A composition for treating kidney yin deficiency syndrome and its application

The composition of Polygonatum water extract and Lactobacillus plantarum GL-5 bacterial solution is used to regulate intestinal flora and short-chain fatty acids, which solves the problems of complex Chinese medicine ingredients and insufficient regulation of intestinal flora, and achieves significant therapeutic effects for kidney yin deficiency syndrome.

CN117122647BActive Publication Date: 2025-07-18LANZHOU UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210552134.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-20
Publication Date
2025-07-18
Estimated Expiration
2042-05-20

AI Technical Summary

Technical Problem

The existing Chinese medicine ingredients are complex and lack of modern scientific verification, which leads to uncertain treatment effect of kidney yin deficiency syndrome and insufficient regulation of intestinal flora, affecting the treatment effect.

Method used

The composition of Polygonatum water extract and Lactobacillus plantarum GL-5 bacterial solution is used to regulate intestinal flora and short-chain fatty acids through synergistic effects, thereby improving kidney yin deficiency syndrome.

Benefits of technology

Significantly improve the metabolism, immunity and antioxidant effects of kidney yin deficiency syndrome, regulate intestinal flora, and improve the therapeutic effect of kidney yin deficiency syndrome.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117122647B_ABST
    Figure CN117122647B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of medicine, and particularly relates to a composition for treating kidney yin deficiency syndrome and its application. The present invention provides a composition for treating kidney yin deficiency syndrome, and the composition comprises a polygonatum sibiricum extract and a Lactobacillus plantarum GL-5 bacterial liquid; the compatibility of the composition has a significant effect on treating kidney yin deficiency syndrome, and the effects in terms of metabolism, immunity and antioxidant are better than those of the polygonatum sibiricum extract and the Lactobacillus plantarum GL-5 bacterial liquid alone; moreover, the composition can regulate the intestinal flora and short-chain fatty acids, which helps to improve kidney yin deficiency syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and particularly relates to a composition for treating kidney yin deficiency syndrome and its application. Background Art

[0002] Kidney yin deficiency is a term in traditional Chinese medicine, referring to the syndrome of insufficient yin fluid in the kidney, also known as insufficient kidney water or true yin deficiency, which is a type of kidney deficiency. Since the symptoms it presents are kidney yin deficiency, lack of nourishment, and endogenous deficiency heat, it is clinically called kidney yin deficiency syndrome in traditional Chinese medicine. Since the 1960s, the team led by Academician Shen Ziyin has carried out research on the essence of the kidney in traditional Chinese and Western medicine. Through in-depth exploration, it is recognized that the kidney is the most important organ in the "theory of visceral manifestations", such as the kidney being the congenital foundation, governing the processes of growth, development, and aging; the kidney being the "gate of vitality", where kidney yang warms the yang of the whole body, and kidney yin nourishes the yin of the whole body, being the center of the body's yin-yang regulation. Moreover, the kidney mainly affects the growth, development, and metabolism of the body by participating in the regulation of the release of hormones in relevant target organs in the "axis from the hypothalamus to the target gland".

[0003] Traditional Chinese medicine believes that when kidney yin is deficient, yin fails to control yang, and yang becomes hyperactive, resulting in endogenous deficiency heat. Therefore, the symptoms of kidney yin deficiency are manifested as feverish sensation over the five centers (palms, soles, and chest), tidal fever and night sweats, dizziness and tinnitus, and a thready, rapid, and fine pulse, etc., which is consistent with the conclusions of many relevant studies, that is, in the group of patients with kidney yin deficiency syndrome, the systolic blood pressure, pulse pressure difference, mean arterial pressure, serum monoamine oxidase, and the activity of serum isocitrate dehydrogenase are significantly increased, while the activity of whole blood acetylcholinesterase and lactate dehydrogenase is significantly decreased. These indicators all suggest that the aerobic metabolism of patients with kidney yin deficiency syndrome is enhanced, the anaerobic glycolysis reaction is weakened, and the overall performance is enhanced body energy metabolism, indicating that there is a disorder in the autonomic nerve function in kidney yin deficiency syndrome. The modern research on the essence of kidney deficiency mainly focuses on the kidney and the endocrine system, the kidney and the reproductive system, the kidney and free radicals, the kidney and immunity, etc.

[0004] The causes of kidney yin deficiency syndrome are mainly of two types. The first is congenital endowment deficiency, and the second is acquired factors, mainly including overwork of the body, excessive thinking, irregular work and rest, depletion caused by chronic diseases, excessive sexual activity, and taking or over-taking drugs or substances that are warm and dry and damage yin. Clinically, kidney yin deficiency syndrome appears along with various diseases such as diabetes, hyperlipidemia, perimenopausal syndrome, IgA (immunoglobulin A) nephropathy, osteoporosis, etc. All systems and organs in the human body are interconnected, and the kidney is the root of the five zang-organs. Therefore, the development of many diseases will ultimately affect the kidney.

[0005] Kidney yin deficiency is associated with various systemic diseases, such as chronic nephritis, diabetic nephropathy, gynecological diseases, sexual dysfunction, diabetes insipidus, slow reaction, susceptibility to fatigue, etc. Kidney yin deficiency syndrome has become a very common pathological state among the population in today's society. The treatment of kidney yin deficiency syndrome mainly relies on Chinese patent medicines and hospital preparations, and there are also a small number of combined Chinese and Western medicine methods and single prescriptions. Among them, Liuwei Dihuang Pills are a recognized classic prescription for treating kidney yin deficiency syndrome. Clinical and pharmacological experiments have confirmed that Liuwei Dihuang Pills have the effects of enhancing immunity, regulating metabolism, anti-fatigue, delaying aging, resisting low temperature, tolerating hypoxia, reducing the three highs, regulating kidney function, and increasing bone density in patients with primary osteoporosis. However, due to the complex components of traditional Chinese medicines and the relative lack of modern scientific verification, the further development and research of traditional Chinese medicines are often hindered. Some components of traditional Chinese medicines may directly affect the epithelial cells and immune cells of the digestive tract, but there are also some indigestible components such as polysaccharides, polyphenols, and alkaloids, which will reach the intestine through the stomach and be fermented or transformed by local intestinal flora, forming bioactive or toxic metabolites. Summary of the Invention

[0006] In view of the above technical problems, the purpose of the present invention is to provide a composition for treating kidney yin deficiency syndrome and its application, specifically including the following content:

[0007] In the first aspect, the present invention provides a composition for treating kidney yin deficiency syndrome, and the composition includes an aqueous extract of Polygonatum sibiricum and a Lactobacillus plantarum bacterial liquid.

