume, and culture it for 36-48 hours under aeration, at 23-32℃ and 130-180rpm on a shaker to obtain live bacterial culture.

[0024] The live bacterial culture obtained in step (3) above was adjusted to a bacterial count of 1.0 × 10⁻⁶. 10 ~2.0×10 10 The concentration of cfu / mL can be used to obtain a liquid bacterial agent, or excipients can be added to obtain a liquid bacterial agent.

[0025] The live bacterial culture obtained in step (3) above is added to a carrier, dispersant, wetting agent and protectant to obtain a wettable powder containing Bacillus moghaves HNWQ05-1.

[0026] The bacterial cells of the live bacterial culture obtained in step (3) were removed by centrifugation or filtration to obtain the fermentation supernatant of Bacillus mogavus HNWQ05-1.

[0027] This invention demonstrates through experiments that *Bacillus mogarfianus* HNWQ05-1 exhibits highly effective inhibitory effects against plant pathogens such as *Pseudomonas amygdalis* and *Aureobasidium falciparum*, and provides significant control over plant diseases caused by these pathogens (e.g., peach fruit rot and scab). Simultaneously, it shows significant growth-promoting, yield-increasing, and quality-improving effects on plants.

[0028] Based on the above functions, the present invention provides the following applications of Bacillus moghaves HNWQ05-1:

[0029] The present invention provides the application of the Bacillus moghaves HNWQ05-1 or the microbial preparation or the biocontrol preparation in inhibiting plant pathogens.

[0030] Preferably, the plant pathogen is *Phomopsis amygdalina* and / or *Venturia carpophila*.

[0031] This invention provides the application of the Bacillus moghaves HNWQ05-1, the microbial preparation, or the biocontrol agent in the prevention and control of plant diseases.

[0032] The plant diseases mentioned include fruit tree diseases.

[0033] Preferably, the plant disease is peach fruit rot and / or scab, or the plant disease is a plant disease other than peach fruit rot and scab caused by infection with *Phomopsis amygdalina* and / or *Venturia carpophila*.

[0034] This invention provides the application of the Bacillus moghaves HNWQ05-1 or the microbial preparation or the biocontrol preparation in promoting plant growth, increasing plant yield and / or improving the quality of plant fruits.

[0035] This invention provides the application of the Bacillus moghaves HNWQ05-1 or the microbial preparation in the selection and breeding of agricultural microorganisms.

[0036] The agricultural microorganisms mentioned above include agricultural microorganisms that have one or more functions such as plant disease prevention and control, growth promotion, yield increase and fruit quality improvement.

[0037] The above applications can be used to select agricultural microorganisms from Bacillus mogavus HNWQ05-1 through mutagenesis, genetic modification, and other methods.

[0038] This invention provides the application of the Bacillus moghaves HNWQ05-1 or the microbial preparation in the preparation of agricultural formulations.

[0039] Preferably, the agricultural preparation has one or more functions selected from plant disease control, growth promotion, yield increase, and fruit quality improvement.

[0040] The above-mentioned agricultural formulations can be prepared using one or more of the following: bacterial cells, bacterial powder, bacterial suspension, fermentation supernatant, and fermentation broth extract of Bacillus mogavus HNWQ05-1.

[0041] This invention provides a method for preventing and controlling plant diseases, promoting plant growth, increasing plant yield, and / or improving the quality of plant fruits. The method includes applying the Bacillus moghaves HNWQ05-1 or the microbial preparation or the biocontrol preparation to the plant.

[0042] Preferably, the application method includes spraying, hole application, etc.

[0043] Preferably, when applying by spraying, the dosage of Bacillus moghaves HNWQ05-1 is 1.0 × 10⁻⁶ per plant. 10 CFU ~ 2.5 × 10 10 When applying CFU, the dosage of Bacillus moghavae HNWQ05-1 is 1.2 × 10⁻⁶ per plant. 10 CFU ~ 4.0 × 10 10 CFU.

[0044] Specifically, when used for disease control, when plant diseases are sporadic, a concentration of 10 is applied. 6 ~10 7 Spray with a CFU / mL solution of Bacillus moghavae HNWQ05-1 at a rate of 100–150 L / mu. For increasing yield and strengthening seedlings, apply 1.2 × 10⁶ CFU / mL per plant during the spring leaf expansion stage. 10 ~4.0×10 10 CFU-containing Bacillus moghavae HNWQ05-1 was mixed with soil and applied to the hole at a depth of 25-30 cm.

