A method for preparing stable isotope labeled ssDNA by biological fermentation

Abstract

The present invention provides a method for preparing stable isotope-labeled single-stranded DNA (ssDNA) by biological fermentation, belonging to the technical field of DNA synthesis. In the method of the present invention, the target sequence of ssDNA is tandemly repeated on a high-copy vector, and by adding the site of a first restriction endonuclease and the site of a second restriction endonuclease to the 5' and 3' ends of the target sequence respectively, after digesting the recombinant vector, an asymmetric double-stranded DNA structure is obtained, and then two ssDNAs with different lengths are obtained by denaturation separation, including 15 N or 13 C-labeled target ssDNA. The method of the present invention can effectively improve the yield of ssDNA, thereby improving the in vitro synthesis efficiency of ssDNA. Moreover, the culture medium used for culturing the host bacteria in the present invention uses 15 N-labeled NH4Cl as the sole nitrogen source and / or 13 C-labeled glucose as the sole carbon source, which can effectively reduce the synthesis cost.

Description

Technical Field

[0001] The invention belongs to the technical field of DNA synthesis, and in particular relates to a method for preparing stable isotope-labeled ssDNA by a biological fermentation method. Background Art

[0002] Most DNA exists in a double-stranded form as a double helix, but once treated with heat or alkali, it will become a single-stranded state. Single-stranded DNA (ssDNA) refers to DNA that exists in this state. ssDNA is different from double-stranded DNA (dsDNA) in terms of molecular fluid dynamics, absorption spectrum, base reaction properties, three-dimensional structure and function. It is worth noting that ssDNA can fold to form a three-dimensional structure and plays an important role in life processes. For example, the G quadruplex structure is considered to be a potential target for anti-cancer drugs. Stable isotope-labeled ssDNA can facilitate the nuclear magnetic resonance analysis of the three-dimensional structure of ssDNA.

[0003] The current method for obtaining stable isotope-labeled ssDNA on the market is solid phase synthesis, but this method is expensive to synthesize. It costs about 330,000 RMB to synthesize a 24nt, 1mg ssDNA chain. In addition, for samples with high GC content, the preparation process is prone to confusion or secondary structures hindering the work of polymerase. Therefore, the development of a universal method for preparing stable isotope-labeled ssDNA is an urgent problem to be solved in this field. Summary of the invention

[0004] The purpose of the present invention is to provide a method for preparing stable isotope labeled ssDNA by biological fermentation. The method of the present invention is a universal stable isotope 15 N and / or 13 The method of C labeling ssDNA can effectively improve 15 N and / or 13 C-labeled ssDNA can be synthesized efficiently in vitro and at a lower cost.

[0005] The present invention provides a method for preparing stable isotope labeled ssDNA by biological fermentation, comprising the following steps:

[0006] 1) adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit;

[0007] The first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases;

[0008] 2) connecting the repeating units in step 1) in series to obtain a fusion sequence;

[0009] 3) inserting the fusion sequence in step 2) into a high copy vector to obtain a recombinant vector;

[0010] 4) introducing the recombinant vector described in step 3) into a host bacterium to obtain a recombinant bacterium;

[0011] 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used in the culture is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source;

[0012] 6) using the first restriction endonuclease and the second restriction endonuclease to digest the recombinant vector in step 5) to obtain an asymmetric double-stranded DNA structure, and separating two ssDNAs of different lengths, one of which is the target sequence;

[0013] 7) Recovering the target sequence in the two ssDNAs in step 6) to obtain a stable isotope-labeled target ssDNA.

[0014] Preferably, in step 1), the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI; alternatively, the first restriction endonuclease is KpnI-HF and the second restriction endonuclease is BamHI-HF; alternatively, the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is HindIII-HF; alternatively, the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF.

[0015] Preferably, in step 4), the shorter of the two ssDNAs of unequal lengths is the target sequence.

[0016] Preferably, in step 2), every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are further connected in series via a linker sequence.

[0017] Preferably, in step 2), the length of the fusion sequence is ≤2k.

[0018] Preferably, in step 3), the high copy vector includes pUC57.

[0019] Preferably, in step 1), the target sequence includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA; the nucleotide sequence of the telomeric ssDNA is shown in SEQ ID NO.1; the nucleotide sequence of the human promoter ssDNA is shown in SEQ ID NO.2; the nucleotide sequence of the HIV ssDNA is shown in SEQ ID NO.3.

[0020] Preferably, when the target sequence is telomeric ssDNA, 12 repeating units in step 2) are connected in series; when the target sequence is human promoter ssDNA, 20 repeating units in step 2) are connected in series; when the target sequence is HIV ssDNA, 15 repeating units in step 2) are connected in series.

[0021] Preferably, in step 5), the culture medium 15 The concentration of NH4Cl is ≥1g / L; 13 C-glucose concentration ≥4g / L.

[0022] Preferably, step 7) further comprises recovering another ssDNA except the target sequence.

[0023] The present invention provides a method for preparing stable isotope labeled ssDNA by biological fermentation. The method of the present invention repeats and concatenates the target sequence of ssDNA on a high copy vector, and respectively adds a first restriction endonuclease site and a second restriction endonuclease site at the 5' and 3' ends of the target sequence, and after enzyme digestion of the recombinant vector, an asymmetric double-stranded DNA structure can be obtained, and then two ssDNAs of different lengths can be separated, including 15 N and / or 13 The target ssDNA is labeled with C. The method of the present invention can effectively increase the yield of ssDNA, thereby improving the in vitro synthesis efficiency of ssDNA. In addition, the medium used in culturing the host bacteria of the present invention is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source, which can effectively reduce the synthesis cost of stable isotope labeled DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0025] Figure 1 is the stable isotope in Example 1 15 Schematic diagram of the N-labeled telomeric ssDNA, where A is the formation of the plasmid pUC57-wtTel23c; B is the transformation of the constructed plasmid into DH5α E. coli cells for propagation; C is the DH5α E. coli cells transformed with pUC57-wtTel23c in 15 The cells were grown in M9 medium with N-labeled NH4Cl as the sole nitrogen source to produce15 N is the pUC57-wtTel23c plasmid; D is the purified plasmid treated with restriction endonucleases KpnI and BamHI 15 N-labeled pUC57-wtTel23c plasmid; F is the digestion product obtained in the form of asymmetric dsDNA; G is the further separation and purification of asymmetric dsDNA by urea-denatured polyacrylamide gel electrophoresis; H is the recovery and electroelution of target ssDNA to obtain target 15 N-labeled ssDNA;

[0026] Figure 2 for 15 The identification results of N-labeled wtTel23c, where A is 15 N-labeled wtTel23c 15 The mass spectrometry analysis results of N labeling rate, reference is the reference ssDNA wtTel23c synthesized by solid phase synthesis, NA-wtTel23c is the natural abundance isotope labeled wtTel23c prepared by biosynthesis according to the method of the present invention, 15 N-wtTel23d 15 N-labeled wtTel23; B is the 1D 1H-NMR spectrum of G4 formed by wtTel23c and the reference substance, respectively, and the imino proton region; C and D are the 2D 1H-NMR spectra of G4 formed by wtTel23c and the reference substance, respectively. 1 H- 15 N sfHMQC( 1 H- 15 The imino region of the N band-selective optimized flip-angle short-transient heteronuclear multiple quantum coherence) spectrum, the reference is ssDNA with the same sequence as the solid phase synthesis;

[0027] Figure 3 For the cell-like environment and K + Comparison results of sfHMQC 2D spectra of wtTel23c-TMPyP4 complex in dilute solution, where the red spectrum represents K + The signal of wtTel23c-TMPyP4 complex in dilute solution environment; the black spectrum represents the signal of wtTel23c-TMPyP4 complex in cell-like environment;