[0008] Preferably, the Lactobacillus plantarum is Lactobacillus plantarum GL-5, and the Lactobacillus plantarum GL-5 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 21, 2019, with the deposit number: CGMCC No. 18988.

[0009] Preferably, the preparation method of the Lactobacillus plantarum bacterial liquid is: culturing and activating Lactobacillus plantarum on a solid medium, inoculating the activated Lactobacillus plantarum into a liquid medium for culture, and centrifuging to collect the bacterial liquid to obtain the Lactobacillus plantarum bacterial liquid.

[0010] Preferably, the preparation method of the Lactobacillus plantarum bacterial liquid is:

[0011] (1) Culturing and activating Lactobacillus plantarum on a solid medium at 37°C for 24-48 hours;

[0012] (2) Inoculating a single colony of the activated Lactobacillus plantarum into 10 ml of a liquid medium containing 52.24 g of MRS broth / L, and culturing at 37°C for 24 hours to obtain a first-generation bacterial liquid;

[0013] (3) Inoculate 400 μL of the first-generation bacterial solution into 9.6 mL of the liquid medium described in step (2), and culture it at 37 °C for 24 h to obtain the second-generation bacterial solution. Centrifuge to collect the bacterial solution to obtain the Lactobacillus plantarum bacterial solution.

[0014] Preferably, the preparation method of the polygonatum water extract is as follows: Take polygonatum powder, soak it in water and then heat and decoct it, and take the filtrate to obtain the polygonatum water extract.

[0015] Preferably, the preparation method of the polygonatum water extract is as follows: Take polygonatum powder, soak it in 10 times the volume of purified water overnight, heat and decoct it for 1 h after overnight soaking, filter, add 8 times the volume of purified water to the residue and decoct it for 1 h again, combine the filtrates, concentrate to 0.5 g / mL, centrifuge and take the supernatant, and sterilize it to obtain the polygonatum water extract.

[0016] Preferably, the volume ratio of the polygonatum water extract to the Lactobacillus plantarum bacterial solution is 1:1.

[0017] In a second aspect, the present invention provides the use of the composition described in the first aspect above in the preparation of a drug for treating kidney yin deficiency syndrome.

[0018] Preferably, the kidney yin deficiency syndrome includes chronic nephritis, diabetic nephropathy, gynecological diseases, sexual dysfunction, diabetes insipidus, and fatigue syndrome.

[0019] Preferably, the composition is added with a pharmaceutically acceptable carrier / excipient to form any pharmaceutically acceptable dosage form.

[0020] The beneficial effects of the present invention are as follows: The present invention provides a composition for treating kidney yin deficiency syndrome, and the composition includes a polygonatum extract and a Lactobacillus plantarum GL-5 bacterial solution; the combination of the composition has a significant effect on treating kidney yin deficiency syndrome, and the effects in terms of metabolism, immunity, and antioxidant are better than those of the polygonatum extract and the Lactobacillus plantarum GL-5 bacterial solution alone; moreover, the composition can regulate the intestinal flora and short-chain fatty acids, which is helpful for the improvement of kidney yin deficiency syndrome. Description of the Drawings

[0021] Figure 1 Growth curve graph;

[0022] Figure 2 Experimental flow chart;

[0023] Figure 3 Body weight change rate;

[0024] Figure 4 Change results of metabolic indexes of mice in each group;

[0025] Figure 5 Change results of immune indexes of mice in each group;

[0026] Figure 6 Results of oxidative stress indexes of mice in each group;

[0027] Figure 7 Expression levels of tight junction protein ZO-1 and mucin MUC2 in the mouse intestine;

[0028] Figure 8 HE-stained section of mouse colon;

[0029] Figure 9 Analysis results of fecal microbial diversity in each group of mice;

[0030] Figure 10 Change results of intestinal flora in each group of mice at the phylum level;

[0031] Figure 11 Change results of intestinal flora in each group of mice at the genus level;

[0032] Figure 12 Total ion current chromatogram;

[0033] Figure 13 Detection result chart of SCFAs content in each group. Detailed implementation manners

[0034] The present invention will be elaborated in detail through specific embodiments below. However, the protection scope of the present invention is not limited to the following embodiments. Any technical solution that can be conceived by those skilled in the art on the basis of the present invention in combination with the common general knowledge in the art belongs to the protection scope of the present invention.

[0035] The Lactobacillus plantarum GL-5 described in the following embodiments was deposited at the China General Microbiological Culture Collection Center on November 21, 2019, with the deposit number: CGMCC No. 18988; the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; contact phone number: 010 - 64807355.

[0036] The kit materials used in the following embodiments can all be obtained commercially.

[0037] Example 1 Preparation of the composition

[0038] 1. Preparation of Lactobacillus plantarum bacterial liquid

[0039] Lactobacillus plantarum GL-5 is preserved in glycerol and needs to be activated before use:

[0040] (1) Weigh 66.2 g of MRS agar, add it to 1 L of purified water, dissolve it by ultrasonic heating, sterilize it at 121 °C for 15 min. After the temperature drops below 60 °C, take it to the laminar flow hood and pour it into the sterilized disposable petri dishes while it is still hot. Use it after it cools and solidifies.

[0041] (2) Pick the strain preserved in glycerol and streak it on the prepared solid medium, and culture it at 37 °C for 24 - 48 h.

[0042] (3) Weigh 52.24 g of MRS broth, add it to 1 L of purified water, dissolve it by ultrasonic heating, sterilize it at 121 °C for 15 min to obtain the liquid medium. After the temperature drops below 60 °C, take it to the laminar flow hood for standby.

[0043] (4) Add 10 mL of the liquid medium to the sterilized 15 mL centrifuge tube, pick a single colony from the cultured solid medium and transfer it into the centrifuge tube, and culture it at 37 °C for 24 h to obtain the first-generation bacterial liquid.

[0044] (5) Add 9.6 mL of the liquid medium to the sterilized 15 mL centrifuge tube, add 400 μL of the first-generation bacterial liquid, shake well, and culture it at 37 °C for 24 h to obtain the second-generation bacterial liquid.

[0045] The recommended human dose of probiotics is 20 billion CFU / day. Calculated based on a human body weight of 60 kg and the dose conversion coefficient between humans and mice, the final administered dose for mice is determined to be 3.3 billion CFU / kg. Culture the GL-5 second-generation bacterial liquid to the corresponding CFU number, centrifuge, discard the supernatant, add an equal volume of physiological saline, shake well, centrifuge again, discard the supernatant, and finally add an equal volume of physiological saline and shake well to obtain the GL-5 Lactobacillus plantarum bacterial liquid. The gavage dose is 0.05 mL / 10 g.

