Application of sorghum SbMYB12 protein and its encoding gene in regulating plant salt tolerance

Abstract

The present invention discloses the application of sorghum SbMYB12 protein and its encoding gene in regulating plant salt tolerance. The SbMYB12 protein is a protein as follows a) or b) or c) or d): a) the amino acid sequence is the protein shown in sequence 2; b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in sequence 2; c) a protein with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in sequence 2; d) a protein with 75% or more identity with the amino acid sequence shown in sequence 2 and having the same function. The present invention introduces the SbMYB12 gene into the dicotyledonous recipient plant Arabidopsis and finds that overexpression of the SbMYB12 gene can improve plant salt tolerance.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of sorghum SbMYB12 protein and a coding gene thereof in regulating plant salt tolerance. Background Art

[0002] Plants grow in a constantly changing environment. Unlike animals that can actively escape from adverse environments, plants inevitably face changes in the environment due to their fixed growth characteristics. These include the impact of various abiotic stresses, such as salinity, drought, heat, low temperature, nutrient deficiency, and heavy metal stress. With global warming and the intensification of human activities, land environmental issues such as water shortage, soil salinization, and secondary salinization have attracted much attention. In my country, nearly half of the country's land area is in arid and semi-arid areas, and the area of ​​saline-alkali soil is about 1.16×10 8 hm 2 At the same time, we are facing problems such as the reduction of arable land. Therefore, there is an urgent need to develop biomass energy crops that can grow in arid and saline-alkali areas and achieve high yields.

[0003] Sorghum (Sorghum Bicolor (L.) Moench) is the fifth largest food crop in the world. It is the main food crop for people in arid and semi-arid areas of sub-Saharan Africa and parts of Asia. More than 500 million people rely on sorghum as their staple food. In addition to being used as food, sorghum is also widely used in feed, brewing, bioenergy and industrial processing. Sorghum in my country is mainly grown in saline-alkali and arid areas. Previous studies have shown that there are large differences in salt tolerance between different sorghum varieties, resulting in large differences in the yield and quality of different varieties of sorghum planted in the same place. Finding genes related to salt tolerance in sorghum and studying its genetic mechanism of salt stress tolerance are of great guiding significance for the genetic improvement of sorghum salt tolerance. Summary of the invention

[0004] The purpose of the present invention is how to regulate plant salt tolerance.

[0005] In order to achieve the above object, the present invention first provides a protein.

[0006] The protein provided by the present invention is derived from sorghum (Sorghum Bicolor (L.) Moench), and is named SbMYB12 protein. The SbMYB12 protein is the protein shown in a) or b) or c) or d) below:

[0007] a) the amino acid sequence is the protein shown in SEQ ID NO: 2;

[0008] b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2;

[0009] c) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2;

[0010] d) A protein that has 75% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

[0011] In the protein described in b) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0012] In the protein described in c) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0013] In the protein described in d) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0014] The protein described in a) or b) or c) or d) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0015] In order to achieve the above object, the present invention further provides biological materials related to SbMYB12 protein.

[0016] The biological material related to the SbMYB12 protein provided by the present invention is any one of the following A1) to A12):

[0017] A1) a nucleic acid molecule encoding the above-mentioned SbMYB12 protein;

[0018] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0019] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0020] A4) a recombinant vector containing the expression cassette described in A2);

[0021] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0022] A6) a recombinant microorganism containing the expression cassette described in A2);

[0023] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0024] A8) a recombinant microorganism containing the recombinant vector described in A4);

[0025] A9) a transgenic plant cell line containing the nucleic acid molecule described in A1);

[0026] A10) a transgenic plant cell line containing the expression cassette described in A2);

[0027] A11) a transgenic plant cell line containing the recombinant vector described in A3);

[0028] A12) A transgenic plant cell line containing the recombinant vector described in A4).

[0029] In the above biological material, the nucleic acid molecule described in A1) is the gene shown in 1) or 2) or 3) below:

[0030] 1) Its coding sequence is the cDNA molecule shown in Sequence 1 or the genomic DNA molecule shown in Sequence 3;

[0031] 2) a cDNA molecule or a genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the above-mentioned SbMYB12 protein;

[0032] 3) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the above-mentioned SbMYB12 protein.