[0045] The plants described in this invention are dicotyledonous or monocotyledonous plants, including but not limited to drupe plants, such as peach, apricot, plum, cherry, blueberry, kiwi, hawthorn, apple, pear, grape, papaya, jujube, tomato, cucumber, eggplant, pumpkin, potato, tobacco, cabbage, Arabidopsis thaliana, etc.

[0046] Preferably, the plant is a peach.

[0047] The Bacillus moghavae HNWQ05-1 provided by this invention has at least the following beneficial effects:

[0048] (1) It can effectively inhibit plant pathogens: Bacillus moghaves HNWQ05-1 has excellent inhibitory effects on plant pathogens such as Pseudomonas amygdalis and Acer tumefaciens, with an inhibition rate of up to 93.42% to 95.77%.

[0049] (2) It has both therapeutic and preventive effects on plant diseases: Bacillus moghaves HNWQ05-1 has a high preventive effect on plant diseases such as peach fruit rot and scab caused by Pseudomonas aeruginosa and Pseudomonas thunbergii, with an average preventive effect of over 90.0%.

[0050] (3) Bacillus moghaves HNWQ05-1 can stably colonize plant plants, has strong survival ability in plant plants, and plays a sustained effect in plants.

[0051] (4) Bacillus moghaves HNWQ05-1 has a good effect on increasing yield, promoting growth and improving fruit quality in plants;

[0052] (5) Using Bacillus moghaves HNWQ05-1 to control plant diseases is less likely to produce drug resistance, has good long-lasting efficacy, and is safe for humans and animals and will not cause environmental pollution.

[0053] (6) The preparation method of Bacillus moghaves HNWQ05-1 bacterial agent and biocontrol agent is simple, low in cost and easy to use.

[0054] In conclusion, Bacillus mogarbhae HNWQ05-1 shows great promise for plant disease control and yield promotion, providing new strain resources for biological control of plant diseases and laying the foundation for the development of highly efficient and broad-spectrum biocontrol agents. Attached Figure Description

[0055] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0056] Figure 1 This image shows the morphological observation of freshly prepared sections of Bacillus moghaves HNWQ05-1 in liquid culture under an electron microscope in Example 1 of this invention.

[0057] Figure 2 This is an electrophoresis diagram of the PCR amplification products of 16S rDNA, gyrA and phoPR genes of Bacillus mogava HNWQ05-1 in Example 1 of the present invention. The left diagram is a schematic diagram of the DNA marker band size, and the right diagram is an electrophoresis diagram of the PCR amplification products of 16S rDNA, gyrA and phoPR genes. Lane 1 is the amplification product of 16S rDNA, lane 2 is the amplification product of gyrA gene, lane 3 is the amplification product of phoPR gene, and M is the DNA marker.

[0058] Figure 3 This is a phylogenetic tree of Bacillus moghaves strain HNWQ05-1 obtained from the 16S rDNA sequence in Example 1 of the present invention.

[0059] Figure 4This is a phylogenetic tree of Bacillus moghavae HNWQ05-1 strain obtained from the gyrA gene sequence in Example 1 of the present invention.

[0060] Figure 5 This is a phylogenetic tree of Bacillus moghavae HNWQ05-1 strain obtained from the phoPR gene sequence in Example 1 of the present invention.

[0061] Figure 6 The effect of ultraviolet irradiation on the antibacterial activity of the fermentation broth of strain HNWQ05-1 in Example 7 of the present invention is shown. The significant difference is compared between the antibacterial rates of the fermentation broth of the strain against the same pathogen. Detailed Implementation

[0062] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0063] Unless otherwise specified, all percentages in the following examples are by weight.

[0064] The specific culture medium formulations involved in the following examples are as follows:

[0065] Modified LB solid medium (strain preservation medium): 5.0g peptone, 3.0g beef extract, 5.0g sodium chloride, 15.0g agar, 5mg MnSO4·H2O, pH 7.0, add water to 1L, pH 6.5-7.5.

[0066] Modified LB broth (bacterial activation medium): 5.0g peptone, 3.0g beef extract, 5.0g sodium chloride, 5mg MnSO4·H2O, add water to 1L, pH 6.3-7.2.

[0067] Seed culture medium (liquid, 1L): K2HPO4 4.8g, KH2PO4 3.5g, (NH4)2SO4 2g, MgCl2 0.16g, CaCl2 0.02g, Na2MoO4·2H2O 0.0024g, FeCl3 0.0018g, MnCl2·2H2O 0.0015g, sodium chloride 10g, pH 7.0.

[0068] All the above culture media were sterilized at 121℃ for 15–30 min.