[0046] 2. Preparation of the aqueous extract of Polygonatum sibiricum

[0047] In the first part of the Chinese Pharmacopoeia (2020 Edition), the daily human dosage of "Polygonatum sibiricum" is specified as 9 g - 15 g. This dosage range is relatively narrow, and according to relevant research literature on Polygonatum sibiricum, its therapeutic effects are all positively correlated with the dosage. Therefore, no dosage groups are set here, and it is directly calculated based on the human dosage of 15 g / day. Calculated based on a human body weight of 60 kg and the dose conversion coefficient between humans and mice, the final administered dose for mice is determined to be 2.5 g / kg.

[0048] Take an appropriate amount of Polygonatum sibiricum powder, soak it in 10 times the volume of purified water in a cool place overnight. After overnight soaking, heat and decoct it for 1 h, filter, add the residue to 8 times the volume of purified water and decoct it for 1 h again. Combine the two filtrates, concentrate to 0.5 g / mL, centrifuge at 3500 rpm, take the supernatant, and sterilize it to obtain the aqueous extract of Polygonatum sibiricum. The gavage dose is 0.05 mL / 10 g.

[0049] 3. Preparation of the Composition

[0050] Physically add the administration doses of the water extract of Polygonatum sibiricum and the GL-5 bacterial solution to obtain the dose of the composition. To ensure the same gavage volume, double the concentrations of the water extract of Polygonatum sibiricum and the GL-5 bacterial solution according to the aforementioned method, and then mix and shake well to obtain it.

[0051] Growth curve of Lactobacillus plantarum GL-5 in the composition of Example 2

[0052] Add 9.6 mL of the sterilized water extract of Polygonatum sibiricum to a sterilized 15 mL centrifuge tube, add 400 μL of the second-generation bacterial solution, shake well, and culture at 37°C. Starting from 0 h, sample once every 2 h - 4 h. Dilute each sample and spread it, count after culturing, and draw a growth curve with the viable count as the index.

[0053] The growth curve is as Figure 1 shown. It can be seen from the figure that when the reaction time reaches about 16 h, the number of bacteria can increase by more than 100 times, indicating that there is a synergistic effect between the water extract of Polygonatum sibiricum and Lactobacillus plantarum GL-5, and the water extract of Polygonatum sibiricum can significantly promote the growth of Lactobacillus plantarum GL-5.

[0054] Improvement effect of the composition of Example 3 on kidney yin deficiency syndrome in mice

[0055] 1. Experimental animals

[0056] C57BL / 6 male mice, 7 weeks old, weighing 20 g ± 2 g, 40 in number, purchased from Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. All mice were housed in a SPF-class clean area laboratory. The laboratory temperature was 20°C ± 2°C, the humidity was 35% - 55%, with a 12 h light / dark alternating circadian rhythm, fed with normal sterilized feed, and freely drank sterile distilled water. The adaptation period was 7 days.

[0057] 2. Experimental grouping

[0058] Randomly place 40 C57BL / 6 male mice into 5 cages and adaptively raise them for 7 days to make the mice adapt to the environment. After 7 days, start the formal experiment: Except for the normal group given an equal amount of normal saline, the remaining groups of mice were gavaged with a mixed solution of thyroxine + reserpine. After the start of modeling, the treatment drugs were given simultaneously. Except for the normal group and the model group given an equal amount of normal saline, the remaining treatment groups were given the corresponding drugs. The drugs were given while modeling for a total of 14 days. The experimental process is as shown in Figure 2.

[0059] (1) Normal group (C): Throughout the experimental period, the mice were supplied with normal feed and water. When the other groups of mice were given the modeling drugs and the treatment drugs, the normal group was given an equal amount of normal saline;

[0060] (2) Model group (M): During the entire experimental period, the mice were provided with normal feed and water. When establishing the model, a mixed solution of thyroxine and reserpine was administered; during the treatment, an equal amount of normal saline was given.

[0061] (3) Polygonatum sibiricum aqueous extract group (PE): During the entire experimental period, the mice were provided with normal feed and water. When establishing the model, a mixed solution of thyroxine and reserpine was administered; during the treatment, Polygonatum sibiricum aqueous extract was given.

[0062] (4) Lactobacillus plantarum GL-5 group (GL-5): During the entire experimental period, the mice were provided with normal feed and water. When establishing the model, a mixed solution of thyroxine and reserpine was administered; during the treatment, GL-5 bacterial solution was given.

[0063] (5) Composition group (Syn): During the entire experimental period, the mice were provided with normal feed and water. When establishing the model, a mixed solution of thyroxine and reserpine was administered; during the treatment, a composition mixture was given.

[0064] (6) Liuwei Dihuang Pills group (P): During the entire experimental period, the mice were provided with normal feed and water. When establishing the model, a mixed solution of thyroxine and reserpine was administered; during the treatment, an aqueous solution of Liuwei Dihuang Pills was given.

[0065] 3. Dosage

[0066] Modeling drug: Thyroid tablets purchased from Shandong Huinuo Pharmaceutical Co., Ltd., with a tablet weight of 137 mg ± 1 mg and a drug content of 40 mg / tablet. According to the dosage of 180 mg / kg and a dosing volume of 0.05 mL / 10 g, 123 mg of the drug is required to prepare 3 mL of the solution. The purchased reserpine reference substance, with a purity of 98%, requires 0.6 mg of the drug to prepare 3 mL of the solution according to the dosage of 1 mg / kg and a dosing volume of 0.05 mL / 10 g. Grind the thyroid tablets into fine powder using a mortar, weigh 123 mg, and then weigh 0.6 mg of reserpine and add them together to 3 mL of sterile normal saline to obtain the modeling mixed solution, which is prepared freshly every day;

[0067] Polygonatum sibiricum aqueous extract: Take an appropriate amount of Polygonatum sibiricum powder, soak it in 10 times the volume of purified water in a cool place overnight, heat and decoct for 1 h after overnight soaking, filter, add the residue to 8 times the volume of purified water and decoct for 1 h again, combine the two filtrates, concentrate to 0.5 g / mL, centrifuge at 3500 rpm, take the supernatant, and obtain the Polygonatum sibiricum aqueous extract after sterilization. The gavage dosage is 0.05 mL / 10 g;

