An indel molecular marker linked with peanut kernel weight qtl qhkwa05 and application thereof
By developing an INDEL molecular marker linked to the peanut kernel weight QTL qHKWA05 and using PCR for genotyping, the accuracy and efficiency issues of peanut kernel weight detection were solved, achieving efficient breeding improvement, reducing costs, and accelerating the breeding process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-25
- Publication Date
- 2026-03-03
AI Technical Summary
Molecular markers for peanut kernel weight are scarce. Breeding relies on phenotypic observation, which is greatly affected by the environment, resulting in high costs and long cycles. The complexity of the peanut genome makes molecular marker development difficult, and the low density of genetic maps makes it difficult to effectively improve kernel weight.
We developed an INDEL molecular marker linked to the peanut kernel weight QTL qHKWA05, and used PCR to identify the genotype. PCR was performed using specific amplification primers qHKWA05F and qHKWA05R. Combined with a high-density SNP genetic map, the kernel was located on chromosome Arahy05. Specific amplification PCR primers were designed to achieve rapid and accurate kernel weight detection.
It improves the accuracy and efficiency of kernel weight detection, reduces breeding costs, shortens the breeding cycle, and increases peanut breeding efficiency, thus accelerating the process of breeding high-yield and processing-specific new peanut varieties.
Smart Images

Figure CN117106961B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, specifically to an INDEL molecular marker linked to the QTL qHKWA05 of peanut kernels and its application. Background Technology
[0002] Peanuts are an important oilseed and cash crop in my country. Peanut kernels are rich in protein and oil, and are widely used for fresh consumption, oil extraction, and food processing. my country has the world's largest peanut planting area, but its yield per unit area lags behind countries like the United States and Brazil. The size of peanut kernels is closely related to peanut yield and its processing and utilization.
[0003] Peanuts are classified into three varieties based on their weight per 100 plump kernels: large, medium, and small. Large peanuts weigh more than 80g per 100 kernels, medium peanuts weigh between 50g and 80g, and small peanuts weigh less than 50g. Currently, molecular markers for peanut kernel weight and size are scarce. Selection based on kernel weight in breeding primarily relies on phenotypic observation. Because this is a quantitative trait, it is greatly influenced by the environment, and phenotypic data can only be collected after harvest, resulting in a long identification cycle and high costs.
[0004] Cultivated peanut varieties are allotetraploid (AABB) with a large genome, high subgenome similarity, and numerous repetitive sequences. Before the publication of the cultivated peanut genome, molecular marker development in peanuts lacked polymorphism, resulting in few molecular markers for constructing genetic maps and large QTL mapping intervals for kernel weight and size. After the publication of the reference genome sequence of cultivated peanuts, SNP / INDEL markers mined through resequencing significantly increased the density of the genetic linkage map, effectively narrowing the mapping intervals. Utilizing QTL mapping to discover and develop molecular markers closely linked to kernel weight (100 kernels) and applying them to marker-assisted selection breeding will greatly improve the efficiency of genetic improvement of peanut yield traits. Summary of the Invention
[0005] To address the problems of existing technologies, this invention provides an INDEL molecular marker linked to the peanut kernel QTL qHKWA05 and its application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] The nucleotide sequence of the INDEL molecular marker linked to the peanut kernel QTL qHKWA05 is 'ATGCATAATATTCCTCCATCT' (SEQ ID NO.1) or 'A'.
[0008] Among them, PCR was used to identify the genotype of the qHKWA05.INDEL molecular marker site. The molecular marker primers were:
[0009] Forward primer qHKWA05F: AAGGGAAAAATCGGATGTGA (SEQ ID NO.2)
[0010] Reverse primer qHKWA05R: GGGTTTTCAGTTTTTGCTGCT (SEQ ID NO.3).
[0011] The total PCR reaction volume was 20 μL, including 5× buffer, 4 μL of 2.5 mM dNTPs, 1.6 μL of 1.25 U / μL GXL DNA polymerase, 0.4 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 0.5 μL of 50 ng / μL genomic DNA, and 3 μL of 10 μL ddH2O.
[0012] PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 56℃ annealing for 15 s, 68℃ extension for 45 s, 35 cycles; 68℃ extension for 7 min.
[0013] This invention proposes a kit comprising the molecular marker primers described above.