[0069] Modified LB plates: Prepare 100 mL of the above modified LB solid medium. After autoclaving, place the melted LB solid medium in a 55°C water bath. When the medium temperature drops to 55°C, pour the plates into a sterile petri dish and add 10 mL of LB solid medium. Open the lid and irradiate under a UV lamp for 10-15 minutes. After cooling, seal with sealing film and invert in a 4°C refrigerator for later use.

[0070] PDA plates: Peel 200g of potatoes, cut them into small pieces, put them in a pot, add 1000mL of water, heat to a boil and continue for 20-30 minutes. Filter through 4 layers of gauze while hot to remove residue, add 20g of agar powder, wait for the agar to dissolve, add 20g of glucose, add water to make up to 1000mL, sterilize at 121℃ for 15-30 minutes, remove and cool to 55℃, pour 10mL of culture medium into a sterilized petri dish, open the lid, irradiate under a UV lamp for 10-15 minutes, cool, seal with sealing film and invert and store in a 4℃ refrigerator for later use.

[0071] MEA plates: 30g malt extract powder, 3g soybean peptone, filter through 8 layers of gauze, add 20g agar powder, wait for the agar to dissolve, bring the volume to 1000mL with deionized water, autoclave at 121℃ for 20min, remove and cool to 55℃, pour 10mL of culture medium into each sterilized petri dish, open the lid, irradiate under UV light for 10-15min, cool, seal with sealing film and invert and store in a 4℃ refrigerator for later use.

[0072] The pathogenic fungal strains used in the following examples are: *Phomopsisamygdalina* (strain number: ACCC 37078), purchased from the China Agricultural Microbiological Culture Collection Center; and *Venturia carpophila* (Cytological observation of the infectious process of *Venturia carpophila* on peach leaves, Yang Zhou et al., *Plant Disease*, 2022, 106:79-86.), provided by Huazhong Agricultural University.

[0073] The peach varieties used in the following examples are Ying Shuang Hong (susceptible to fruit rot) and Zhongyou No. 7 (susceptible to scab), both of which came from the Mancheng District Nursery in Baoding City, Hebei Province.

[0074] Example 1: Obtaining and identifying Bacillus moghaves HNWQ05-1

[0075] 1. Screening and isolation of Bacillus moghaves strain HNWQ05-1

[0076] (1) Sample collection: Fresh leaves of peach trees from Hebei Meisongyuan Agricultural Development Co., Ltd. were collected. The dust on the surface of the leaves was washed off with sterile water. Then the leaves were disinfected by soaking in 75% alcohol for 1 minute and then soaking in 8% NaClO for 4 minutes. The leaves were washed with sterile water 4 times.

[0077] (2) Separation and screening: Cut the leaves into 1cm×1cm fragments, add water and grind into a paste, let stand for 10 minutes and then spread on the modified LB plate, and place them at 28℃ for 48h.

[0078] (3) Purification: After the culture has grown, the plate streak separation method is used for purification. The colonies are picked and streaked on the enrichment medium until pure culture is obtained.

[0079] Using peach fruit rot and scab as targets, biocontrol bacteria were screened through plate confrontation and field plot experiments. Finally, a strain with good control effects against peach fruit rot and scab caused by *Pseudomonas aeruginosa* and *Aureobasidium cirrhifolium* was selected and named strain HNWQ05-1.

[0080] 2. Classification and identification of strain HNWQ05-1

[0081] (1) Morphological characteristics identification

[0082] Strain HNWQ05-1 cultured on modified LB medium resulted in rod-shaped cells. Figure 1 This strain is Gram-positive, aerobic, and appears pale yellow under a microscope. Its colonies are milky white with rounded, slightly transparent edges and a smooth, slightly raised surface. When streaked on nutrient agar slants, it forms a straight line. In liquid culture, it remains opaque and milky white. These morphological characteristics are largely consistent with those described in the *Handbook of Systematic Identification of Common Bacteria* (edited by Dong Xiuzhu et al., Science Press, 2001), leading to the preliminary conclusion that strain HNWQ05-1 belongs to the *Bacillus* genus.

[0083] (2) Identification and classification using 16S rDNA sequences

[0084] Using genomic DNA from HNWQ05-1 as a template, PCR amplification was performed using universal primers F27 and R1492 to obtain the PCR amplification products. The sequences of primers F27 and R1492 are as follows:

[0085] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO. 4);

[0086] R1492: 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO. 5).