[0033] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0034] A person skilled in the art can easily mutate the nucleotide sequence encoding the SbMYB12 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the SbMYB12 nucleotide sequence isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the SbMYB12 protein and have the same function.

[0035] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0036] In the above-mentioned biological materials, the expression cassette (SbMYB12 gene expression cassette) containing a nucleic acid molecule encoding the SbMYB12 protein described in A2) refers to a DNA capable of expressing SbMYB12 in a host cell, and the DNA may include not only a promoter for initiating transcription of SbMYB12, but also a terminator for terminating transcription of SbMYB12. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator and pea rbcS E9 terminator.

[0037] Available existing expression vector construction contains the recombinant vector of the SbMYB12 gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company), etc. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as Agrobacterium crown gall induction (Ti) plasmid gene (such as nopaline synthase gene Nos), plant gene (such as soybean storage protein gene) 3' end transcription non-translated region all have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0038] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector, and specifically may be a pCambia1300-221 vector.

[0039] In the above biological materials, the microorganism may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium, specifically the GV3101 strain.

[0040] Among the above biological materials, the transgenic plant cell lines do not include propagation materials.

[0041] In order to achieve the above objectives, the present invention also provides new uses of the above SbMYB12 protein or related biomaterials.

[0042] The present invention provides the use of the above-mentioned SbMYB12 protein or related biological materials in regulating plant salt tolerance.

[0043] Furthermore, the regulation of plant salt tolerance is to improve plant salt tolerance, which is specifically manifested in that: the higher the expression level and / or activity of the SbMYB12 protein in the plant, the stronger the salt tolerance of the plant.

[0044] The present invention also provides the use of the SbMYB12 protein or related biological materials in cultivating transgenic plants with improved salt tolerance.

[0045] The present invention also provides the use of the SbMYB12 protein or related biological materials in plant breeding, wherein the purpose of the plant breeding is to improve the salt tolerance of plants or cultivate salt-tolerant plant varieties.

[0046] In order to achieve the above objectives, the present invention finally provides a method for cultivating transgenic plants with improved salt tolerance.

[0047] The method for cultivating transgenic plants with improved salt tolerance provided by the present invention comprises the steps of increasing the expression level and / or activity of the above-mentioned SbMYB12 protein in a recipient plant to obtain a transgenic plant; the salt tolerance of the transgenic plant is higher than that of the recipient plant.

[0048] Furthermore, the salt tolerance of the transgenic plant is higher than that of the recipient plant, which is reflected in that the germination rate (such as relative germination rate) and / or survival rate of the transgenic plant under salt stress is higher than that of the recipient plant.

[0049] Furthermore, the method for increasing the expression level and / or activity of the above-mentioned SbMYB12 protein in the recipient plant is to overexpress the above-mentioned SbMYB12 protein in the recipient plant.

[0050] The overexpression method may be to introduce the coding gene of the SbMYB12 protein into a recipient plant.

[0051] The nucleotide sequence of the gene encoding the SbMYB12 protein is specifically shown in Sequence 1 in the sequence table.

[0052] In a specific embodiment of the present invention, the coding gene of the SbMYB12 protein is introduced into a recipient plant via a recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS. The recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS is a vector obtained by inserting the coding gene of the SbMYB12 protein shown in sequence 1 between the SalI and XbaI restriction sites of the pCambia1300-221-35S-3HA-NOS vector, while keeping the other sequences of the pCambia1300-221-35S-3HA-NOS vector unchanged.

[0053] In any of the above-mentioned uses or methods, the transgenic plants include not only the first generation transgenic plants obtained by transforming the SbMYB12 gene into a recipient plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, complete plants and cells.

[0054] In any of the above applications or methods, the plant may be a monocot or a dicot. Further, the dicot may be Arabidopsis thaliana; the monocot may be sorghum. Further, the Arabidopsis thaliana may be wild-type Arabidopsis thaliana Col-0, and the sorghum may be sorghum inbred line Rio.