[0028] Figure 4 is the stable isotope in Example 3 15Schematic diagram of N-labeled human promoter c-myc ssDNA, in which the gray part of the plasmid represents the pUC57 vector sequence; the green part represents the BsmB I restriction site; the blue part represents the tandemly repeated target gene (PU22) 20 , the local enlarged image shows a target gene unit PU22 (the difference from PU22C is that there is one less C base at the 5' end), the ellipsis indicates the target gene is repeated in series, and the sequence indicated by the hollow arrow indicates the double-stranded DNA sequence of different lengths obtained by double digestion of pUC57-PU22C with Hind III-HF and Kpn I-HF; after purification by denaturing polyacrylamide gel electrophoresis, two ssDNAs of different lengths are obtained, namely PU22C and PU30C;

[0029] Figure 5 The results of gel detection and restriction digestion of plasmids in Example 5, wherein A is the result of 1% agarose gel electrophoresis to detect the purified plasmid pUC57-PU22C; B is the result of 8% acrylamide gel electrophoresis to detect the step-by-step double restriction digestion of the plasmid, lane Hind III-HF indicates that the plasmid is first digested with Hind III-HF, and lane Kpn I-HF indicates that the plasmid is digested with HindIII-HF and then with Kpn I-HF; C is the ssDNA (PU22C) obtained by 12% acrylamide gel electrophoresis, and lane reference indicates the solid-phase synthesized ssDNA with the same sequence as PU22C;

[0030] Figure 6 For the mutual titration of CX5461 and PU22C 1 H- 15 N sfHMQC NMR spectrum, in which the gray spectrum represents the free PU22C, the red spectrum represents the bound PU22C, and the ratio marked in the figure is the titration ratio of PU22C and CX5461;

[0031] Figure 7 For the mutual titration of CX5461 and PU22C 2 J HN - 1 H- 15 N HSQC NMR spectrum, in which the gray spectrum represents the free PU22C, the red spectrum represents the bound PU22C, and the ratio marked in the figure is the titration ratio of PU22C and CX5461;

[0032] Figure 8 is the stable isotope in Example 6 15Schematic diagram of HIV ssDNA labeled with N, in which the gray part of the plasmid represents the pUC57 vector sequence, the green part represents the BsmB I restriction site; the blue part represents the tandemly repeated target gene (LTR-III) 16 , the local enlarged image shows a target gene unit LTR-III, the ellipsis indicates the target gene is repeated in series, the sequence indicated by the hollow arrow indicates the double-stranded DNA sequence of different lengths obtained by double digestion of pUC57-LTR-III with Pst I-HF and HindⅢ-HF; after urea denatured polyacrylamide gel electrophoresis and purification, two ssDNAs of different lengths are obtained, namely LTR-III and LTR-C;

[0033] Figure 9 To collect 2D 1 H- 15 The fingerprint of the interaction between LTR-III G4 and the ligand Braco-19 was obtained by N sfHMQC spectrum, where the molar ratio of G4 to the ligand interaction (G4: Braco-19) is shown in the upper left corner of the figure;

[0034] Figure 10 The effect of complex cell environment on the conformation of LTR-III G4, where the concentration of cell lysate is shown in the upper left corner of the figure; the gray background image represents the spectrum information of LTR-III G4 when no cell lysate is added; the red spectra (A-C) represent the spectrum information of LTR-III G4 obtained under different concentrations of cell lysate;

[0035] Figure 11 The interaction between LTR-III G4 and ligand Braco-19 in a complex cell environment. The gray background image represents the spectrum signal of free LTR-III G4 under the condition of 50 mg / mL cell concentration; the red spectrum represents the spectrum information of the complex at different titration ratios under the condition of cell extract;

[0036] Figure 12 for 1 H- 13 The C HSQC spectrum characterizes the CH signals of various bases. DETAILED DESCRIPTION

[0037] The present invention provides a method for preparing stable isotope labeled ssDNA by biological fermentation, comprising the following steps:

[0038] 1) adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit; the first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases;

[0039] 2) connecting the repeating units in step 1) in series to obtain a fusion sequence;

[0040] 3) inserting the fusion sequence in step 2) into a high copy vector to obtain a recombinant vector;

[0041] 4) introducing the recombinant vector described in step 3) into a host bacterium to obtain a recombinant bacterium;

[0042] 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used in the culture is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source;

[0043] 6) using the first restriction endonuclease and the second restriction endonuclease to digest the recombinant vector in step 5) to obtain an asymmetric double-stranded DNA structure, and separating two ssDNAs of different lengths, one of which is the target sequence;

[0044] 7) Recovering the target sequence in the two ssDNAs in step 6) to obtain a stable isotope-labeled target ssDNA.

[0045] The present invention firstly adds a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence respectively to obtain a repeating unit.

[0046] In the present invention, the length of the target sequence is preferably less than 100 nt.

[0047] In the present invention, the target sequence includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA; the nucleotide sequence of the telomeric ssDNA is shown in SEQ ID NO.1, specifically: 5'-tagggttagggttagggttaggg-3', named wtTel23; the nucleotide sequence of the human promoter c-myc ssDNA is shown in SEQ ID NO.2, specifically: 5'-ctgagggtgggtagggtgggtaa-3', named PU22C; the nucleotide sequence of the HIV ssDNA is shown in SEQ ID NO.3, specifically: 5'-gggaggcgtggcctgggcgggactgggg-3', named LTR-III.

[0048] In the present invention, the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI; or, the first restriction endonuclease is KpnI-HF and the second restriction endonuclease is BamHI-HF; or, the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is HindIII-HF; or, the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF. The restriction endonuclease in the above combination has high enzyme digestion efficiency and can ensure that the shorter of the two ssDNAs of different lengths obtained in the subsequent scheme is the target sequence.

[0049] In the present invention, when the target sequence is telomeric ssDNA, the first restriction endonuclease is preferably KpnI and the second restriction endonuclease is preferably BamHI.

[0050] In the present invention, when the target sequence is human promoter ssDNA, the first restriction endonuclease is preferably Kpn I-HF and the second restriction endonuclease is preferably HindIII-HF.

[0051] In the present invention, when the target sequence is HIV ssDNA, the first restriction endonuclease is preferably PstI-HF and the second restriction endonuclease is preferably HindIII-HF.

[0052] After obtaining the repeating units, the present invention connects the repeating units in series to obtain a fusion sequence.

[0053] In the present invention, every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are connected in series through a linker sequence; the linker sequence preferably does not contain a repeating sequence and is longer than the target sequence for subsequent separation; in the present invention, the length of the linker sequence is preferably 50 to 200 nt; the advantage of connecting the linker sequence in series is to reduce the difficulty of plasmid synthesis. In the present invention, the length of the fusion sequence is preferably ≤2k, more preferably 1.3 to 2k. This length range not only meets the requirements for constructing a recombinant vector, but also can increase the number of repetitions of the target sequence to increase its yield.

[0054] In the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is obtained by connecting 12 repeating units in series; more preferably, every 3 repeating units are connected in series to form one large repeating unit.

[0055] In the present invention, when the target sequence is a human promoter ssDNA, the fusion sequence is obtained by connecting 20 repeating units in series; more preferably, every 4 repeating units are connected in series to form one large repeating unit.

[0056] In the present invention, when the target sequence is HIV ssDNA, the fusion sequence is obtained by connecting 15 repeating units in series; more preferably, every 3 repeating units are connected in series to form one large repeating unit.

[0057] After obtaining the fusion sequence, the present invention inserts the fusion sequence into a high copy vector to obtain a recombinant vector.

[0058] In the present invention, the high copy vector preferably includes pUC57, which is purchased from Nanjing GenScript Corporation.

[0059] In the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is preferably ligated into the pUC57 vector at the BsmBI restriction endonuclease site.

[0060] In the present invention, when the target sequence is a human promoter ssDNA, the fusion sequence is preferably connected to the pUC57 vector at the EcoRV restriction endonuclease site.

[0061] In the present invention, when the target sequence is HIV ssDNA, the fusion sequence is preferably ligated into the pUC57 vector at the BsmBI restriction endonuclease site.

[0062] After obtaining the recombinant vector, the present invention introduces the recombinant vector into a host bacterium to obtain the recombinant bacterium.