[0068] GL-5 bacterial solution: Determine the dosage for mice to be 3.3 billion CFU / kg; culture the GL-5 bacterial solution to the corresponding CFU number, centrifuge, discard the supernatant, add an equal volume of normal saline, shake well, centrifuge, discard the supernatant, and finally add an equal volume of normal saline and shake well to obtain the GL-5 bacterial solution. The gavage dosage is 0.05 mL / 10 g;

[0069] Preparation of the composition mixture: Physically add the dosage of the aqueous extract of Polygonatum sibiricum and the GL-5 bacterial solution to obtain the dosage of the synbiotic. To ensure the same gavage volume, the concentrations of the aqueous extract of Polygonatum sibiricum and the GL-5 bacterial solution need to be doubled according to the aforementioned method, and then mixed and shaken well to obtain it;

[0070] Aqueous extract of Liuwei Dihuang Pills: Liuwei Dihuang Pills purchased from Lanzhou Foci Pharmaceutical Co., Ltd., with 8 pills weighing 1.44 g. The human dosage is 8 pills at a time, three times a day. According to the actual experimental needs, the mouse dosage is calculated based on 24 pills taken by humans per day, with the human body weight calculated as 60 kg. Then, according to the dosage conversion coefficient between humans and mice, the final determined mouse dosage is 0.72 g / kg, and the gavage dosage is 0.05 mL / 10 g. Grind the Liuwei Dihuang Pills into fine powder with a mortar, weigh 144 mg, add 1 mL of sterile physiological saline and shake well to obtain it.

[0071] 4. Detection of related indicators

[0072] 4.1 Record the changes in body weight and food intake of mice in each group during the experiment

[0073] 4.2 Sample collection

[0074] After the administration period ends, fast the mice for 12 h without water deprivation, and then decapitate the mice in each group after taking blood from the eyeballs. After allowing the blood samples to stand at room temperature for a period of time, centrifuge at 3000 rpm and take the serum, which is then aliquoted and stored frozen for later use. Take the thymus and spleen of the mice, weigh them, and calculate the organ index. Take the right kidney and liver, rinse the residual blood with physiological saline, blot dry with filter paper, and store frozen for later use. Take the proximal part of the colon, wash the intestinal contents with PBS buffer and blot dry the residual liquid, and then store frozen for later use. Take the left kidney and the distal part of the colon. After washing the intestinal contents of the colon with PBS buffer and blotting dry the residual liquid, place them in 10% neutral formalin solution for fixation respectively.

[0075] 4.3 Detection of metabolism-related indicators

[0076] Measure LA, FFA, cAMP, cGMP, TG, BUN, and CK in the serum according to the kit instructions. Prepare 0.86% physiological saline as the homogenization medium. After thawing the liver tissue, take about 100 mg, weigh it, add 9 times the volume of the homogenization medium, and homogenize it with a ball mill. After centrifugation, take the supernatant, which is 10% liver tissue homogenate. Dilute the 10% homogenate to concentrations such as 1% and 0.2% according to the optimal concentrations given in the different kit instructions for the next step of measurement. Measure Na + -K + -ATPase, Ca 2+ -ATPase, LDH, BCA.

[0077] 4.4 Determination of immune-related indicators

[0078] After thawing and weighing the kidney and proximal colon tissues, add 9 times the volume of homogenization medium, homogenize with a ball mill, centrifuge, and take the supernatant, which is 10% tissue homogenate. Dilute the 10% homogenate to concentrations such as 5% and 1% according to the optimal concentrations given in the instructions of different kits for the next determination. Determine TNF-α, TGF-β, IL-1β, IL-6, IL-10, and IL-17 in the kidney and colon according to the kit instructions.

[0079] 4.5 Determination of oxidative stress-related indicators

[0080] Determine CAT, SOD, T-AOC, MDA, and BCA in the kidney according to the kit instructions.

[0081] 4.6 Determination of intestinal tight junction protein ZO-1 and mucin MUC2

[0082] RNA extraction: Extract RNA using the Trizol total RNA extraction method. Take 100 mg of colon tissue, grind it in a mortar with liquid nitrogen and transfer it to a 1.5 mL centrifuge tube. Add 1 mL of Trizol and let it stand at room temperature for 5 min. After 5 min, add 200 μL of chloroform, shake for 15 s, let it stand at room temperature for 10 min, then centrifuge at 12000 rpm and 4 °C for 10 min. After centrifugation, let it stand for layering: The layering ends when the sample is divided into three layers. The upper layer is a colorless aqueous phase, and RNA is distributed in the aqueous phase. Aspirate the upper aqueous phase and transfer it to a new centrifuge tube. Add an equal volume of isopropanol to the centrifuge tube, let it stand at room temperature for 10 min, centrifuge at 12000 rpm and 4 °C for 10 min, and then discard the supernatant. Then add 75% ethanol diluted with DEPC water to wash the precipitate in the centrifuge tube, centrifuge at 12000 rpm and 4 °C for 5 min, discard the supernatant. Repeat this step 2 times, discard the supernatant, centrifuge at 12000 rpm and 4 °C for 2 min, then suck dry the liquid and evaporate the ethanol.

[0083] Concentration determination: Add 20 μL of DEPC water to dissolve the RNA precipitate, detect the RNA concentration and purity with Nanodrop 2000, and normalize the RNA concentrations of all samples.

[0084] Reverse transcription: Operate according to the reverse transcription kit instructions to reverse transcribe the total RNA into cDNA.

[0085] Detection of target gene expression: Using the SYBR fluorescence dye labeling method, a 20 μL reaction system was prepared (10 μL SYBR, 7 μL ddH2O, 1 μL upstream primer, 1 μL downstream primer, 1 μL cDNA template). Then, the cycle threshold (Ct value) of the target gene was detected by an ABI Q5 real-time quantitative PCR instrument. Finally, the 2-ΔΔCt comparative method was used to determine the expression of the target gene. GAPDH was used as the internal reference gene in the experiment, and 3 technical replicates and 3 biological parallels were set for each sample. The primer sequences required for this experiment are shown in Table 1 below:

[0086] Table 1 Primer sequence information

[0087] Primer Information Primer Name Primer Sequence (5'-3') Fragment Length Annealing Temperature NM_023566.4 M-MUC2 GGCTCGGAACTCCAGAAAGAAG 139bp 60℃ NM_023566.4 M-MUC2 CTCGGCAGTCAGACGCAAAG 139bp 60℃ NM_008084.2 M-GAPDH CCTCGTCCCGTAGACAAAATG 133bp 60℃ NM_008084.2 M-GAPDH GAGGTCAATGAAGGGGTCGT 133bp 60℃ NM_009386.2 M-ZO1 GGGAAAACCCGAAACTGATG 103bp 60℃ NM_009386.2 M-ZO1 GCTGTACTGTGAGGGCAACG 103bp 60℃