[0055] The present invention provides a SbMYB12 gene related to plant salt tolerance. By overexpressing the SbMYB12 gene in the dicotyledonous plant Arabidopsis thaliana, it is found that overexpression of the SbMYB12 gene can improve plant salt tolerance. The SbMYB12 gene provided by the present invention will play an important role in cultivating salt-tolerant plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Schematic diagram of the structure of the recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS.

[0057] Figure 2 Analysis of salt tolerance of transgenic Arabidopsis thaliana expressing SbMYB12 gene. Figure 2 A is the relative expression analysis of the SbMYB12 gene in wild-type Arabidopsis and transgenic Arabidopsis thaliana with the SbMYB12 gene under normal growth conditions. Figure 2 B is the phenotype analysis of wild-type Arabidopsis and SbMYB12 transgenic Arabidopsis during the germination period under salt stress conditions. Figure 2C is the seedling phenotypic analysis of wild-type Arabidopsis and SbMYB12-transgenic Arabidopsis under salt stress conditions. Figure 2 D is the seedling survival rate analysis of wild-type Arabidopsis and SbMYB12 gene transgenic Arabidopsis under salt stress conditions. DETAILED DESCRIPTION

[0058] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0059] The wild-type Arabidopsis thaliana Col-0 in the following examples is a product of the Arabidopsis Information Resources (TAIR) website.

[0060] The pCambia1300-221 vector, EHA105 strain and GV3101 strain in the following examples are all recorded in the following literature: Ting Gao, Yaorong Wu, Yiyue Zhang, Lijing Liu, Yuese Ning, Dongjiang Wang, Hongning Tong, Shouyi Chen, Chengcai Chu, Qi Xie. (2011) Plant Mol Biol. 76: 145-156; the public can obtain them from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0061] The sorghum inbred line Rio in the following example is described in the following literature: Cooper EA, Brenton ZW, Flinn BS, Jenkins J, Shu S, Flowers D, Luo F, Wang Y, Xia P, Barry K, Daum C, LipzenA, Yoshinaga Y, Schmutz J, Saski C, Vermerris W, Kresovich SA new reference genome for Sorghum bicolor reveals high levels of sequence similarity between sweet and grain genotypes: implications for the genetics of sugarmetabolism. BMC Genomics. 2019 May 27; 20(1): 420.; the public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0062] Example 1. Obtaining sorghum SbMYB12 protein and its encoding gene

[0063] 1. Obtaining the genome sequence of SbMYB12

[0064] 1. Extract genomic DNA from sorghum inbred line Rio.

[0065] 2. Using the genomic DNA obtained in step 1 as a template, a primer pair consisting of SbMYB12-F and SbMYB12-R was used to perform PCR amplification using KOD FX Neo enzyme to obtain a PCR product, and the genomic sequence of the SbMYB12 gene in Rio was obtained through PCR amplification reaction. The primer sequences are as follows:

[0066] SbMYB12-F:5'-ATGGGGAGGGGCCGTGCTGCGA-3';

[0067] SbMYB12-R:5'-TTATGGCTGCAGCTGCGCGCTCTGG-3'.

[0068] The PCR reaction system was as follows: 25 μL 2× KOD FX Neo Buffer, 5 μL 2 mM dNTPs, 1 μL KOD FXNeo, 1.5 μL each of forward and reverse primers (10 μM), 1 μL template, and 15 μL deionized water.

[0069] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 62°C for 30 s, extension at 68°C for 30 s / kb, 10 cycles, with the annealing temperature decreasing by 1°C in each cycle; denaturation at 98°C for 10 s, annealing Tm for 20 s, extension at 68°C for 25 s / kb, 30 cycles; 68°C for 7 min; storage at 4-10°C.

[0070] 3. After the amplification product is recovered, it is sent to a sequencing company for sequencing verification. The fragment with correct sequencing verification is named SbMYB12-Rio, and its nucleotide sequence is shown in Sequence 3 in the sequence table, which is the genomic sequence of the SbMYB12 gene.

[0071] 2. Obtaining the SbMYB12 coding sequence

[0072] 1. Extract total RNA from leaves of sorghum inbred line Rio and obtain cDNA first chain by reverse transcription.