[0087] The PCR reaction system (20 μL) for 16S rDNA amplification was as follows: 2.0 μL of 10×Ex Taq buffer; 0.2 μL of 5U Ex Taq; 1.6 μL of 2.5 mM dNTP Mix; 1 μL of 27F; 1 μL of 1492R; 0.5 μL of HNWQ05-1 genomic DNA; and ddH2O to a final volume of 20 μL.

[0088] The PCR reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1.5 min, 25 cycles; 72℃ for 10 min. The obtained PCR amplification products were subjected to gel electrophoresis and sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing to obtain the 16S rDNA sequence of HNWQ05-1 (as shown in SEQ ID NO.1).

[0089] The electrophoretic detection results of PCR amplification products are as follows: Figure 2 As shown.

[0090] A phylogenetic tree was constructed using the 16S rDNA sequence of strain HNWQ05-1 via MEGA software (Molecular Evolutionary Genetics Analysis). The phylogenetic analysis diagram is shown below. Figure 3 As shown, the 16S rDNA gene sequence of the strain was compared with that of the registered bacterial strain using the BLAST program on the Genbank website (http: / / www.ncbi.nlm.nih.gov / ). The results showed that the 16S rDNA of this strain had the highest similarity with Bacillus mojavensis, reaching more than 97.5%.

[0091] (3) Identification and classification based on gyrA gene sequence

[0092] Using the genomic DNA of strain HNWQ05-1 as a template, PCR amplification was performed using the degenerate primers gyrA-F and gyrA-R of the Bacillus gyrA gene. The PCR amplification products were obtained, and the sequences of the primers gyrA-F and gyrA-R are as follows:

[0093] gyrA-F:5'-ATGAGCGATCTGGCCAGAGA-3' (SEQ ID NO.6);

[0094] gyrA-R: 5'-CGCGCCTTGTTCACCTGATA-3' (SEQ ID NO. 7).

[0095] The PCR reaction system (50 μL) for gyrA amplification was: 10×PCR Buffer (Mg 2+ 5 μL of dNTP mixture (2.5 mM); 5 μL of Taq (5 U / μL); 1 μL of gyrA-F (10 μmol / L); 1 μL of gyrA-R (10 μmol / L); 50 ng of HNWQ05-1 genomic DNA; and ddH2O to bring the total volume to 50 μL.

[0096] The PCR reaction conditions were 94℃ for 5 min; 94℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, for 30 cycles; and 72℃ for 7 min.

[0097] The amplified product was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, yielding the gyrA gene sequence of strain HNWQ05-1 (as shown in SEQ ID NO.2). Homology comparison of the obtained gyrA gene sequence of strain HNWQ05-1 in GenBank showed that the gyrA gene sequence of HNWQ05-1 had the highest homology (96.1%) with that of Bacillus mojavensis. Simultaneously, a phylogenetic tree of the gyrA gene was constructed using MEGA software (Molecular Evolutionary Genetics Analysis). Figure 4 The results showed that strain HNWQ05-1 aggregated with Bacillus mojavensis, indicating that strain HNWQ05-1 is Bacillus mojavensis.

[0098] (4) Identification and classification based on phoPR gene sequence

[0099] Using the genomic DNA of strain HNWQ05-1 as a template, PCR amplification was performed using the degenerate primers phoPR-F and phoPR-R of the Bacillus phoPR gene. The PCR amplification products were obtained, and the sequences of the phoPR-F and phoPR-R primers are as follows:

[0100] phoPRF:5'-GG(G / C / T / A)TA(T / C)AAA(A / T / C / G)A(G / A)GAGGAGCC-3'(SEQ IDNO.8);

[0101] phoPR-R:5'-TT(C / T)A(G / A)(C / T)TCATG(A / G)GA(A / C / G)ACATT-3' (SEQ ID NO. 9). The PCR reaction system (50 μL) for phoPR amplification was: 10×Buffer (Mg 2+ 5 μL; dNTPs 8 μL; phoPR-F 1 μL; phoPR-R 1 μL; HNWQ05-1 genomic DNA (approximately 10 ng) 1 μL; rTaq DNA polymerase 1 μL; ddH2O 33 μL.

[0102] The PCR reaction conditions were 95℃ for 5 min; 94℃ for 45 s, 48℃ for 45 s, 72℃ for 1 min, for 35 cycles; and 72℃ for 10 min.