[0088] 4.7 Preparation of mouse colon pathological sections

[0089] After fixing the left kidney of each mouse in 10% neutral formalin solution for 48 h, the kidney tissue was dehydrated with ethanol at different concentration gradients in an embedding cassette. After dehydration, the tissue was made transparent with xylene to replace the alcohol in the tissue block. The transparent tissue was placed in the melted paraffin, put into a wax melting box for insulation, and after the paraffin completely penetrated the tissue, embedding was carried out: Pour the melted paraffin into a suitable container, quickly pick up the tissue that has completely penetrated the paraffin and put it into it. After cooling and solidifying into a block, the embedded tissue was obtained. The embedded paraffin block was fixed on a microtome and cut into thin slices of 5 - 8 μm. The cut thin slices were flattened in preheated water, then pasted onto glass slides and dried in an incubator at 45°C. The paraffin in the sections was removed with xylene, and then successively placed in alcohol from high concentration to low concentration, and finally added to distilled water. Then, the sections that had been put into distilled water were stained in hematoxylin (H) solution for several minutes, and then the sections were differentiated in acid water and ammonia water for several seconds each. After rinsing with running water for 1 h and placing in distilled water for several minutes, they were dehydrated in 70% and 90% alcohol for 10 minutes respectively. Finally, the sections were stained in eosin (E) staining solution for 2 - 3 minutes. The stained sections were dehydrated with absolute ethanol and then made transparent with xylene. Canada balsam was dropped on the transparent sections, and a cover glass was covered and sealed. The morphological changes of the mouse kidney tissue sections were observed and photographed under an optical microscope at 100× and 40× magnifications.

[0090] 5. Results

[0091] 5.1 Body weight changes

[0092] The body weight of each group of mice at the end of the experiment was compared with the initial body weight. Taking the body weight change rate as the ordinate, the results were as follows Figure 3As shown, it can be seen from the figure that in the treatment of all groups, the composition group described in the present application is the only group that achieves positive weight gain, indicating that the composition described in the present application can promote the weight gain of mice with kidney yin deficiency. Moreover, the food intake of each group of mice is basically consistent with the trend of their weight changes.

[0093] 5.2 Detection results of metabolism-related indicators

[0094] The changes in the metabolic indicators of each group of mice are as Figure 4 shown. It can be seen from the figure that in terms of the indicators of cAMP / cGMP, LA, FFA, CK, LDH, and BUN, the composition group and the PE group showed similar effects, and both had obvious regulatory effects on these indicators; in terms of TG, Ca 2+ -ATPase and Na + -K + -ATPase, the composition described in the present invention has a better regulatory effect than PE.

[0095] 5.3 Detection results of immunity-related indicators

[0096] The changes in the immune indicators of each group of mice are as Figure 5 shown, where A-E are inflammatory factors in the kidney, and H-L are inflammatory factors in the colon. It can be seen from the figure that IL-1β, IL-17, TNF-α, and TGF-β showed the same change trend in the kidney and colon: the composition significantly improved the immune level of mice with kidney yin deficiency and regulated the immune balance of the body. The IL-10 in the kidneys of each group of mice hardly changed, which may be because the immune changes affected by kidney yin deficiency and the composition do not involve the pathway where this factor is located. In addition, the thymus index and spleen index of mice with kidney yin deficiency were also significantly improved by the composition.

[0097] 5.4 Detection results of oxidative stress-related indicators

[0098] The results of the oxidative stress indicators of each group of mice are as Figure 6 shown. It can be seen from the figure that the composition significantly improved the oxidative stress indicators of mice with kidney yin deficiency and regulated the redox homeostasis of their bodies, and the effect was significantly better than that of the PE group.

[0099] 5.5 Expression levels of intestinal tight junction protein ZO-1 and mucin MUC2

[0100] Figure 7 are the results of the expression levels of intestinal tight junction protein ZO-1 and mucin MUC2 in each group of mice. It can be seen from the figure that in the model group, the contents of both proteins decreased significantly, indicating that there were mucosal damage and increased permeability in the intestines of mice with kidney yin deficiency. Each administration group significantly improved this situation, and the best effect was shown in the composition group described in the present application.

[0101] 5.6 Histopathological changes of the colon tissues of mice in each group

[0102] Figure 8 These are the HE staining section images of the colon of mice in each group. As shown in the figure, in the model group, the intestinal villi were blurred in morphology, the intestinal mucosa was severely damaged, and the crypt structure was damaged to a certain extent. This lesion was alleviated to varying degrees in each administration group. Among them, in the synbiotic group, the intestinal mucosa was significantly thickened and the cell structure was complete. The morphological changes of the colon in each group were consistent with the quantitative detection results of ZO-1 and MUC-2 proteins.

[0103] To sum up, the intestinal barrier includes an immune barrier (regulatory T cells, macrophages, CD4 cells, dendritic cells, plasma cells), a mechanical barrier (small intestinal epithelial cells, colonic epithelial cells, goblet cells, intraepithelial lymphocytes, tight junction proteins, Paneth cells), a chemical barrier (antimicrobial peptides), and a biological barrier (intestinal flora). The intestinal barrier function is closely related to autoimmune diseases, inflammatory and metabolic diseases, such as diabetes, obesity, atherosclerosis, hypertension, etc. Among them, the tight junction protein ZO-1 (zonula occludens-1) is an important component of the mechanical barrier and has an important function in intestinal immunity and permeability maintenance. MUC2 is a secreted glycoprotein that has functions such as lubricating the inner wall and mucosal layer and blocking pathogenic substances, and plays an important role in maintaining the balance of the intestinal barrier and regulating the internal environment of the body. In the kidney yin deficiency syndrome model group, the expression levels of ZO-1 and MUC-2 were significantly decreased compared with the normal group, indicating that there was damage to the intestinal barrier and increased permeability in mice with kidney yin deficiency syndrome, which was closely related to the decreased immunity and inflammatory response in them; after administering the composition described in this application, the protein contents of ZO-1 and MUC-2 increased, and the inflammatory response was improved.