[0073] 2. Using the first strand of cDNA obtained in step 1 as a template, a primer pair consisting of SbMYB12-S-Psc and SbMYB12-A-Psc (lowercase letters represent vector fragments) was used for PCR amplification to obtain a PCR product. The coding sequence of the SbMYB12 gene in Rio was obtained by PCR amplification reaction. The primer sequences are as follows:

[0074] SbMYB12-S-Psc:5'-cgactctagaggatcaattcgagctccATGGGGAGGGCGCCGTGCTGCGA-3';

[0075] SbMYB12-A-Psc:5'-gcctgcaggtcgactctagaggatccTTATGGCTGCAGCTGCGCGCTCTGG-3'.

[0076] 3. After the amplification product was purified, it was cloned into the pEASY-Blunt Simple vector and sent to a sequencing company for sequencing verification after colony PCR detection. The sequencing results showed that the coding sequence of the SbMYB12 gene in sorghum Rio was 1071 bp in length, and its nucleotide sequence was shown in Sequence 1 in the sequence table, encoding a SbMYB12 protein composed of 356 amino acids, and the amino acid sequence of the SbMYB12 protein was shown in Sequence 2 in the sequence table.

[0077] Example 2: Obtaining SbMYB12-transgenic Arabidopsis

[0078] 1. Obtaining Transgenic Arabidopsis thaliana with SbMYB12 Gene

[0079] 1. Using the coding sequence (sequence 1) of the SbMYB12 gene obtained in step 3 of Example 1 as a template, a primer pair consisting of SbMYB12-Fsc and SbMYB12-Rsc (lowercase letters are vector fragments) was used for PCR amplification. After the amplified product was recovered, it was sent to a sequencing company for sequencing verification. The nucleotide sequence of the correctly sequenced fragment is shown in sequence 3 in the sequence table. The primer sequences are as follows:

[0080] SbMYB12-Fsc:5'-gatagcccccggggtcgacATGGGGAGGGCGCCGTGCTGCGA-3';

[0081] SbMYB12-Rsc:5'-gagaacacgggggactctagaTGGCTGGCAGCTGCGCGCTCTGGTCG-3'.

[0082] 2. Double-digest the pCambia1300-221 vector with restriction endonucleases XbaI and SalI to form linear fragments, and recover the vector backbone pCambia1300-221.

[0083] 3. The correctly sequenced amplified product obtained in step 1 and the vector backbone pCambia1300-221 obtained in step 2 were mixed at a molar ratio of 2:1, and connected using the full-strength gold seamless cloning kit to obtain the recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS, the structural diagram of which is shown in the figure. Figure 1 shown.

[0084] The recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS is obtained by inserting the coding gene of the SbMYB12 protein shown in sequence 1 between the SalI and XbaI restriction sites of the pCambia1300-221-35S-3HA-NOS vector, while keeping the other sequences of the pCambia1300-221-35S-3HA-NOS vector unchanged.

[0085] 4. The recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS was transformed into the Agrobacterium GV3101 strain by electric shock to obtain Agrobacterium containing the recombinant expression vector pCambia1300-221-35S-SbMYB12-3HA-NOS, which was recorded as GV3101 / pCambia1300-221-35S-SbMYB12-3HA-NOS recombinant bacteria.

[0086] 5. The SbMYB12 gene was transformed into wild-type Arabidopsis plants (Col-0) using the Agrobacterium-mediated method using the GV3101 / pCambia1300-221-35S-SbMYB12-3HA-NOS recombinant bacteria to obtain the homozygous lines OE4, OE9 and OE20 of Arabidopsis thaliana transgenic with SbMYB12 gene. The T3 generation positive transgenic lines OE4, OE9 and OE20 of Arabidopsis thaliana transgenic with SbMYB12 gene were selected for the detection of SbMYB12 gene expression and salt tolerance identification analysis.