[0103] The amplified products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, yielding the phoPR gene sequence of strain HNWQ05-1 (as shown in SEQ ID NO.3). Homology comparison of the obtained phoPR gene sequence of strain HNWQ05-1 was performed in GenBank, revealing the highest homology (96.7%) with the phoPR gene sequence of Bacillus mojavensis. Simultaneously, a phylogenetic tree of the phoPR gene was constructed using MEGA software (Molecular Evolutionary Genetics Analysis). Figure 5 The results showed that strain HNWQ05-1 aggregated with Bacillus mojavensis, indicating that strain HNWQ05-1 is Bacillus mojavensis.

[0104] Based on the above morphological characteristics and the results of homology comparison analysis of 16S rDNA, gyrA and phoPR gene sequences, it can be concluded that HNWQ05-1 belongs to Bacillus mojavensis and is different from existing Bacillus mojavensis strains, making it a new Bacillus mojavensis strain.

[0105] Bacillus mojavensis HNWQ05-1 was deposited on May 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and classified as Bacillus mojavensis, with accession number CGMCC No. 24971.

[0106] Example 2: Preparation of bacterial suspension and inoculum of Bacillus mogavus HNWQ05-1

[0107] The preparation methods for Bacillus moghaves HNWQ05-1 bacterial suspension and inoculum include the following steps:

[0108] (1) Activation of strain: Bacillus moghaves HNWQ05-1 was picked into the strain preservation medium, streaked continuously at 28℃, and single colonies were cultured twice. Then, single colonies were picked into the strain activation medium and cultured at 30℃ and 160r / min for 40h.

[0109] (2) Liquid seed preparation: The HNWQ05-1 activated bacterial solution obtained in step (1) was inoculated into a fermenter containing high-temperature sterilized seed culture medium at an inoculation rate of 10% (V / V), and cultured at 28°C with air for 30 h to obtain liquid seed.

[0110] (3) Liquid fermentation: Liquid seeds were inoculated into a seed culture medium that had been sterilized at high temperature at an inoculation rate of 10% by volume, and cultured at 30℃ and 160r / min for 40h (logarithmic growth phase) to obtain live bacterial culture.

[0111] (4) Preparation of bacterial agent: Centrifuge the live bacterial culture at 4℃ and 5000r / min for 15min, take the bacterial pellet and wash it 3 times with 0.85% sterile physiological saline, add an appropriate amount of seed culture medium to adjust the bacterial content to 10. 10 The HNWQ05-1 bacterial culture was obtained by adding cfu / mL; glycerol (50% by volume) was added, and the culture was bottled and stored.

[0112] Example 3: Antibacterial effect of Bacillus mogavus HNWQ05-1

[0113] This embodiment analyzes the inhibitory effect of Bacillus mogavus HNWQ05-1 on Prunus syringae stem-point mold and Prunus cerevisiae in peaches. The specific method is as follows:

[0114] (1) Prunus syringae and Prunus cerevisiae, the pathogens of peaches, were inoculated onto PDA and MEA plates, respectively. Prunus syringae was cultured at 25℃ and Prunus cerevisiae at 21℃. After the cultured fungi reached two-thirds of the plate's height, mycelial cakes were made using a 5mm diameter punch. The mycelial cakes were then inoculated into the center of the PDA and MEA plates, respectively. At the same time, HNWQ05-1 bacterial suspension (concentration 10) was inoculated at the four corner points about 30mm from the center. 8 The above treatment was used as the experimental group (cfu / mL, 20μL), and the plate inoculated only with pathogenic fungi was used as the control group. Each treatment was set up in 3 replicates.

[0115] (2) Place the PDA and MEA plates after inoculation in each treatment in step (1) in a suitable temperature environment for the corresponding pathogens in (1) and culture them. When the colonies of the pathogens of the control group are almost fully covered by the fungi, the diameter of the pathogens of each treatment is measured and the inhibition rate is calculated according to the following formula: Inhibition rate (%) = [(AB) / (A-5)] × 100%, where A is the diameter of the pathogens of the control group and B is the diameter of the pathogens of the experimental group.

[0116] (3) Results of antibacterial experiment: The results are shown in Table 1. The antibacterial rate of strain HNWQ05-1 against Pseudomonas aeruginosa and Pseudomonas flavovirens were 93.42% and 95.77%, respectively, indicating that Bacillus mogarf has a good inhibitory effect on the above-mentioned major pathogens of peach.

[0117] Table 1. Antibacterial effects of strain HNWQ05-1 against *Pseudomonas amygdalinus* and *Neisseria flavescens*.

[0118]

[0119] Note: The experimental results in Table 1 are the average of three replicates.

[0120] Example 4: Field trial of Bacillus moghaves HNWQ05-1 for the control of peach fruit rot and scab.