[0063] In the present invention, the host bacteria preferably include Escherichia coli; the Escherichia coli preferably includes DH5α Escherichia coli. The mutation probability of DNA replication in DH5α Escherichia coli cells is very low, about 10 -10 , which is four orders of magnitude lower than that of high-fidelity PCR polymerase.

[0064] After obtaining the recombinant bacteria, the present invention cultured the recombinant bacteria, extracted and purified the recombinant vector in the recombinant bacteria; the culture medium used in the culture is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source.

[0065] In the present invention, the culture medium preferably comprises 15 NH4Cl and / or 13 C-glucose M9 culture medium, the present invention is 15 NH4Cl and / or 13 C-glucose is the raw material for biological fermentation and has the advantage of low cost; 15 The concentration of NH4Cl is preferably ≥1 g / L, more preferably 1 g / L; 13The concentration of C-glucose is preferably ≥ 4 g / L, more preferably 4 g / L, which is the minimum amount required to ensure that the culture medium has sufficient nitrogen and carbon sources, thus saving costs.

[0066] After obtaining the extracted and purified recombinant vector, the present invention uses the first restriction endonuclease and the second restriction endonuclease to digest the extracted and purified recombinant vector to obtain an asymmetric double-stranded DNA structure, and separates two ssDNAs of different lengths, one of which is the target sequence.

[0067] In the present invention, the separation to obtain two ssDNAs of different lengths preferably includes separation to obtain two ssDNAs of different lengths by urea-denatured polyacrylamide gel electrophoresis. This method has the advantages of simple operation and low cost.

[0068] In the present invention, the urea denatured polyacrylamine gel electrophoresis is preferably a urea denatured polyacrylamine gel electrophoresis with a volume concentration of 12%, 12% refers to the volume fraction of acrylamide in the polyacrylamide gel; the urea denatured polyacrylamine gel electrophoresis is based on 500 mL, and preferably includes the following components: 10×TBE 50 mL, 40% Acry (19:1) 150 mL, urea 210 g and the remainder of water.

[0069] After obtaining two ssDNAs, the present invention recovers the target sequences in the two ssDNAs to obtain the target ssDNAs labeled with stable isotopes.

[0070] If the complementary strand of the target sequence is also worthy of research, the present invention preferably further comprises recovering another ssDNA other than the target sequence, that is, recovering the complementary strand of the target sequence, so that two different strands can be obtained in one preparation. 15 N and / or 13 C-labeled ssDNA.

[0071] Preparation of the present invention 15 The method of N-labeled ssDNA is a bio-fermentation synthesis method, which can synthesize stable isotopes. 15 N-labeled ssDNA has high labeling efficiency (labeling efficiency up to 96%), low synthesis cost (compared with commercial products, the cost is reduced by 90%), and high yield (1L M9 culture medium can produce 8.1g 15 N-labeled plasmid), low mutation rate (mutation rate is 10 -10 Compared with the high-fidelity PCR polymerization reaction, the mutation rate is reduced by two orders of magnitude) and other advantages. It is suitable for the synthesis of common ssDNA and ssDNA sequences rich in repetitive sequences.

[0072] In one embodiment of the present invention, when the target sequence is telomeric ssDNA, the fusion sequence is obtained by connecting 12 repeating units in series; every 3 repeating units are connected in series to form a large repeating unit; the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the BsmBI restriction endonuclease site; the two ssDNAs of different lengths are the short target sequence wtTel23c and the long byproduct wtTel34; the nucleotide sequence of wtTel34 is shown in SEQ ID NO.4, specifically: 5'-gatccccttacccttacccttacccctaggta-3'. 15 N-labeled telomeric ssDNA can significantly reduce 2D 1 H- 15 The acquisition time of NsfHMQC (flip-angle short-transient heteronuclear multiple quantum coherence spectrum) spectra is greatly improved, which lays the foundation for characterizing the G quadruplex (G4) structure and its interaction with ligands in the cellular environment.

[0073] In one embodiment of the present invention, when the target sequence is human promoter ssDNA, the fusion sequence is obtained by connecting 20 repeating units in series; every 4 repeating units are connected in series to form one large repeating unit; the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the EcoRV restriction endonuclease site; the two ssDNAs of different lengths are the short target sequence PU22C and the long PU30C sequence; the nucleotide sequence of PU30C is shown in SEQ ID NO.5, specifically: 5'-agctttacccaccctacccaccctcaggtac-3'. Compared with the naturally abundant human promoter sequence, the stable isotope prepared by the method of the present invention is 15 The N-uniformly labeled human promoter ssDNA sequence has the following two advantages: (1) it can improve the sensitivity of nuclear magnetic resonance detection and significantly increase the sensitivity of nuclear magnetic resonance detection. 1 H- 15 The collection efficiency of N 2D NMR spectra is 99.63% of the natural abundance of nitrogen atoms is 14 N, with a spin of 1 and a quadrupole moment of 2.044 fm 2 . 15 The natural abundance of N is 0.364% and the spin is 1 / 2. 14N abundance is very high and it also has spin, but due to the quadruple moment, the relaxation rate is fast and the spectrum is wide, which is not suitable for two-dimensional nuclear magnetic resonance spectrum acquisition. 15 The N spectrum signal has a narrow half-peak width, which is more conducive to analyzing the precise structural information of biological macromolecules. Therefore, the nitrogen spectra of biological macromolecules usually collected are specifically 15 N NMR spectrum. So improve 15 The abundance of N can be increased 15 N signal sensitivity, thereby improving the collection efficiency of the spectrum. (2) Stable isotopes 15 N-uniformly labeled human promoter sequences can be used to study the human promoter G4 topology and its interaction with ligands in complex cellular environments. 15 N uniformly labeled human promoter G4, except that the target human promoter G4 is 15 N-labeled, and other background molecules were 15 N has a natural abundance (0.364%), so the background interference of its NMR spectrum signal is small, and the target molecule can be directly collected. 15 N signal. So in situ in the cell 15 When collecting N-G4 signals, 1 H- 15 In the spectrum collection of NHSQC or HMQC, the background signal can be ignored and the interference of the background signal is small.

[0074] In one embodiment of the present invention, when the target sequence is HIV ssDNA, the fusion sequence is obtained by connecting 15 repeating units in series; every 3 repeating units are connected in series to form a large repeating unit; the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is HindⅢ-HF; the high copy vector is pUC57; the fusion sequence is connected to the pUC57 vector at the BsmBI restriction endonuclease site; the two ssDNAs of different lengths are the short target sequence LTR-III and the long byproduct LTR-C; the nucleotide sequence of the LTR-C is shown in SEQ ID NO.6, specifically: 5'-gatcccccagtcccgcccaggccacgcctccctgca-3'; the nucleotide sequence of the LTR-III is shown in SEQ ID NO.3. Stable isotopes prepared by the method of the present invention 15 N-uniformly labeled HIV ssDNA sequence LTR-III can improve the sensitivity of NMR signal acquisition and can be used in traditional 15 In addition, the stable isotope prepared by the method of the present invention 15HIV ssDNA uniformly labeled with N can also be used for NMR studies of HIV LTR-III G4 structure and its interaction with ligands in complex cell extracts, providing a new platform for drug screening targeting HIV LTR-III G4 in complex cell environments.

[0075] In the present invention, wtTel34, PU30C and LTR-C, these ssDNAs are rich in C bases, which can fold to form a functional i-motif structure, and are also used for NMR studies of the i-motif structure and its interaction with ligands.

[0076] In order to further illustrate the present invention, a method for preparing stable isotope-labeled ssDNA by a biological fermentation method provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0077] In the embodiment of the present invention, the high copy vector pUC57 was purchased from Nanjing GenScript Co., Ltd., and the fusion sequence was synthesized by Nanjing GenScript Co., Ltd.

[0078] Example 1 Stable Isotopes 15 Preparation method of N-labeled telomeric ssDNA

[0079] Experimental principles of plasmid design Figure 1 As shown, the target sequence of this embodiment is telomeric ssDNA, For example, the sequence is named wtTel23.