[0104] Effect of the composition in Example 4 on the intestinal flora of mice with kidney yin deficiency syndrome

[0105] 1. Method

[0106] Sample preparation: After the mice in each group were administered drugs as described in Example 3 above, 2-3 fresh feces of each group of mice were collected in a sterilized centrifuge tube and stored at -80 °C for later use;

[0107] DNA extraction and detection: Use a DNA extraction kit for strong extraction. Quantify the DNA using Nanodrop and detect the DNA extraction quality by 1.2% agarose gel electrophoresis;

[0108] PCR amplification: The PCR amplification and high-throughput sequencing of the samples were carried out. The amplification primers designed targeting the variable sequences in the 16S rRNA V3-V4 region are as follows:

[0109] Bacterial 16S rRNA (V3 + V4): Forward primer sequence 5’-ACTCCTACGGGAGGCAGCA-3’; Reverse primer sequence 5’-GGACTACHVGGGTWTCTAAT-3’;

[0110] Fungi: Forward primer sequence 5’-CTTGGTCATTTAGAGGAAGTAA-3’; Reverse primer sequence 5’-GCTGCGTTCTTCATCGATGC-3’.

[0111] PCR amplification conditions: 95°C for 5 min; 95°C for 1 min; 50°C for 1 min; 72°C for 1 min; 72°C for 7 min → 15 cycles; 1.8% agarose gel, electrophoresis at 120 V for 40 min, cut the target fragment and recover it;

[0112] Product purification: Add 0.8 times the volume of magnetic beads (Vazyme VAHTSTM DNA CleanBeads) to 25 μL of PCR product, shake, fully suspend, then adsorb on a magnetic stand for 5 min, and aspirate the supernatant with a pipette. Add 20 μL of 0.8 times the magnetic bead washing solution, shake, fully suspend, then place on a magnetic stand and adsorb for 5 min, carefully aspirate the supernatant. Add 20 μL of 80% ethanol, place it in reverse on the magnetic stand, fully adsorb and aspirate the supernatant. Let the magnetic beads stand at room temperature for 5 min. After the alcohol has completely evaporated and the magnetic beads show cracks, add 25 μL of Elution Buffer for elution. Finally, place the PCR tube on the adsorption stand for 5 min, fully adsorb, transfer the supernatant to a clean 1.5 mL centrifuge tube for storage.

[0113] Library preparation and library inspection: The sequencing library was prepared using the TruSeq Nano DNA LT Library Prep Kit from Illumina. First, the ends of the amplified products were repaired. The protruding bases at the 5' end of the DNA sequence were excised using the End Repair Mix 2 in the kit, and at the same time, a phosphate group was added and the missing bases at the 3' end were filled in. Since there is a protruding T base at the 3' end of the sequencing adapter, an A base was added to the 3' end of the DNA sequence to prevent self-ligation of DNA fragments and ensure that the target sequence can be ligated to the sequencing adapter. Next, a sequencing adapter containing a library-specific tag (i.e., the Index sequence) was added to the 5' end of the sequence so that DNA molecules could be immobilized on the Flow Cell. Then, BECKMAN AMPure XP Beads were used to screen out adapter self-ligated fragments by magnetic beads and purify the library system after adding the adapter. The DNA fragments ligated with the adapter were amplified by PCR to enrich the sequencing library template, and BECKMAN AMPure XP Beads were used again to purify the library enrichment product. Finally, the library was subjected to final fragment selection and purification by 2% agarose gel electrophoresis. Before sequencing on the machine, the library was first inspected on an Agilent Bioanalyzer using the Agilent High Sensitivity DNA Kit. A qualified library has and only has a single peak and no adapter. Then, the library was quantified on a Promega QuantiFluor fluorescence quantification system using the Quant-iT PicoGreen dsDNA Assay Kit. The concentration of a qualified library should be above 2 nM. After gradient dilution of each qualified sequencing library (the Index sequences cannot be repeated), they were mixed in the corresponding proportion according to the required sequencing amount and denatured with NaOH into single strands for sequencing on the machine.

[0114] NovaSeq sequencing on the machine: Paired-end sequencing was performed using a NovaSeq sequencer, and the corresponding reagent was the NovaSeq 6000SP Reagent Kit (500 cycles).

[0115] 2. Results

[0116] 2.1 Analysis of fecal microbial diversity in each group of mice

[0117] Figure 9In Figure A, it is a two-dimensional NMDS sorting graph based on Bray-curtis distance. It can be seen from the figure that the distance between the model group (M) and the other five groups is relatively far, indicating that the intestinal flora of the mice in the kidney yin deficiency syndrome model group has changed significantly compared with other groups. Among the normal group (C) and each administration group, the composition group (Syn) and the normal group are clustered together, followed by the water extract group of Polygonatum sibiricum. This shows that after administering the composition and the water extract of Polygonatum sibiricum, the intestinal flora of the mice tends to be normal.

[0118] Figure 9 In Figure B, it is a box plot of multi-group comparison based on the distance matrix and difference test. It can be seen from the figure that the distance between group C and group M is the farthest, and the distances of each administration group are all below group M. Among them, the PE group and the Syn group are the closest to group C. The results of this figure are generally the same as those of the NMDS sorting analysis graph, indicating that there are differences in the beta diversity of the intestinal flora in group M compared with other groups, and the treatment effects of the composition and the water extract of Polygonatum sibiricum are better.

[0119] 2.2 Changes in the intestinal flora of mice in each group at the phylum level

[0120] The abundance results of the top 20 species in the intestinal flora of mice in each group at the phylum level show that compared with the normal group, the relative abundance of Bacteroidetes in the model group decreased significantly, and the abundance of Firmicutes increased significantly. Correspondingly, the F / B ratio in the model group increased significantly. In addition to the two dominant phyla, the abundances of Proteobacteria and Cyanobacteria in the model group increased significantly, the abundance of Actinobacteria decreased significantly, and the relative abundances of TM7 phylum and Deffibacteres phylum decreased slightly. The abundances of Bacteroidetes in each administration group all recovered, and the abundances of Firmicutes all decreased. Correspondingly, the F / B ratios of each group also recovered to a certain extent; in addition, the abundances of Proteobacteria and Cyanobacteria in each administration group decreased compared with the model group, and even dropped below the level of the normal group; the abundances of Actinobacteria in each administration group all recovered, and the largest recovery was in the water extract group of Polygonatum sibiricum; in the change of Deffibacteres phylum, only the abundance of the composition group increased; the specific results are shown in detail in Figure 10 It shows that the improvement effect of the composition described in this application on kidney yin deficiency syndrome is closely related to the intestinal flora, and the occurrence and development of kidney yin deficiency syndrome are highly correlated with the abundance changes of Bacteroidetes, Actinobacteria, Proteobacteria, Cyanobacteria, and Firmicutes.