[0121] This embodiment provides a small-plot field trial of Bacillus mogarfianus HNWQ05-1 for the control of fruit rot caused by Pseudomonas moniliforme and scab disease caused by Agromyces citrinum in almonds. The specific methods are as follows:

[0122] (1) The treatment was conducted in 2021 and 2022 at a nursery in Mancheng District, Baoding City, Hebei Province. The number of applications was determined based on the occurrence and severity of the diseases and climatic conditions. The peach varieties used were Ying Shuang Hong (susceptible to fruit rot) and Zhongyou No. 7 (susceptible to scab), with tree ages of 4-5 years and 5-6 years, respectively. The row spacing was 2.5 meters and the plant spacing was 2.0 meters. The trees were of moderate vigor and had experienced the corresponding diseases in previous years. The pesticide was applied 15 days after the peach trees finished flowering, with an interval of 10-14 days. Conventional chemical agents and water were used as controls. The pesticide was sprayed 3 times, with 4 replicates for each treatment. The trees were randomly arranged, with 20 peach trees per plot. Treatment: A: Microbial agent group (HNWQ05-1): The liquid Bacillus moghavae HNWQ05-1 prepared in Example 2 was diluted with water 2000 times to a bacterial concentration of 5×10⁻⁶. 6 CFU / mL; B: Chemical fungicide group (difenoconazole): 10% difenoconazole water-dispersible granules (Shigao) diluted 1000 times with water; C: Blank control group: water. Taishan-18 motorized high-pressure sprayer was used for uniform spraying, ensuring the fruit was moistened with slight dripping of pesticide, with an average of 2.5L of solution per plant. Disease incidence was investigated during fruit harvest. Ten sampling points were collected in each plot, oriented towards the southeast, northwest, and center. Twenty fruits were taken from each point and graded according to the percentage of diseased area covering the entire fruit area. Grading method: Grade 0: No disease; Grade 1: Diseased area less than 10% of the entire fruit area; Grade 3: Diseased area 11%–25% of the entire fruit area; Grade 5: Diseased area 26%–40% of the entire fruit area; Grade 7: Diseased area 41%–65% of the entire fruit area; Grade 9: Diseased area more than 65% of the entire fruit area. Based on the survey results, the disease severity index and prevention efficacy were calculated. Disease severity index = [(number of diseased fruits × relative grade) / (total number of surveyed fruits × highest grade)] × 100; Prevention efficacy (%) = [(control disease severity index - treatment disease severity index) / control disease severity index] × 100.

[0123] (2) Results of peach fruit rot control: The results are shown in Table 2. The control efficacy of Bacillus mogarbhae HNWQ05-1 against peach fruit rot was 92.84%, which was higher than that of the chemical fungicide difenoconazole. This indicates that Bacillus mogarbhae HNWQ05-1 and its microbial agents have a good control effect on peach fruit rot.

[0124] (3) Results of peach scab control: The results are shown in Table 2. The control efficacy of Bacillus mogavus HNWQ05-1 against peach scab was 91.94%, which was higher than that of the chemical fungicide difenoconazole. This indicates that Bacillus mogavus HNWQ05-1 and its microbial agents have a good control effect on peach scab.

[0125] Table 2. Results of field trials of strain HNWQ05-1 for the control of peach fruit rot and scab.

[0126]

[0127]

[0128] Note: The experimental results in Table 2 are the average of 4 replicates (2 years); data with different letters on the top label are significantly different.

[0129] Example 5: Field plot experiment on the yield-increasing and growth-promoting effects of Bacillus moghaves HNWQ05-1 on peaches.

[0130] This embodiment provides a plot-based field trial of the yield-increasing and growth-promoting effects of Bacillus moghaves HNWQ05-1 on peaches. The specific methods are as follows:

[0131] (1) The experiment was conducted in 2021 and 2022 at a nursery in Mancheng District, Baoding City, Hebei Province. One application of the pesticide was made during the spring leaf expansion period of the peach trees, followed by another application every 15-20 days, for a total of three applications. The peach varieties were Ying Shuang Hong and Zhongyou No. 7, with tree ages of 4-5 years and 5-6 years respectively. The row spacing was 2.5 meters, the plant spacing was 2.0 meters, and the tree vigor was moderate. A water control was also included. Each treatment was replicated four times, randomly arranged, with 20 peach trees per plot. Treatment: A: Microbial inoculant group (HNWQ05-1): 1.2 × 10⁻⁶ Bacillus moghavae HNWQ05-1 prepared in Example 2 per tree. 10 One kilogram of CFU was mixed with soil and applied in holes at a depth of 25-30 cm around the base of the peach tree; B: blank control group: water. During the fruit harvest period, the biomass of leaves, shoots, and fruits was investigated. Five trees were selected for each treatment. Healthy leaves from the 3rd to 4th from the top of the current year's spring shoots in the four directions of east, south, west, and north on the outer side of the crown were collected. Twenty leaves were collected from each tree, and the leaves from the five trees were mixed into one sample, with three replicates per sample. Fruits were collected using the same method as leaves, and the standard for fruit collection was healthy fruits of similar size.