[0080] The overall design of the plasmid is used to obtain 15 N-labeled DNA. In order to increase the yield of the target DNA, two different restriction endonuclease sites, Kpn I and BamH I, were added to the 5' and 3' ends of the target sequence (in bold font) to obtain a repeating unit. The nucleotide sequence of the repeating unit is shown in SEQ ID NO.7, specifically: The repeating units were connected in series 12 times to obtain a fusion sequence (the nucleotide sequence is shown in SEQ ID NO.8, specifically: Every three repeat units were connected to a linker with a random sequence (yellow) to facilitate plasmid construction, and the fusion sequence was ligated into the pUC57 vector in series at the BsmBI restriction endonuclease site to form the plasmid pUC57-wtTel23c (see Figure 1 The constructed plasmid was transformed into DH5α E. coli cells for propagation (see Figure 1 B) DH5α E. coli cells transformed with pUC57-wtTel23c were grown in 15The cells were grown in M9 medium with N-labeled NH4Cl as the sole nitrogen source to produce 15 N-labeled pUC57-wtTel23c plasmid (see Figure 1 C) The purified protein was treated with restriction endonucleases KpnI and BamHI 15 N-labeled pUC57-wtTel23c plasmid (see Figure 1 D and E in Figure 1). The double-stranded DNA structure was generated by double digestion with BamH I and Kpn I. Two ssDNAs of different lengths were obtained by separation using urea-denaturing polyacrylamide gel electrophoresis: wtTel23c: 5'-tagggttagggttagggttaggg-3'; wtTel34: 5'-gatccccttacccttacccttacccctaggta-3'. The digestion product was obtained in the form of asymmetric dsDNA (see Figure 1 F in the figure). The asymmetric dsDNA was further separated and purified by urea-denatured polyacrylamide gel electrophoresis (45 cm × 35 cm) (see Figure 1 G in the figure). The target ssDNA is recovered and electroeluted to obtain the target 15 N-labeled ssDNA. (See Figure 1 H in.

[0081] Methods:

[0082] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0083] Select a single clone and culture it in 5 mL TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL TB medium. After 3 h, collect the bacteria by centrifugation and transfer them into 150 mL of 1 g / L TB medium. 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 In fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when OD = 1.0, and continue to culture at 37°C for 9 hours. Collect the bacteria by centrifugation, wash with STE buffer, and wait for purification.

[0084] 2. Large-scale plasmid extraction and purification

[0085] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0086] The buffer solutions used in the following experimental steps all use water as the solvent. The formula is shown below, and the amount is suitable for 2LM9 cultured bacteria.

[0087] STE buffer: 10mM Tris-HCl pH 8.0, 100mM NaCl, 1mM EDTA pH 8.0, sterilized at high temperature, precooled at 4°C before use;

[0088] S1 solution: 25mM Tris-HCl pH 8.0, 50mM glucose, 10mM EDTA pH 8.0, sterilized at high temperature, used at room temperature;

[0089] S2: Prepare fresh each time, 0.2M NaOH, 1% m / V SDS, use at room temperature;

[0090] S3 solution: 3M KAc, 2M HAc, precool at 4℃ before use;

[0091] Isopropyl alcohol: Use at room temperature;

[0092] 70% ethanol in water (70% ethanol): precool to 4°C before use;

[0093] 4M NaCl: autoclaved;

[0094] 40% PEG 6000: high temperature sterilization;

[0095] TE 10 / 0.1: 10 mM Tris-HCl pH 8.0, 0.1 mM EDTA, autoclaved;

[0096] TE 10 / 50: 10 mM Tris-HCl pH 8.0, 50 mM EDTA, autoclaved;

[0097] 3M NaAc: pH 5.2.

[0098] 2.1 Plasmid extraction

[0099] (1) Resuspend the cells in 60 mL of pre-cooled S1 solution, slowly add 120 mL of S2, gently invert to mix, and let stand at room temperature for 3 to 5 min until the mixture becomes uniform and transparent with high viscosity and a stringy appearance. Then add 210 mL of pre-cooled S3 solution and shake in the same direction until the liquid phase is not separated.

[0100] (2) Incubate on ice for 10 min.

[0101] (3) Centrifuge at 7500 rpm for 20 min and filter with a membrane to remove large precipitates.

[0102] (4) Add 0.52 times the volume of isopropanol and leave at room temperature for 15 min.

[0103] (5) Collect the precipitate by centrifugation and add an appropriate amount of pre-cooled 75% ethanol to wash the precipitate.

[0104] (6) Centrifuge to remove the ethanol solution and evaporate to remove the residual ethanol.

[0105] (7) Add an appropriate volume of TE10 / 50 to dissolve the precipitate.

[0106] (8) Add 160 μL RNase A (25 mg / mL) and digest at 37°C overnight.

[0107] (9) Detect RNA hydrolysis using 1% agarose gel electrophoresis.

[0108] 2.2.8 Plasmid purification

[0109] (1) Add 1 / 5 volume of 4M NaCl and 2 / 5 volume of 40% PEG6000 and place at 37°C for 5 min.

[0110] (2) Incubate on ice for 1 h.

[0111] (3) Centrifuge at 13000 rpm for 30 min, collect the precipitate, and wash it with 70% ethanol.

[0112] (4) Remove the ethanol, evaporate the residual ethanol, and dissolve the precipitate in an appropriate volume of TE10 / 0.1.

[0113] (5) Add 1 / 5 volume of phenol-chloroform (25:24:1), mix well, centrifuge at 13,000 rpm for 30 min, and remove the organic phase.

[0114] (6) Repeat step (4) until no more white precipitate appears at the interface between the two phases (generally repeat 2 to 3 times).

[0115] (7) Add 1 / 5 volume of chloroform and isoamyl alcohol (24:1), mix well, centrifuge, and remove the organic phase.

[0116] (8) Add 1 / 10 volume of 3M NaAc pH=5.2; 2.5 volumes of pre-cooled anhydrous ethanol.

[0117] (9) Mix well and place at -20°C overnight.

[0118] (10) Collect the precipitate by centrifugation, drain until there is no ethanol smell, dissolve the precipitate in an appropriate volume of sterile water, detect the ultraviolet absorption spectrum, and record the A260 / A280 ratio.

[0119] 3. Use two restriction endonucleases to perform double digestion of the plasmid to obtain the target double-stranded DNA

[0120] Add 23 μL of deionized water, 5 μL of 10×NEB cutsmart buffer (1×NEB cutsmart buffer, 50 mM KAC, 20 mM Tris-HAC, 10 mM Mg(AC)2, 100 μg / ml BSA, pH=7.9@25°C), 20 μL of plasmid solution (concentration is 200 ng / μL), 2 μL of Kpn I (20 U), 2 μL of BamHI (20 U) to a 200 μL PCR tube and mix well. Place in a 37°C water bath for 4 hours. Use 8% native-PAGE to detect enzyme digestion efficiency. The optimal plasmid concentration for the plasmid double enzyme digestion reaction should be 1000 ng / μL.

[0121] 4. Isolation and purification of target ssDNA

[0122] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) by 12% urea denaturing polyacrylamide gel electrophoresis. Use a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) for electrophoresis, with a constant power of 75 W for 8 h. Perform the electrophoresis experiment in a biochemical incubator at a constant temperature of 30°C.

[0123] (2) Cut the target ssDNA band, pass the gel block through the syringe, and crush it into fine particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50°C water bath overnight (or use an electroelution device to elute the DNA).

[0124] (3) The soaked liquid was filtered through a 0.2 μm filter membrane (if electroelution is used, the liquid in the sample pool is directly aspirated), and then concentrated through a 3K ultrafiltration tube, and ultrafiltered with water for multiple times to finally obtain ssDNA. The naturally abundant ssDNA prepared in this experiment was named NA-wtTel23c. 15 N-labeled ssDNA is named 15 N-wtTel23c.

[0125] (4) Preparation of urea-denatured polyacrylamine gel electrophoresis.