[0121] 2.3 Changes in the intestinal flora of mice in each group at the genus level

[0122] The abundance results of the top 20 species of the intestinal flora of each group of mice at the genus level showed that the dominant genera were Lcatobacillus, Oscillospira, Bacteroides, Parabacteroides, [S24-7] (the square brackets indicate that the bacterium has not been confirmed at the genus level, so its family name is used to indicate), [Clostridiaies], [Lachnospiraceae], etc. There were significant changes in the intestinal genera of mice before and after modeling. Compared with the normal group, the genera of [S24-7], [Clostridiaies] (including two unconfirmed genera), [Lachnospiraceae], Oscillospira, Bacteroides, Parabacteroides, Lachnospiraceae, Ruminococcaceae, Prevotella, Alistipes, Adiercreutzia, Ruminococcus, Flexispira, Sutterella, Desulfovibrio, Rikenellaceae, Akkermansia, etc. in the model group all showed significant changes in abundance. Among them, the genera with increased abundance in the model group were [Clostridiaies], [Lachnospiraceae], Oscillospira, Bacteroides, Parabacteroides, Lachnospiraceae, Ruminococcaceae, Prevotella, Alistipes, Rikenellaceae; the genera with decreased abundance in the model group were [S24-7], Adiercreutzia, Ruminococcus, Flexispira, Sutterella, Desulfovibrio, Akkermansia; the abundance of the Lcatobacillus genus was basically the same in the normal group and the model group, but the abundance of this bacterium was significantly increased in each administration group; for the specific changes of each genus, see Figure 11 The composition group showed better effects in the changes of the genera Lachnospiraceae, Prevotella, and Flexispira, and these three genera may be one of the mechanisms by which the synbiotic is more effective than the single component.

[0123] Under normal conditions, the abundances of various gut microbiota are in dynamic balance, and under the multi-pathway participation of the gut microbiota, various life activities of the human body proceed orderly. The occurrence and development of many diseases will lead to the disruption of the balance of the gut microbiota, resulting in a decrease in the types of beneficial bacteria, an increase in the types of harmful bacteria, and changes in the proportions of various bacteria. This change, in turn, will further exacerbate the disease or cause other complications. Therefore, during the treatment of diseases, in addition to the phenotype, the changes in the gut microbiota should also be concerned about.

[0124] Effect of the composition in Example 5 on short-chain fatty acids in fecal metabolites of mice with kidney yin deficiency syndrome

[0125] 1. Method

[0126] 1.1 Sample pretreatment

[0127] Preparation of standard curve: Appropriate amounts of pure standard products of acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, and caproic acid were measured and prepared into ten mixed standard concentration gradients of 0.02 μg / mL, 0.1 μg / mL, 0.5 μg / mL, 2 μg / mL, 10 μg / mL, 25 μg / mL, 50 μg / mL, 100 μg / mL, 250 μg / mL, and 500 μg / mL with ether. The stock solution and the working standard solution were both stored at 0 °C.

[0128] Extraction of metabolites: After the mice in Example 3 finished drug administration, 2-3 fresh feces of each group of mice were collected into a sterilized centrifuge tube and stored at -80 °C for later use. An appropriate amount of the sample was taken into a 2 mL centrifuge tube, 50 μL of 15% phosphoric acid was added, then 100 μL of an internal standard (isohexanoic acid) solution at 125 μg / mL and 400 μL of ether were added, and homogenized for 1 min. Centrifuged at 12000 rpm at 4 °C for 10 min, and the supernatant was taken for on-machine testing.

[0129] 1.2 LC-MS conditions

[0130] Chromatographic conditions: Chromatographic column Agilent HP-INNOWAX capillary column (30 m × 0.25 mm ID × 0.25 μm); Split injection, injection volume 1 μL, split ratio 10:1. Injection port temperature 250 °C; Ion source temperature 300 °C; Transfer line temperature 250 °C. The initial temperature of the programmed temperature rise was 90 °C; then it was heated to 120 °C at a rate of 10 °C / min; then it was heated to 150 °C at a rate of 5 °C / min; finally, it was heated to 250 °C at a rate of 25 °C / min and maintained for 2 min. The carrier gas was helium, and the carrier gas flow rate was 1.0 mL / min.

[0131] Mass spectrometry conditions: Electron impact ionization (EI) source, SIM scanning mode, electron energy 70 eV.

[0132] 1.3 Methodological verification

[0133] Precision: The standard sample with a mixed standard concentration of 25 μg / mL was injected continuously eight times to calculate the within-day precision, expressed as RSD. One 25 μg / mL standard sample was processed every day and measured on the first, second, and third days to calculate the between-day precision, expressed as RSD.

[0134] Repeatability: Six samples were repeatedly processed according to "Metabolite Extraction" to obtain the concentration for calculating repeatability, expressed as RSD.

[0135] Recovery rate: Six low, medium, and high concentration quality control samples (low concentration - LQC quality control sample, medium concentration - MQC quality control sample, high concentration - HQC quality control sample, and the following tables all use the abbreviations LQC, MQC, HQC) were processed in parallel according to "Metabolite Extraction". The recovery rate was measured on the same day. Since short-chain fatty acids are endogenous substances, the recovery rate = (actual value - theoretical value) / added amount × 100%.

[0136] 1.4 Standard curve and limit of quantification

[0137] Each working standard solution was detected by LC-MS. The concentration of the working standard solution was used as the abscissa, and the ratio of the peak area to the internal standard was used as the ordinate to investigate the linear range and draw the standard curve.

[0138] 2. Results

[0139] 2.1 Results of method validation

[0140] Precision: The within-day precision was between 1.00% and 1.85%, and the between-day precision was between 4.76% and 11.73%, indicating good precision of the instrument. The results of precision and repeatability are shown in Table 2; the results of recovery rate are shown in Table 3.

[0141] The results showed good linearity of each substance within the concentration range. The within-day and between-day precisions and repeatability were all less than 15%, and the recovery rate was between 85% and 110%, meeting the analysis requirements of the samples, indicating that this method is stable and reliable and can be applied to the detection of samples.