[0014] This invention provides a method for detecting the weight of 100 peanut kernels, the method comprising the following steps:
[0015] (1) Extract DNA from the peanut material to be identified, and amplify and sequence the qHKWA05.INDEL molecular marker by PCR;
[0016] (2) If the molecular marker is identified as the genotype “ATGCATAATATTCCTCCATCT” (SEQ ID NO.1), then the weight of 100 peanut kernels to be identified is “<45g”;
[0017] If the molecular marker is identified as genotype "A", then the peanut material to be identified has a weight of 100 kernels > 85g.
[0018] The present invention relates to the application of the QTL qHKWA05-linked INDEL molecular marker for peanut kernels in peanut breeding.
[0019] The present invention relates to the application of the INDEL molecular marker linked to the QTL qHKWA05 in peanut kernel weight genotyping in natural peanut populations.
[0020] The present invention relates to the application of the INDEL molecular marker linked to the QTL qHKWA05 in peanut kernel weight in haplotype analysis of natural peanut populations.
[0021] The positive and beneficial effects of this invention are:
[0022] Based on a high-density SNP genetic map of 318 RILs and combined with the phenotypic data of Bai Ren Chong under three environments, this invention located the Bai Ren Chong QTL qHKWA05 on chromosome Arahy05 and developed the INDEL molecular marker qHKWA05.INDEL. After validation in natural populations, the accuracy rate reached over 80%.
[0023] The QTL interval located by this invention is small, requiring only one pair of PCR primers to distinguish peanut kernel size, thus improving detection efficiency and reducing detection costs. Applying this technology to the genetic improvement of peanut kernel traits will effectively improve the selection accuracy of kernel weight and size in hybrid offspring, reduce breeding costs, improve breeding efficiency, and help accelerate the breeding process of high-yield and processing-specific peanut varieties. Attached Figure Description
[0024] Figure 1 .Location result diagram of peanut kernel weight QTL qHKWA05;
[0025] Note: Black, red, green, and blue represent QTLs that are co-located in the same interval (the weight of 100 fruits: qHPW05, the weight of 100 kernels: qHKW05, the area of kernels: qKA05, and the length of kernels: qKL05, respectively).
[0026] Figure 2 Agarose gel electrophoresis image of PCR products of QTL qHKWA05 for 100 peanut kernels in some samples;
[0027] Where M: DL 1,000 DNA marker; 1-17: sample number.
[0028] Figure 3 .353 natural populations qHKWA05 interval INDEL haplotype analysis
[0029] in, Figure 3 A: Correlation coefficients of haplotypes H001 and H002 Figure 3 B: Redistribution of haplotypes H001 and H002 and the significance of their differences. Detailed Implementation
[0030] The specific embodiments of the present invention will be further described in detail below with reference to examples.
[0031] Example 1: Development of INDEL molecular markers
[0032] Using 318 recombinant self-pollinated families derived from the cross between Yuhua 15 and W1202, a linkage map containing 4561 SNP (Single Nucleotide Polymorphism) markers was constructed through population and parental resequencing and genotyping. In 2021 and 2022, multi-environmental phenotypic identification was performed, and using the IciMapping QTL (Quantitative Trait Locus) method, the peanut kernel weight QTL qHKWA05 (PVE%>10%) located on chromosome 5 (Arahy05) in cultivated peanut species was located in three environments. This QTL was reproducible in all three environments and co-located in the same region with QTLs for 100-kernel weight, kernel area, and kernel length. Figure 1 Based on the INDEL (Insertion-Deletion) variant at 106411957 bp in the qHKWA05 QTL interval, specific PCR primers for amplification were designed. Primer pairs for PCR amplification were designed at both ends of the insertion or deletion site using Primer3Plus (https: / / www.bioinformatics.nl / cgi-bin / primer3plus / primer3plus.cgi), and the amplification product length was approximately 750 bp. Figure 2 Its primer sequences are as follows:
[0033] Forward primer sequence qHKWA05F: AAGGGAAAAATCGGATGTGA (SEQ ID NO.2)
[0034] Reverse primer sequence qHKWA05R: GGGTTTTCAGTTTTTGCTGCT (SEQ ID NO.3)
[0035] PCR reaction system: 20 μL total, including 4 μL of 5× buffer, 1.6 μL of dNTP (2.5 mM), 0.4 μL of GXL DNA polymerase (1.25 U / μL), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 3 μL of genomic DNA (50 ng / μL), and 10 μL of ddH2O;
[0036] PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 56℃ annealing for 15 s, 68℃ extension for 45 s, 35 cycles; 68℃ extension for 7 min.
[0037] The genomic DNA was obtained by extracting DNA from peanut leaves using the TIANGEN plant genomic DNA extraction kit.