[0126] Example 2

[0127] In order to verify that the target ssDNA (wtTel23c) obtained by E. coli amplification is consistent with the ssDNA sample of the same sequence synthesized by chemical analysis, mass spectrometry, 2D 1 H-NMR and 2D 1 H- 15High performance liquid chromatography-mass spectrometry (LC-MS) was used to determine the molecular weight of the naturally abundant wtTel23c (NA-wtTel23c) synthesized in this experiment and 15 N-wtTel23c 15 N labeling rate. The experimental results are shown in Figure 2 As shown, ( Figure 2 A to C) in the figure are the reference sample (reference) synthesized in solid phase, the non-labeled wtTel23c (NA-wtTel23c) prepared in this experiment, and the 15 N-labeled wtTel23c ( 15 The results showed that the relative molecular weight of the solid phase synthesized reference sample was 7559.94, while the relative molecular weight of NA-wtTel23c with the same sequence was 7640.89, and the relative molecular weight difference between the two was 80.95. This is because the 5' and 3' ends of the solid phase synthesized wtTel23c both ended with hydroxyl groups, while NA-wtTel23c was obtained by restriction endonuclease, and its 5' end was a phosphate group and the 3' end was a hydroxyl group. Compared with the solid phase synthesized reference sample, the NA-wtTel23c molecular composition has one more P atom, three O atoms and one H atom, and the relative atomic mass sum of these atoms is 79.97. Therefore, the molecular weight of NA-wtTel23c synthesized by biosynthesis is consistent with expectations.

[0128] 15 The relative molecular mass of N-wtTel23c is 7733.92, which is 93.02 higher than that of NA-wtTel23c. This is because the vast majority (99.6%) of nitrogen atoms in the NA-wtTel23c sequence are 14 N, and 15 The majority of nitrogen atoms in the N-wtTel23c sequence are 15 N atoms, the number of nitrogen atoms in the wtTel23c sequence is 97, and NA-wtTel23c and 15 The theoretical relative molecular weight difference of N-wtTel23c is 96.61, while the experimental relative molecular weight difference between the two is 93.02, indicating that 15 The labeling rate of N-wtTel23c sequence was 96.28%. 15 The calculation formula of N labeling rate refers to formula 1.

[0129]

[0130] Note: In formula 1, N represents the number of nitrogen atoms in the wtTel23c sequence, i.e., 97.

[0131] The atomic resolution NMR technique was used to characterize the stacking of the G bases in the G4 formed by the ssDNA folding obtained in this experiment. Figure 2 As shown in B, the sample (wtTel23c) obtained in this experiment and the reference sample (reference) show 12 high-resolution signal peaks and some small peaks in the 10-12 ppm imino proton region, which indicates that the fine structure of ssDNA folding to form G4 obtained in this experiment is consistent with the reference sample. 1 H- 15 N sfHMQC is a fast two-dimensional spectrum acquisition technology that is widely used in the study of biomacromolecules. This technology can significantly improve the signal-to-noise ratio per unit time in heteronuclear correlation experiments. 15 The signal of N-wtTel23c sample. 15 N-labeled ssDNA samples with a concentration as low as 0.2 mM can obtain high resolution in just 7 min under the same spectral acquisition conditions. 1 H- 15 NsfHMQC 2D spectrum ( Figure 2 C), while for the naturally abundant NA-wtTel23c sample, the concentration was as high as 2.0 mM, and the 1 H- 15 N sfHMQC 2D spectrum still needs 18h ( Figure 2 D in this example. This shows 15 N-labeled DNA samples can significantly shorten the acquisition time of spectra, improve the signal-to-noise ratio per unit time, and lay the foundation for the study of complex biological systems.

[0132] The wtTel23c-TMPyP4 complex obtained under dilute solution conditions and cell-like environment 1 H- 15 There are significant differences in the two-dimensional spectra of N sfHMQC (e.g. Figure 2 As shown in the spectrum obtained in the cell-like environment, the G21 signal indicated by the arrow is clearly retained but does not appear in the dilute solution condition. This indicates that the binding mode of TMPyP4 to telomere G4 in the cell-like environment is significantly different from that in the dilute solution condition.

[0133] Example 3 Stable Isotopes 15 Preparation method of N-labeled human promoter c-myc ssDNA sequence

[0134] Experimental principles of plasmid design Figure 4 As shown, c-MYC promoter DNA was used as the target sequence, 5′-ctgagggtgggtagggtgggtaa-3′, and was named PU22C.

[0135] In order to improve the yield of the target DNA, two different restriction endonuclease sites, Kpn I-HF and Hind III-HF, were added to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit. The nucleotide sequence of the repeating unit is shown in SEQ ID NO.9, specifically: ggtacctgagggtgggtagggtgggtaaagctt. The repeating unit was repeated 20 times in series to obtain a fusion sequence (the nucleotide sequence is shown in SEQ ID NO.10, specifically: GGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAGGGTGGGTAAAGCTT atgttcagaatgaaactcatggaaacacttaaccagtgcataaacgctggtcatgaa atgacgaaggctatcgccattgcacagtttaatgatgacagcccggaagcgaggaaaataacccggcgctggagaa taggtgaagcagcggatttagttggggtttcttctcaggctatcagagatgccgagaaagcagggcg(linker) GGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTT tcacggatgggaaccagatct tcatattcatgcagaagacactctcctgcctttctatcttggggaaaaggacgatgtcacttatgcaataaagccc acttgctggccggggcttgacattattccttcctgtctggctctgcaccgtattgaaactgagttaatgggcaaat ttgatgaaggtaaactgcccaccgatc(linker) GGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTT gttccacttgtatcgtcggtctgataatcagactgggaccacggtcccactcgtatcgtcg gtctgattattagtctgggaccacggtcccactcgtatcgtcggtctgattattagtctgggaccacggtcccact cgtatcgtcggtctgataatcagactgggaccacggtcccactcgtatcgtcggtctgattat(linker) GGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTT ttaatacgatacctgcgtcataatt gattatttgacgtggtttgatggcctccacgcacgttgtgatatgtagatgataatcattatcactttacgggtcc tttccggtgatccgacaggttacggggcggcgacctcgcgggttttcgctatttatgaaaattttccggtttaagg cgtttccgttcttcttcgtcata(linker)GGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTAC CTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTTGGTACCTGAGGGTGGGTAGGGTGGGTAAAGCTT), and an irrelevant sequence was added between every four repeats of the target sequence in the fusion sequence, and the fusion sequence was constructed into a high copy vector pUC57. An asymmetric double-stranded DNA structure was generated by double restriction digestion with Kpn I-HF and Hind III-HF, and two ssDNAs of different lengths were obtained by separation using urea denaturing polyacrylamide gel electrophoresis, namely PU22C: 5'-ctgagggtgggtagggtgggtaa-3'; PU30C 5'-agctttacccaccctacccaccctcaggtac-3'. The target DNA sequence and linker sequence (1460 bp) were repeatedly concatenated and spliced ​​by producing sticky ends by EcoRV single restriction digestion of vector pUC57 to construct a plasmid, which was named pUC57-PU22C.

[0136] method:

[0137] (one) 15 Preparation of N-PU22C ssDNA:

[0138] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0139] Select a single clone and culture it in 5 mL TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL TB medium. After 3 h, collect the bacteria by centrifugation and transfer them into 150 mL of 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 In fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when OD = 1.0, and continue to culture at 37°C for 9 hours. Collect the bacteria by centrifugation, wash with STE buffer, and wait for purification.

[0140] 2. Large-scale plasmid extraction and purification

[0141] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0142] 3. Use two restriction endonucleases to perform double digestion of the plasmid to obtain the target double-stranded DNA

[0143] Add 23 μL of deionized water, 5 μL of 10×NEB cutsmartbuffer (1×NEB cutsmartbuffer, 50 mM KAC, 20 mM Tris-HAC, 10 mM Mg(AC)2, 100 μg / ml BSA, pH=7.9@25°C), 20 μL of plasmid solution (concentration is 200 ng / μL), 2 μL of Kpn I (20 U), 2 μL of Hind III (20 U) to a 200 μL PCR tube and mix well. Place in a 37°C water bath for 4 hours. Use 8% native-PAGE to detect enzyme digestion efficiency. The optimal plasmid concentration for the plasmid double enzyme digestion reaction should be 1000 ng / μL.