[0142] Table 2 Precision and repeatability

[0143] Name Quantitative Ion Intraday Precision RSD / % Interday Precision RSD / % Repeatability RSD / % Acetic Acid 60 1.85 11.73 5.44 Propionic Acid 74 1.73 5.28 4.72 Isobutyric Acid 73 1.31 4.76 5.65 Butyric Acid 60 1.57 6.87 5.51 Isovaleric Acid 60 1.35 6.63 7.59 Valeric Acid 60 1.30 5.66 7.68 Caproic Acid 60 1.00 7.71 9.53

[0144] Table 3 Recovery rate

[0145] Name LQC Recovery RSD MQC Recovery RSD HQC Recovery RSD Acetic Acid 1μg / mL 90.34% 25μg / mL 97.25% 100μg / mL 106.31% Propionic Acid 1μg / mL 94.55% 25μg / mL 87.81% 100μg / mL 87.53% Isobutyric Acid 1μg / mL 107.07% 25μg / mL 86.17% 100μg / mL 85.20% Butyric Acid 1μg / mL 96.35% 25μg / mL 85.56% 100μg / mL 86.38% Isovaleric Acid 1μg / mL 92.82% 25μg / mL 85.50% 100μg / mL 85.80% Valeric Acid 1μg / mL 99.25% 25μg / mL 88.16% 100μg / mL 89.19% Caproic Acid 1μg / mL 85.22% 25μg / mL 96.97% 100μg / mL 96.76%

[0146] 2.2 Standard curve and limit of quantification

[0147] The linear regression equations of each substance are shown in Table 4.

[0148] Table 4 Standard curve and limit of quantification

[0149] Name Retention Time Linear Equation Correlation Coefficient r Linear Range Quantitation Limit Acetic Acid 4.867min y = 0.0304x - 0.0023 0.9951 0.1 - 500ng / mL 0.1ng / mL Propionic Acid 5.945min y = 0.0316x - 0.0146 0.9933 0.5 - 500ng / mL 0.5ng / mL Isobutyric Acid 6.321min y = 0.0358x - 0.0157 0.9926 0.5 - 500ng / mL 0.5ng / mL Butyric Acid 7.253min y = 0.0827x - 0.0013 0.9937 0.02 - 500ng / mL 0.02ng / mL Isovaleric Acid 7.901min y = 0.086x + 0.0037 0.9987 0.02 - 500ng / mL 0.02ng / mL Valeric Acid 9.058min y = 0.0871x - 0.0014 0.9904 0.02 - 500ng / mL 0.02ng / mL Caproic Acid 10.37min y = 0.0632x + 0.0028 0.9935 0.02 - 500ng / mL 0.02ng / mL

[0150] 2.3 Short-chain fatty acid contents in each group of mice

[0151] The total ion current chromatogram is as follows Figure 12 . According to the methodological verification, linear equation, limit of quantification and chromatogram, it can be seen that this method has good repeatability, high sensitivity and accuracy. The SCFAs contents in each group measured by the above method are as follows Figure 13 shown. It can be seen from the figure that compared with the normal group, the contents of acetic acid and propionic acid in the fecal metabolites of the kidney yin deficiency syndrome model group decreased significantly (p < 0.01), the contents of isobutyric acid, butyric acid, isovaleric acid and valeric acid decreased slightly, and the content of caproic acid increased slightly. After administration, the contents of acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid and valeric acid all increased. Among them, the increase amplitude of the synbiotic group was the largest. The change of caproic acid content among all groups was small and the content was very low, indicating that caproic acid has little influence during the occurrence and treatment of kidney yin deficiency syndrome and can be ignored. The contents of isobutyric acid, isovaleric acid and valeric acid in the synbiotic group increased significantly compared with those in the model group (p < 0.01), suggesting that the effect of the composition described in this application is closely related to these three short-chain fatty acids.

[0152] It can be seen from the results that the contents of acetic acid, propionic acid, isobutyric acid, butyric acid and valeric acid in the kidney yin deficiency syndrome model group all decreased, indicating that the onset of kidney yin deficiency syndrome is related to multiple short-chain fatty acids, and increasing the content of short-chain fatty acids is helpful for the improvement of kidney yin deficiency syndrome. After administration, the contents of isobutyric acid, isovaleric acid and valeric acid in the composition group described in this application increased significantly.

Claims

1. A composition for treating kidney yin deficiency syndrome, characterized in that, The composition is composed of polygonatum water extract and plant lactobacillus liquid; The volume ratio of the polygonatum water extract to the Lactobacillus plantarum liquid is 1:1; The Lactobacillus plantarum is Lactobacillus splantarum GL-5, and the Lactobacillus plantarum Lactobacillus plantarum GL-5 was deposited at the China General Microbiological Culture Collection Center on November 21, 2019, with the deposit number: CGMCC No. 18988; The preparation method of the Lactobacillus plantarum bacterial liquid comprises: culturing and activating the Lactobacillus plantarum on a solid culture medium, inoculating the activated Lactobacillus plantarum into a liquid culture medium for cultivation, and collecting the bacterial liquid by centrifugation to obtain the Lactobacillus plantarum bacterial liquid; The preparation method of the polygonatum water extract is as follows: taking polygonatum powder, soaking it in water, heating and boiling it, and taking the filtrate to obtain the polygonatum water extract.

2. The composition according to claim 1, wherein The preparation method of the plant lactobacillus liquid is: (1) culturing and activating Lactobacillus plantarum on a solid culture medium at 37° C. for 24-48 hours; (2) inoculating a single colony of the activated Lactobacillus plantarum into 10 mL of a liquid culture medium containing 52.24 g MRS broth / L, and culturing at 37° C. for 24 h to obtain a first-generation bacterial solution; (3) Take 400 μL of the first-generation bacterial solution and inoculate it into 9.6 mL of the liquid culture medium described in step (2), and culture it at 37° C. for 24 h to obtain the second-generation bacterial solution. The bacterial solution is collected by centrifugation to obtain the Lactobacillus plantarum bacterial solution.

3. The composition according to claim 1, wherein The preparation method of the polygonatum water extract is as follows: taking polygonatum powder, soaking it in 10 times the volume of purified water overnight, heating and decocting it for 1 hour after overnight, filtering the residue and adding 8 times the volume of purified water to decoct it for 1 hour again, combining the filtrate, concentrating it to 0.5g / mL, taking the supernatant after centrifugation, and sterilizing it to obtain the polygonatum water extract.

4. Use of the composition as claimed in any one of claims 1 to 3 in the preparation of a drug for treating kidney yin deficiency syndrome.

Citation Information

Patent Citations

  • Special diet edible for patients with kidney yin deficiency

    CN103431407A

  • Lactobacillus plantarum GL-5 with oxidation resisting activity and application thereof

    CN111304117A