[0087] Example 3: Detection of SbMYB12 gene expression

[0088] The expression level of the SbMYB12 gene in the T3 generation positive transgenic Arabidopsis homozygous strains OE4, OE9 and OE20 obtained in Example 2 was detected. The specific steps are as follows:

[0089] The relative expression of SbMYB12 gene in T3 generation positive transgenic SbMYB12 gene homozygous Arabidopsis lines OE4, OE9 and OE20 was detected by fluorescence quantitative PCR. Arabidopsis AtACTIN2 (AT3G18780) was used as the internal reference gene. The following fluorescence quantitative PCR detection primers were designed according to the gene sequence:

[0090] SbMYB12qRT-F:5'-TGCTGGACCCGATAGACCTC-3';

[0091] SbMYB12qRT-R:5'-GTGAAATGCTTCGGCAACCG-3';

[0092] qRT-AtACTIN2-F:5'-GCACCACCTGAAAGGAAGTACA-3';

[0093] qRT-ATACTIN2-R:5'-CGATTCCTGGACCTGCCTCATC-3'.

[0094] The fluorescence quantitative PCR was performed using the CFX-96 fluorescence quantitative PCR instrument from BioRad. The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing / extension at 60°C for 15 s, 45 cycles; melting curve analysis was performed from 65°C to 95°C, and fluorescence was read every 0.5°C for 4 s each time; end. The relative expression level of the SbMYB12 gene was calculated using the formula Qt=2 -Ct(Reference gene)-Ct(SbMYB12) Calculate, Ct represents the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold. The result is as follows Figure 2 As shown in A.

[0095] Example 4: Identification of salt tolerance of SbMYB12-transgenic Arabidopsis

[0096] The salt tolerance of the T3 generation positive transgenic SbMYB12 gene homozygous Arabidopsis lines OE4, OE9 and OE20 obtained in Example 2 was identified, and the specific steps were as follows:

[0097] 1. Determination of germination rate after salt treatment during germination period

[0098] Wild-type Arabidopsis Col-0 and transgenic Arabidopsis with SbMYB12 gene were treated with salt in salt-containing medium and the germination rate was counted after salt treatment. The specific steps are as follows: Take mature and plump seeds of each strain and evenly spread them on 1 / 2MS medium with sodium chloride concentrations of 0mM, 100mM and 150mM. The medium was placed in a culture room with a light condition of 16h light / 8h dark and a temperature of 22°C. The appearance of radicle was used as the criterion for seed germination. The number of germinated seeds was counted every 12 hours. At the same time, the germination rate in normal medium (1 / 2MS medium) was used as a control, and the relative germination rate was calculated as salt treatment germination rate / control germination rate.

[0099] The statistical results of relative germination rate are as follows Figure 2 B. The results showed that the relative germination rate of SbMYB12-transgenic Arabidopsis on 100mM and 150mM 1 / 2MS medium was higher than that of wild-type Arabidopsis, indicating that the salt tolerance of SbMYB12-transgenic Arabidopsis during germination was higher than that of wild-type Arabidopsis.

[0100] 2. Phenotypic identification after salt treatment at the seedling stage

[0101] Wild-type Arabidopsis Col-0 and transgenic Arabidopsis with SbMYB12 gene were treated with salt at seedling stage, and phenotypic identification and survival rate analysis were performed after salt treatment. The specific steps are as follows: The length × width × height of the black plug tray used in this experiment is 12 cm × 12 cm × 5 cm, and each black plug tray is filled with 50-60 g of soil. The soil formula used is obtained by mixing imported nutrient soil and vermiculite in a mass ratio of 1:1. The number of transplanted seedlings is 32. The lighting conditions in the culture room and greenhouse are 16 h light / 8 h dark, and the temperature is 22 ° C. After the seedlings cultured on 1 / 2MS medium for 10-14 days are transplanted to the plug tray, they continue to grow normally for 21 days. After the plants grow 10-14 rosette leaves, they are watered with 150 mM sodium chloride solution, and the plant phenotypes are observed after 14 days.

[0102] The phenotypes after 14 days of salt treatment at the seedling stage are as follows Figure 2 C. The survival rate statistics after 14 days of salt treatment in the seedling stage are shown in Figure 2D. The results showed that the survival rates of the homozygous lines OE4, OE9 and OE20 of the SbMYB12 transgenic Arabidopsis were 88.5%, 92.7% and 91.7%, respectively, which were significantly higher than that of the wild-type Arabidopsis Col-0 (32.3%). This indicates that the salt tolerance of the SbMYB12 transgenic Arabidopsis seedlings is higher than that of the wild-type Arabidopsis.