[0144] 4. Isolation and purification of target ssDNA

[0145] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) by 12% urea denaturing polyacrylamide gel electrophoresis. Use a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) for electrophoresis, with a constant power of 75 W for 8 h. Perform the electrophoresis experiment in a biochemical incubator at a constant temperature of 30°C.

[0146] (2) Cut the target ssDNA band, pass the gel block through the syringe, and crush it into fine particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50°C water bath overnight (or use an electroelution device to elute the DNA).

[0147] (3) The soaked liquid is filtered through a 0.2 μm filter membrane (if electroelution is used, the liquid in the sample pool is directly absorbed), and then concentrated through a 3K ultrafiltration tube, and the buffer is changed several times by ultrafiltration with water to finally obtain ssDNA. The naturally abundant ssDNA prepared in this example is named NA-PU22C. 15 N-labeled ssDNA is named 15 N-PU22C.

[0148] (II) Preparation of G4s samples

[0149] (1)PU22C: ctgagggtgggtagggtgggtaa

[0150] (2) K + Buffer solution: 2.5 mM K3PO4, 7.5 mM KCl, pH = 6.0

[0151] (3) 15 Preparation of N-labeled G4s (PU22C): prepared by the above method 15 N stable isotope labeled ssDNA dissolved in K+ In a buffer solution, it was heated at 95°C for 10 min, gradually cooled to 4°C, and balanced at this temperature for 0.5 h to form a stable G4s structure.

[0152] (4) Preparation of unlabeled G4s: The purchased DNA sample powder was dissolved in deionized water and ultrafiltered three times to remove inorganic salt ions and organic solvents such as triethylamine in the sample as much as possible. + Annealing was performed under buffer solution conditions, heating at 95°C for 10 min, gradually cooling to 4°C, and equilibrating at this temperature for 0.5 h to form stable G4s.

[0153] Example 4 Nuclear magnetic resonance experiment

[0154] 1. 1 H- 15 N sfHMQC experiment

[0155] In the 200 μL prepared in advance Example 3 15 10% v / v heavy water (D2O) was added to the N-labeled PU22C sample, and the total sample volume was 220 μL, so that the final concentration of the DNA sample was 0.2 mM. The sample was loaded into a Shigemi NMR tube and the NMR experiment was performed on a 700 MHz Bruker spectrometer equipped with an ultra-low temperature probe. The sampling temperature of the experiment was 298 K. 1 H- 15 The direct dimension sampling points of the N sfHMQC spectrum are 400, the indirect dimension sampling points are 40, the direct dimension spectrum width is 12ppm, and the spectrum center position is 10.5ppm. The indirect dimension spectrum width is 6ppm, and the spectrum center position is 144ppm. The cumulative number of scans is 16. Topspin software was used for NMR data acquisition, and carar software was used for data processing.

[0156] 2. 2 J HN 1 H- 15 N HSQC selectivity experiment

[0157] The NMR experiments were performed on a 700 MHz Bruker spectrometer equipped with a cryogenic probe. The sampling temperature of the experiments was 298 K. 1 H- 15 The direct dimension sampling points of the NHSQC spectrum are 1408, the indirect dimension sampling points are 128, and the spectral width of the direct dimension is 20ppm. The center position of the spectrum is determined according to the selected area. The cumulative number of scans is 80 times. 15 N bandwidth selective HSQC pulse sequence ( 15 N-band-selective 1 H-15 NHSQC). 15 N Selective pulse excitation achieves excitation within a certain frequency range through soft pulse or shape pulse (Q3shape pulse).

[0158] Example 5

[0159] (I) Example 3 prepared 15 Preparation and characterization of N-PU22C ssDNA

[0160] The crude plasmid extract was obtained by alkaline lysis, and the crude extracted plasmid was purified by phenol chloroform and other steps. The purified plasmid was detected by agarose gel electrophoresis. The results are as follows: Figure 5 As shown in A in the figure, the purified plasmid has three bands, and the apparent molecular weights from small to large represent supercoiled plasmids, circular plasmids and linear plasmids respectively. The middle band has the highest content, which indicates that the purified plasmid (pUC57-PU22C) mainly exists in a circular form. The apparent molecular weight of pUC57-PU22C shown on the gel is consistent with expectations. The double enzyme digestion conditions were optimized, and the experimental results showed that restriction endonucleases Kpn I-HF and Hind III-HF can simultaneously digest pUC57-PU22C. In addition, during the experimental optimization process, it was found that after the plasmid was digested by Kpn I-HF, Hind III-HF could not effectively perform the next step of digestion; while the plasmid was first digested by Hind III-HF and then digested by Kpn I-HF to effectively obtain the target double-stranded DNA (such as Figure 5 B in the figure). This may be due to the different binding abilities of the two enzymes to double-stranded DNA. The target double-stranded DNA produced after double enzyme digestion was purified by urea denatured polyacrylamide gel electrophoresis (35 cm x 45 cm), the target ssDNA band was recovered by gel cutting, and the purified ssDNA sample was obtained by electroelution. The ssDNA sample of the same sequence prepared by the solid phase synthesis method was used as a reference, and 12% acrylamide gel electrophoresis was used for detection. The results showed that the molecular weight of the PU22C sample prepared in this example was consistent with that of the PU22C sample synthesized by solid phase.

[0161] (II) Interaction between PU22C and CX5461

[0162] PU22C is a cancer-related c-myc promoter G4s structure. The clinical drug CX5461 can specifically bind to the G4s structure and is currently undergoing phase I clinical trials for BRCA1 / 2-deficient tumors, but the structure of the CX5461-G4s complex is unknown. Therefore, it is of great scientific significance to explore the interaction between CX5461 and G4s. PU22C and CX5461 were titrated at different molar ratios. The one-dimensional NMR spectrum of the bound PU22C has poor resolution, and the information obtained about the complex is limited. Using 1 H- 15 The interaction between CX5461 and PU22C was characterized by N sfHMQC 2D NMR spectra. Figure 6 As shown, the two-dimensional NMR spectrum can collect the change process of the spectrum signal. When the molar concentration is low (PU22C:CX5461=1:1), the spectrum signal becomes broader, and as the concentration of CX5461 increases (PU22C:CX5461=1:2), the spectrum signal increases. This shows that the binding of PU22C and CX5461 belongs to a medium exchange rate on the NMR time scale. When the concentration of CX5461 is increased to 1:3, the spectrum no longer changes significantly, indicating that the interaction between PU22C and CX5461 reaches the titration endpoint at 1:2. At the titration endpoint, 8 independent imino proton signals are displayed on the spectrum, which may be a phenomenon of signal overlap. Using 2 J HN - 1 H- 15The N sfHMQC NMR spectrum was characterized in the same way. The results are shown in Figure 7. After binding to the drug, the signals of the G base and the A base changed significantly. Among them, the signal of the A15 base did not change significantly before and after titration, and the signals of other A bases (A6, A24 and A25) shifted significantly. This shows that A15 does not involve the binding site of CX5461. A15 is located in the loop region of the G4s structure, while the other A bases are located at the 5' end and 3' end of the G4s structure. This shows that CX5461 binds to the 5' end and 3' end of PU22C at a binding ratio of 1:2. This is similar to the binding mode of quindoline-i and c-MYC G4s (see [Liu, W., Lin, C., Wu, G., Dai, J., Chang, TC and Yang, D. (2019) Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition. Nucleic Acids Res, 47, 11931-11942.]).

[0163] In the traditional G4s structure analysis method, the H8 of the A and G bases is associated with the protons on the sugar ring through NOE signals to analyze the protons inside the bases and the proton signals of the adjacent bases. However, there are many signals, and it is difficult to attribute the signals, or the NOE signals are partially lost due to spatial distance or angle problems, making it impossible to perform the next step of association. This is the bottleneck problem encountered by the current nuclear magnetic resonance technology in analyzing the G4 structure. 15 N-labeled human promoter c-MYC ssDNA sequence, which was achieved through 15 The N spectrum editing method performs selective excitation of signals in specific proton regions, thereby obtaining proton signals in specific regions (such as proton signals of imino groups), greatly simplifying spectrum signals, and improving the efficiency of spectrum signal analysis.