[0132] (2) Results of the effects of Bacillus mogarbhae HNWQ05-1 on peach growth and development: The results are shown in Table 3. Bacillus mogarbhae HNWQ05-1 promoted the growth of peach leaves and new shoots by 5.83% to 15.70%, increased fruit yield by 2.80% to 2.97%, and increased the soluble solids content by 5.51% to 12.03%. This indicates that Bacillus mogarbhae HNWQ05-1 has a good effect on increasing peach yield, promoting growth, and improving fruit quality.

[0133] Table 3. Results of a small-plot field trial showing the yield-increasing and growth-promoting effects of strain HNWQ05-1 applied in holes on peaches.

[0134]

[0135] Note: The experimental results in Table 3 are the average of four replicates (2 years).

[0136] Example 6: Detection of the colonization ability of Bacillus mogavus HNWQ05-1 in peach trees

[0137] This embodiment detects the gene copy number of Bacillus mogarfii HNWQ05-1 colonizing peach tree leaves and roots when applied by spraying and hole application, respectively. The specific method is as follows:

[0138] The peach cultivar "Yingshuanghong" was selected. Samples were taken from the leaves of peach trees 24-168 hours after the last application of Bacillus mogarf. mogarf. HNWQ05-1 in the spray application experiment of Example 4, and from the roots of peach trees 7-30 days after the last application of Bacillus mogarf. mogarf. HNWQ05-1 in the hole application experiment of Example 5, at different time points. The leaves and roots underwent surface disinfection treatment: rinsing with 75% alcohol for 1 min, soaking in 1% sodium hypochlorite for 2 min, and then rinsing four times with sterile water. 100 μL of the final sterile water rinse solution was spread on modified LB medium and incubated at 30℃ for 24 h to test the disinfection effect and observe for the presence of contaminating bacteria under a microscope. After drying the surface water, the mixture was ground into a paste with 2 mL of sterile water and allowed to stand for 15 min to fully release the Bacillus mogarf. mogarf. mogarf. The paste was then placed in centrifuge tubes, and genomic DNA was extracted using the Bacterial DNA Kit D3350-02.

[0139] Quantitative real-time PCR analysis was performed using primers as follows: 16SPO: AAGAGTTTGATCCTGGCTCAG (SEQ ID NO.10); 16SP6: CTACGGCTACCTTGTTACGA (SEQ ID NO.11) (Antifungal activity and bioactive compounds produced by Bacillus mojavensis and Bacillus subtilis, Mountain YOUCEF-ALI et al., African Journal of Microbiology Research, 2014, 8(6):476-484.). Gene cloning, screening, and plasmid extraction were all performed in accordance with the guidelines for molecular cloning experiments (MR. Green and J. Sambrook, Science Press, 2017). The quantitative real-time PCR amplification reaction system (20 μL) was as follows: SYBR Premix ExTaq™ (2×) (TaKaRa) 10 μL, ROX Reference Dye (50×) 0.4 μL, forward and reverse primers 0.4 μL each, DNA template 2 μL, and double-distilled water 6.8 μL. The reaction procedure was as follows: 95℃ for 30s, 95℃ for 5s, 60℃ for 30s, 72℃ for 30s, for 40 cycles. The melting curve procedure was: 95℃ for 15s, 60℃ for 1min, 95℃ for 15s. Different sample DNA was used as amplification templates, and amplification reactions were performed according to the above-described quantitative PCR reaction system and procedure. After the reaction, the amplification curve and melting curve were confirmed, and the CT value for each sample was recorded. The CT value was then substituted into the standard curve equation to calculate the initial gene copy number of the sample template, and finally, the gene copy number per gram of leaf / root was calculated.