[0103] The above results indicate that overexpression of the SbMYB12 gene can improve the salt tolerance of Arabidopsis thaliana, and the SbMYB12 gene of the present invention can be used to cultivate salt-tolerant plant varieties.

[0104] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention. Sequence Listing <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> Application of sorghum SbMYB12 protein and its encoding gene in regulating plant salt tolerance <130> 3 <170> PatentIn version 3.5 <210> 1 <211> 1071 <212> DNA <213> Artificial Sequence <400> 1 atggggaggg cgccgtgctg cgacaaggtg gggctcaagc gcgggaggtg gacgacggag 60 gaggaccaga tactcgccaa ctacattgcg gagcacggcg agggatcctg gaggtcgctg 120 cccaagaatg cagggctgct ccggtgcggc aagagctgcc ggctgcggtg gatcaactac 180 cttcgggccg acgtcaagag agggaacatc tccaaggagg aagaggacat catcgtcaag 240 ctccacgcca ccctcggcaa caggtggtcc ctgatcgcca gccaccttcc cggccgaaca 300 gacaacgaga tcaagaacca ctggaactcg cacctcagcc gccagatcca cacgtaccgc 360 cggaaataca ccgccgggcc ggacaccacc atcaccatcg acatgagcaa gctgcagagc 420 gccgacaagc gccgcggcgg caggactccg ggccggtcgc cgaggagcag cgccagcagc 480 agcaagagca agaagagtaa taagcagccg gaccctgagc ctgaaccgga gtccggcgac 540 gcgaaaggcg cgtccagccc ggccaccgtc accatcgacg acgacgacaa gcggcacggc 600 ggcaggaccc cgggcctgtc aacgaagagc gctggcagca gcagcaagac caacagcaag 660 cagacggacc ccgagcccga gcccgagccg gagtccggcg acgcgaaagg cgcgtccagc 720 ccggccaccg ccgcgacgtc ggcggcgcac agcgccgtgg tggaccagga tccgaaccag 780 cccaacagca gcagcggcag cacggccgac gggccctgca gcgaggacgc gaccgggccg 840 tgggtgctgg acccgataga cctcggggac ctctgccagg ccgagagcga gatagacgcc 900 ttggtgtcta tcggggccgg ccacgattcg gttgccgaag catttcacgg ggtcggtggt 960 gaggcccagg tggacgacct gttcgacatg gactgggacg gcttcgcggc ccatctatgg 1020 ggcgaaccgg ctccggagca gatcgaccag agcgcgcagc tgcagccata a 1071 <210>2 <211>356 <212>PRT <213>Artificial Sequence <400>2 Met Gly Arg Ala Pro Cys Cys Asp Lys Val Gly Leu Lys Arg Gly Arg 1 5 10 15 Trp Thr Thr Glu Glu Asp Gln Ile Leu Ala Asn Tyr Ile Ala Glu His 20 25 30 Gly Glu Gly Ser Trp Arg Ser Leu Pro Lys Asn Ala Gly Leu Leu Arg 35 40 45 Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg Ala Asp 50 55 60 Val Lys Arg Gly Asn Ile Ser Lys Glu Glu Glu Asp Ile Ile Val Lys 65 70 75 80 Leu His Ala Thr Leu Gly Asn Arg Trp Ser Leu Ile Ala Ser His Leu 85 90 95 Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn His Trp Asn Ser His Leu 100 105 110 Ser Arg Gln Ile His Thr Tyr Arg Arg Lys Tyr Thr Ala Gly Pro Asp 115 120 125 Thr Thr Ile Thr Ile Asp Met Ser Lys Leu Gln Ser Ala Asp Lys Arg 130 135 140 Arg Gly Gly Arg Thr Pro Gly Arg Ser Pro Arg Ser Ser Ala Ser Ser 145 150 155 160 