[0164] Example 6 Stable Isotopes 15 Preparation method of N-labeled HIV ssDNA sequence LTR-III

[0165] Experimental principles of plasmid design Figure 8 As shown, HIV LTR-III DNA was used as the target sequence, 5′-gggaggcgtggcctgggcgggactgggg-3′, and was named LTR-III.

[0166] In order to improve the yield of the target DNA, two different restriction endonuclease sites, Pst I-HF and Hind III-HF, were added to the 5' and 3' ends of the target sequence to obtain a repeating unit. The nucleotide sequence of the repeating unit is shown in SEQ ID NO.11, specifically: ctgcagggaggcgtggcctgggcgggactgggggatcc. The repeating unit was repeated 15 times in series to obtain a fusion sequence (the nucleotide sequence is shown in SEQ ID NO.12, specifically: An irrelevant sequence was added between every four repeated target sequences in the fusion sequence, and the fusion sequence was constructed on the high copy vector pUC57. An asymmetric double-stranded DNA structure was generated by double digestion with PstI-HF and HindⅢ-HF, and two ssDNAs of different lengths were obtained by separation by urea denaturing polyacrylamide gel electrophoresis, namely: 5'-gggaggcgtggcctgggcgggactgggg-3'LTR-III and 3'-acgtccctccgcaccggacccgccctgacccc ctag-5'LTR-C. The repeated tandem target DNA sequence and linker sequence (1370bp) were constructed by the method of splicing the sticky ends of the vector pUC57 produced by BsmBI single digestion, and the plasmid was named pUC57-LTR-III.

[0167] method:

[0168] (one) 15 Preparation of N-LTR-III ssDNA:

[0169] 1. Amplify the stable isotope-labeled plasmid using labeled M9 medium

[0170] Select a single clone and culture it in 5 mL TB medium (37°C). After 5 h, transfer 5 mL of the bacterial solution into 50 mL TB medium. After 3 h, collect the bacteria by centrifugation and transfer them into 150 mL of 15 Cultivate overnight in M9 medium containing NH4Cl, take 50mL of overnight culture solution and add it to 400mL of 15 In fresh M9 medium containing NH4Cl, add chloramphenicol at a final concentration of 11.5 mg / mL when OD = 1.0, and continue to culture at 37°C for 9 hours. Collect the bacteria by centrifugation, wash with STE buffer, and wait for purification.

[0171] 2. Large-scale plasmid extraction and purification

[0172] Since the large-scale plasmid extraction kits on the market could not meet the experimental requirements, the buffer solution required for large-scale plasmid extraction was prepared according to the recipe in the Molecular Cloning Book (3rd Edition).

[0173] 3. Use two restriction endonucleases to perform double digestion of the plasmid to obtain the target double-stranded DNA

[0174] Add 23 μL of deionized water, 5 μL of 10×NEB cutsmartbuffer (1×NEB cutsmartbuffer, 50 mM KAc, 20 mM Tris-HAc, 10 mM Mg(Ac)2, 100 μg / ml BSA, pH=7.9@25°C), 20 μL of plasmid solution (concentration is 200 ng / μL), 2 μL of Kpn I (20 U), 2 μL of Hind III (20 U) to a 200 μL PCR tube and mix well. Place in a 37°C water bath for 4 hours. Use 8% native-PAGE to detect enzyme digestion efficiency. The optimal plasmid concentration for the plasmid double enzyme digestion reaction should be 1000 ng / μL.

[0175] 4. Isolation and purification of target ssDNA

[0176] (1) Separate the two single strands of the target double-stranded DNA (wtTel23c and wtTel34) by 12% urea denaturing polyacrylamide gel electrophoresis. Use a JY-CX2B large vertical electrophoresis tank (35 cm × 45 cm) for electrophoresis, with a constant power of 75 W for 8 h. Perform the electrophoresis experiment in a biochemical incubator at a constant temperature of 30°C.

[0177] (2) Cut the target ssDNA band, pass the gel block through the syringe, and crush it into fine particles. Add an appropriate volume of TE10 / 0.1 and soak it in a 50°C water bath overnight (or use an electroelution device to elute the DNA).

[0178] (3) The soaked liquid is filtered through a 0.2 μm filter membrane (if electroelution is used, the liquid in the sample pool is directly aspirated), and then concentrated through an ultrafiltration tube with a molecular weight cutoff of 3K. The buffer is replaced by water ultrafiltration several times to finally obtain ssDNA. The naturally abundant ssDNA prepared in this experiment is named NA-LTR-III. 15 N-labeled ssDNA is named 15 N-LTR-III.

[0179] (II) Preparation of G4 samples

[0180] (1)LTR-III gggaggcgtggcctgggcgggactgggg

[0181] (2) K+ Buffer solution: 20 mM K3PO4, 70 mM KCl, pH = 7.0

[0182] (3) 15 N-labeled G4 Preparation of (LTR-III): Prepared by the above method 15 N stable isotope labeled ssDNA dissolved in K + In a buffer solution, it was heated at 95°C for 10 min, gradually cooled to 4°C, and balanced at this temperature for 0.5 h to form a stable G4 structure.

[0183] (4) Preparation of unlabeled G4: The purchased DNA sample powder was dissolved in deionized water and ultrafiltered three times to remove inorganic salt ions and organic solvents such as triethylamine in the sample as much as possible. + Annealing was performed under buffer solution conditions, heating at 95°C for 10 min, gradually cooling to 4°C, and equilibrating at this temperature for 0.5 h to form stable G4.

[0184] Example 7 Experimental Method of sfHMQC Nuclear Magnetic Resonance Experiment

[0185] 200 μL prepared in advance in Example 6 15 10% v / v heavy water (D2O) was added to the N-labeled LTR-III sample, and the total sample volume was 220 μL, so that the final concentration of the DNA sample was 0.2 mM. The sample was loaded into a Shigemi NMR tube and the NMR experiment was performed on a 700 MHz Bruker spectrometer equipped with an ultra-low temperature probe. The sampling temperature of the experiment was 298 K. 1 H- 15 The number of sampling points in the direct dimension of the N sfHMQC spectrum is 400, and the number of sampling points in the indirect dimension is 40. The spectral width in the direct dimension is 12ppm, and the center position of the spectrum is 10.5ppm. The spectral width in the indirect dimension is 6ppm, and the center position of the spectrum is 144ppm. The cumulative number of scans is 16. Two-dimensional in the cell environment 1 H- 15 The number of scans for N sfHMQC spectrum acquisition was increased to 2048. Topspin software was used for NMR data acquisition and cara software was used for data processing.

[0186] Example 8

[0187] 1. 15 N-labeled LTR-III ssDNA can obtain the fingerprint of LTR-III G4 and its interaction with ligands

[0188] NMR characterization of LTR-III G4 structure formation is usually performed using a single base at a specific site.15 N mark, through 15 The N-filtered spectroscopy method was used to identify the H1 proton signals one by one. For example, in the structural analysis of LTR-III G4, the 15 G bases of LTR-III G4 were identified at a single site. 15 N mark, then pass 15 The N-filtered spectroscopy method obtains a single H1 proton signal, so the 15 G bases of LTR-III G4 are identified separately. The advantage of this method is that the signal is single and the identification is clear. However, the obvious disadvantage is that multiple single sites are required. 15 N-labeled samples were collected for NMR spectra, and the fingerprint of LTR-III G4 could not be obtained. 15 N-labeled LTR-III G4 has a stable isotope 15 The uniform labeling of N can obtain the two-dimensional NMR fingerprint of LTR-III G4 through a single spectrum acquisition. The structure of LTR-III G4 is different from the traditional G4 structure. In addition to the three-layer G four-plane, there are three pairs of classic GC base pairing. 15 In N-labeled LTR-III G4, high-resolution structural information can be obtained by collecting two-dimensional sfHMQC spectra, and the two-dimensional NMR spectrum can clearly show the change process of the spectrum signal. Figure 9 As shown in A in the figure, when the ligand Braco-19 (1:0) is not added to the system, the proton signal (10-12ppm) of the non-classical pairing of G4 and the proton signal (12-13ppm) of the classical pairing of GC and the Watson-Crick hydrogen bond can be clearly obtained on the sfHMQC spectrum. Under this condition, the titration of the ligand Braco-19 was carried out, and the titration ratio was changed from 1:0.5 to 1:1.5 ( Figure 9 B-D), the addition of Braco-19 caused a significant change in the spectrum signal of LTR-III G4. When the titration ratio was 1:1.5, the spectrum signal no longer changed significantly compared with the spectrum of 1:1, indicating that LTR-III G4 and Braco-19 reached the titration endpoint at 1:1. The signals in the GC three-base pairing region (12-13ppm) and the G4 region (10-12ppm) in the spectrum changed significantly, indicating that the ligand molecule is likely to bind to the interface connection between the G four-plane and the GC base pairing.