[0140] The results of quantitative fluorescence analysis of Bacillus moghaves HNWQ05-1 under different application methods are shown in Table 4. The results indicate that Bacillus moghaves HNWQ05-1 exhibits strong proliferation ability under different application methods, with the highest gene copy number in leaves reaching 5919.36 × 10⁻⁶ during spraying. 4 Copy g －1 The highest gene copy number in the root during acupuncture was 6304.24 × 10⁻⁶. 4 Copy g －1 The colonization and proliferation of Bacillus mogarbhae HNWQ05-1 reduced the space occupied by pathogens in leaves and roots, thus giving full play to the spatial competitive role of Bacillus mogarbhae HNWQ05-1.

[0141] Table 4. Detection of 16S rDNA copy number of Bacillus moghavus HNWQ05-1 colonized in leaves and roots by real-time PCR.

[0142]

[0143]

[0144] Note: The experimental results in Table 4 are the average of four replicates; ± represents the standard deviation of four replicates; data with different letters on the top label are significantly different.

[0145] Example 7: Detection of UV radiation stability of Bacillus moghaves HNWQ05-1

[0146] In this embodiment, the UV radiation stability of Bacillus moghaves HNWQ05-1 was determined. 10 mL of HNWQ05-1 fermentation broth was placed in 7 test tubes and vertically placed at 20 cm under an 18W UV lamp for 12 h. Samples were taken every 2 h to prepare plates for testing antibacterial activity (the methods for testing and investigating antibacterial activity were the same as in Example 3). The control group was not treated with UV irradiation. Each treatment was repeated in 3 replicates.

[0147] The results are as follows Figure 6 As shown, the fermentation broth of strain HNWQ05-1 still exhibited high antibacterial activity against *Pseudomonas aeruginosa* and *Aureobasidium spp.* after irradiation with ultraviolet light for different durations. While the antibacterial activity decreased slightly with increasing time, the inhibition rate remained above 90% after 12 hours of ultraviolet radiation. The difference in inhibition rate was within 2%, with no significant difference (P>0.05), indicating that the antibacterial active substances of strain HNWQ05-1 are highly stable under ultraviolet light irradiation.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Bacillus moghaves ( Bacillus mojavensis HNWQ05-1, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 24971.

2. A microbial preparation, characterized in that, The microbial preparation comprises Bacillus moghaves as described in claim 1. Bacillus mojavensis HNWQ05-1.

3. The method for preparing the microbial preparation according to claim 2, characterized in that, The method includes processing the Bacillus moghaves (Bacillus moghaves) Bacillus mojavensis The steps to obtain live bacterial cultures are carried out at 23~32℃, pH 6.3~7.2 and under aeration conditions.

4. A biocontrol agent, characterized in that, The biocontrol agent comprises Bacillus moghaves as described in claim 1. Bacillus mojavensis HNWQ05-1.

5. The Bacillus moghaves as described in claim 1 ( Bacillus mojavensis The application of HNWQ05-1 or the microbial preparation of claim 2 or the biocontrol preparation of claim 4 in inhibiting plant pathogens; The plant pathogen is *Pseudomonas alpina* (a type of fungus). Phomopsis amygdalina ) and / or fruit-loving black spot ( Venturia carpophila ).

6. The Bacillus moghaves as described in claim 1 ( Bacillus mojavensis The application of HNWQ05-1 or the microbial preparation of claim 2 or the biocontrol preparation of claim 4 in the control of plant diseases; The plant disease is peach fruit rot and / or scab, or, the plant disease is caused by *Pseudomonas auricula-judae*, other than peach fruit rot and scab. Phomopsis amygdalina ) and / or fruit-loving black spot ( Venturia carpophila Plant diseases caused by infection.

7. The Bacillus moghaves as described in claim 1 ( Bacillus mojavensis The application of HNWQ05-1 or the microbial preparation of claim 2 or the biocontrol preparation of claim 4 in promoting plant growth, increasing plant yield and / or improving the quality of plant fruits; The plant in question is a peach.

8. The Bacillus moghaves as described in claim 1 ( Bacillus mojavensis The application of the microbial preparation described in HNWQ05-1 or claim 2 in the breeding of agricultural microorganisms.

9. The Bacillus moghaves as described in claim 1 ( Bacillus mojavensis The application of the microbial preparation described in HNWQ05-1 or claim 2 in the preparation of agricultural formulations.

10. A method for preventing and controlling plant diseases, promoting plant growth, increasing plant yield, and / or improving the quality of plant fruits, characterized in that, The method includes: dispensing the Bacillus moghaves (as described in claim 1) Bacillus mojavensis The microbial preparation of claim 2 or the biocontrol preparation of claim 4 is applied to the plant; The plant in question is a peach.

Images