[0038] The genotype of the molecular marker was determined by sequencing the PCR product. Based on the genotype of the qHKWA05.INDEL marker, the weight of the kernels in the population could be accurately distinguished (Table 1).
[0039] The first row of the table contains the genotype ATGCATAATATTCCTCCATCT (SEQ ID NO.1) (code 0 / 0), which is consistent with the reference genome sequence. The second row contains genotype A (code 1 / 1), which can be interpreted as a deletion compared to the genotype 0 / 0. Arahy05.106411957 is the marker position.
[0040] Table 1. Molecular markers closely linked to the QTL of peanut kernels: qHKWA05 INDEL.
[0041] Arahy.05.106411957 genotype Genotype code Bai Renzhong(HKW) ATGCATAATATTCCTCCATCT 0 / 0 <45g A 1 / 1 >85g
[0042] Example 2: Application of the molecular marker qHKWA05.INDEL in genotyping
[0043] In 2021, 353 natural population materials from domestic and foreign cultivated peanut germplasm resources were sown at three locations in Yuanyang, Shangqiu and Nanyang, Henan Province. A total of 79 materials were selected, including 39 small-seeded materials and 40 large-seeded materials. Genotyping was performed on the qHKWA05.INDEL marker site using the PCR method described above. Materials with an average kernel weight of less than 45g and materials with an average kernel weight of more than 85g could be distinguished with an accuracy of over 80% (Table 2), indicating that this molecular marker is relatively regular in materials with extreme kernel weights.
[0044] The accuracy calculation method is as follows: the number of materials with an average weight of 100 kernels less than 45g and a genotype of 0 / 0 divided by the total number of materials with an average weight of 100 kernels less than 45g. The accuracy calculation method is the same for materials with an average weight of 100 kernels greater than 85g.
[0045] Table 2. Statistical table of 79 materials qHKWA05.INDEL genotype and 100g weight of kernels under three environments.
[0046]
[0047]
[0048]
[0049] In the table, Accession represents the original sequencing number of the material, and NA indicates that the value is missing (no phenotypic data).
[0050] Example 3: Validation of the molecular marker qHKWA05.INDEL marker site in a natural population through haplotype analysis.
[0051] Based on the resequencing results of 353 natural populations from the 2021 original positive test, and combined with the resequencing data of the qHKWA05.INDEL marker site, haplotype analysis was performed on the 353 natural populations. A total of two haplotypes were obtained. Among them, 170 materials had the marker genotype "A" (genotype code '1 / 1', haplotype H001), and 137 materials had the marker genotype "ATGCATAATATTCCTCCATCT" (SEQ ID NO.1) (genotype code '0 / 0', haplotype H002).
[0052] The correlation coefficient between the two haplotypes was 0.001, indicating that the marker genotypes contained in the two haplotypes are closely linked to Bai Ren Zhong. Figure 3 A). Statistical comparative analysis of the 100-kernel weight of different haplotypes showed that the 100-kernel weight of 170 peanut germplasm resources with haplotype H001 was significantly different from that of 137 materials with haplotype H002. Figure 3 B).
[0053] Figure 3 A indicates that the weight of materials with haplotype H001 is significantly correlated with that with haplotype H002 (p = 0.001). Figure 3 B represents the phenotypic distribution and significance analysis of haplotypes H001 and H002 in 100 kernels (p<0.001).
Claims
1. A method for detecting the weight of 100 peanut kernels, characterized in that, The method includes the following steps: (1) DNA was extracted from the peanut material to be identified, and the QTL located at 106411957bp on chromosome 106411957 of peanut cultivar Arahy05 was identified by PCR. qHKWA05 Linked INDEL molecular markers were amplified and sequenced for identification; (2) If the molecular marker is identified as the genotype "ATGCATAATATTCCTCCATCT", then the weight of 100 peanut kernels to be identified is "<45 g". If the molecular marker is identified as genotype "A", then the peanut material to be identified is peanut kernels weighing > 85 g. The primers for the molecular marker PCR are: Forward primer qHKWA05F: AAGGGAAAAATCGGATGTGA; Reverse primer qHKWA05R: GGGTTTTCAGTTTTTGCTGCT.
2. A peanut kernel weight QTL as described in claim 1 qHKWA05 The application of linked INDEL molecular markers in the breeding of high-kernel peanuts is characterized by, If the molecular marker is identified as genotype "A", then the peanut material to be identified is 100 kernels weighing > 85 g.