[0189] 2. Based on 15 N-labeled LTR-III G4 to study the effects of complex cellular environments on LTR-III G4 conformation

[0190] Under dilute solution conditions, the ligand molecule may bind to the interface between the G four-plane and the GC base pairing. However, proteins, metabolite small molecules and crowded environment in the cell environment may affect the conformation of LTR-III G4. Whether the unique conformation of LTR-III G4 exists in the cell environment is still unknown. 15 N-labeled LTR-III G4 with stable isotope 15 The advantage of uniform N labeling is that the structural information of LTR-III G4 can be directly obtained in a complex cell environment. Figure 10 The fingerprints of LTR-III G4 in the cell-like environment were collected at 25 mg / mL, 50 mg / mL and 75 mg / mL. Figure 10 As the concentration of cell extract increases, the signal of some spectra does not change significantly. In the spectrum of the appropriate cell extract concentration of 50 mg / mL ( Figure 10 In B), the signals of the GC three-base pairing region (12-13ppm) and the G4 region (10-12ppm) did not change significantly, indicating that the unique conformation of LTR-III G4 still exists in the cell environment, which may be the special action site of drug molecules targeting LTR-III G4. In addition, when the cell extract concentration is 75mg / mL, the spectrum signal weakens or even disappears, because the nonspecific interaction increases with the increase of cell extract concentration.

[0191] 3. Based on 15 N-labeled LTR-III G4 samples directly obtain information on the interaction between LTR-III G4 and the ligand Braco-19 in a complex cellular environment

[0192] Studying the interaction between LTR-III G4 and the ligand Braco-19 in a cell environment and obtaining relevant binding site information have important guiding significance for the rational design of G4 ligands. In-cell NMR technology is not affected by background signals and can clearly obtain the signal of the target molecule in a complex cell environment. It is suitable for evaluating the interaction between G4 and ligand molecules in a cell environment. In order to obtain better spectral resolution, the authors used a cell-like concentration of 50 mg / mL to explore the interaction between LTR-III G4 and the ligand Braco-19. The results are as follows Figure 11As shown in the figure, the gray background image represents the spectrum signal of free LTR-III G4 under the condition of cell concentration of 50 mg / mL; the red spectrum represents the spectrum information of the complex with different titration ratios under the condition of cell extract. As the ligand concentration increases, the red spectrum signal changes significantly, indicating that the ligand Braco-19 can selectively interact with LTR-III G4 in the environment of cell extract. When the titration ratio ranges from 1:0.5 to 1:1.5 ( Figure 11 A to C in the figure), when the titration ratio is 1:1.0, the red spectrum no longer changes significantly, indicating that the titration endpoint is reached when the titration ratio is 1:0. Figure 11 When the spectrum information of LTR-III G4 in the bound state (red spectrum) is superimposed and compared with the spectrum of LTR-III G4 in the free state (black spectrum), it can be seen that the signals of the GC three-base pairing region (12-13ppm) and the G4 region (10-12ppm) have changed significantly, indicating that in the cell environment, the ligand molecule is likely to bind to the interface connection between the G four-plane and the GC base pairing. 15 The study of N-labeled LTR-III G4 can further prove that it is valuable to develop targeted drugs at the interface between the G tetraplane of TR-III G4 and the GC base pairing, and provide important guidance for the rational design of drugs targeting TR-III G4.

[0193] Example 9 Preparation of Stable Isotopes 13 C-labeled PU22C

[0194] Stable isotopes 13 Preparation of C-labeled PU22C was similar to that in Example 3. 15 The preparation method of N-labeled PU22C is similar, the only difference is 15 The M9 medium was replaced with fresh M9 medium containing NH4Cl. 15 N-NH4Cl and 13 C-glucose was used as the sole nitrogen source and the sole carbon source in fresh M9 medium. The purification method of ssDNA was the same. The CH bond signals of various bases can be obtained by collecting HSQC spectrum signals, such as Figure 12 As shown, 13 Selective excitation of C nuclei can achieve selective collection of CH signals, simplify the signals of NMR spectra, and promote NMR studies of nucleic acids.

[0195] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for preparing stable isotope labeled ssDNA by biological fermentation, characterized in that: The following steps are involved: 1) Adding a first restriction endonuclease site and a second restriction endonuclease site to the 5' and 3' ends of the target sequence, respectively, to obtain a repeating unit; The first restriction endonuclease and the second restriction endonuclease are two different restriction endonucleases; 2) connecting the repeating units in step 1) in series to obtain a fusion sequence; 3) inserting the fusion sequence in step 2) into a high copy vector to obtain a recombinant vector; 4) Introducing the recombinant vector in step 3) into a host bacterium to obtain a recombinant bacterium; 5) After culturing the recombinant bacteria in step 4), extracting and purifying the recombinant vector in the recombinant bacteria; the culture medium used in the culture is 15 NH4Cl as the sole nitrogen source and / or 13 C-glucose is the only carbon source; 6) using the first restriction endonuclease and the second restriction endonuclease to digest the recombinant vector in step 5) to obtain an asymmetric double-stranded DNA structure, and separating two ssDNAs of different lengths, one of which is the target sequence; 7) Recovering the target sequence in the two ssDNAs in step 6) to obtain a stable isotope-labeled target ssDNA; The target sequence includes telomeric ssDNA, human promoter ssDNA or HIV ssDNA; the nucleotide sequence of the telomeric ssDNA is shown in SEQ ID NO.1; the nucleotide sequence of the human promoter ssDNA is shown in SEQ ID NO.2; the nucleotide sequence of the HIV ssDNA is shown in SEQ ID NO.3; When the target sequence is telomere ssDNA, 12 repeating units in step 2) are connected in series; when the target sequence is human promoter ssDNA, 20 repeating units in step 2) are connected in series; when the target sequence is HIV ssDNA, 15 repeating units in step 2) are connected in series.

2. The method according to claim 1, characterized in that In step 1), the first restriction endonuclease is KpnI and the second restriction endonuclease is BamHI; alternatively, the first restriction endonuclease is KpnI-HF and the second restriction endonuclease is BamHI-HF; alternatively, the first restriction endonuclease is Pst I-HF and the second restriction endonuclease is Hind III-HF; alternatively, the first restriction endonuclease is Kpn I-HF and the second restriction endonuclease is Hind III-HF.

3. The method according to claim 2, characterized in that In step 6), the shorter of the two ssDNAs of different lengths is the target sequence.

4. The method according to claim 1, characterized in that In step 2), every 3 to 4 repeating units are connected in series to form a large repeating unit, and the large repeating units are further connected in series through a linker sequence.

5. The method according to claim 1, characterized in that In step 2), the length of the fusion sequence is ≤2k.

6. The method according to claim 1, characterized in that In step 3), the high copy vector includes pUC57.

7. The method according to claim 1, characterized in that In step 5) 15 The concentration of NH4Cl is ≥1g / L; 13 C-glucose concentration ≥4g / L.

8. The method according to claim 1, characterized in that Step 7) also includes recovering another ssDNA except the target sequence.

Images