Ser Lys Ser Lys Lys Ser Asn Lys Gln Pro Asp Pro Glu Pro Glu Pro 165 170 175 Glu Ser Gly Asp Ala Lys Gly Ala Ser Ser Pro Ala Thr Val Thr Ile 180 185 190 Asp Asp Asp Asp Lys Arg His Gly Gly Arg Thr Pro Gly Leu Ser Thr 195 200 205 Lys Ser Ala Gly Ser Ser Ser Lys Thr Asn Ser Lys Gln Thr Asp Pro 210 215 220 Glu Pro Glu Pro Glu Pro Glu Ser Gly Asp Ala Lys Gly Ala Ser Ser 225 230 235 240 Pro Ala Thr Ala Ala Thr Ser Ala Ala His Ser Ala Val Val Asp Gln 245 250 255 Asp Pro Asn Gln Pro Asn Ser Ser Ser Gly Ser Thr Ala Asp Gly Pro 260 265 270 Cys Ser Glu Asp Ala Thr Gly Pro Trp Val Leu Asp Pro Ile Asp Leu 275 280 285 Gly Asp Leu Cys Gln Ala Glu Ser Glu Ile Asp Ala Leu Val Ser Ile 290 295 300 Gly Ala Gly His Asp Ser Val Ala Glu Ala Phe His Gly Val Gly Gly 305 310 315 320 Glu Ala Gln Val Asp Asp Leu Phe Asp Met Asp Trp Asp Gly Phe Ala 325 330 335 Ala His Leu Trp Gly Glu Pro Ala Pro Glu Gln Ile Asp Gln Ser Ala 340 345 350 Gln Leu Gln Pro 355 <210>3 <211>4148 <212>DNA <213>Artificial Sequence <400>3 atggggaggg cgccgtgctg cgacaaggtg gggctcaagc gcgggaggtg gacgacggag 60 gaggaccaga tactcgccaa ctacattgcg gagcacggcg agggatcctg gaggtcgctg 120 cccaagaatg caggtaacca gttgcaagct acacaaatag accgccacga acgcatcatc 180 atcacatata ccagctctat atatcttgca acgaactcgt tgggatccat ctttgttcgt 240 cgtccttatt agctagctag ctgtatatag tctaatagcc agaacgacat atatactagc 300 aaggcagcgg cacaagcaaa tgatgacgat actattagcc cgccgccgca ccttgttaat 360 ttctctctc gatctgcatg ccggtgatga tattatgtgc agggctgctc cggtgcggca 420 agagctgccg gctgcggtgg atcactacc ttcggccga cgtcaagaga gggaacatct 480 ccaaggagga agaggacatc atcgtcaagc tccacgccac cctcggcaac aggtaacta 540 tgcaccataa tcacactga gagcgagtgt gcatccgact agtacaagta ctataagca 600 gcttatagct cgccttcata cacaagggga aagtcccaga atataaagc tcagtacttt 660 gcttccctc tttccaaaa tatatataaa aatctcgttt ctgaatagc atcgagcttg 720 attaaatagc atacaaata ttataattt atgatgcata ataagtatta taggttagac 780 tatttga tattattcta tatttaatc tacttgata tattaatatt atagagtttt 840 tataaattt tagttaatt gtcaatttg gaaaaaaga gttttttt aaaaaattta 900 attagtactg aaggagtacc gtatgcaaca ctccctgaca attttttacc aattatttt 960 ggaaaggat ctctggcaga agagtcaacg ccgacaatac tccgctatac tcgttcattc 1020 gtcgagtgt acagatacaa gtggcggctg ctccgcatgc gctttcaaaa cctttttctt 1080 1140 tggttgagag ttgagagacc atacacgtat acagtactgt actatactat atatactaca 1200 gtagtatagt agacacacac acgctgttgg aataggaggc taagcaagcc tgatgcatgg 1260 ctgaaaacaa tgcaacaagg ccaaaatttg ccatccctct aataattagt aagtaactt 1320 cgctcgagcc cgacagcctc atgcatgcat gtacagtatt ttacacctac accaatgtta 1380 attaatctgt acacgcgcgc gtgggctcta cgcacgctcg ctctacaggg cattgagtac 1440 ttaacactga cggtccgatc gatcctgtcc ttgtcactgg ctcgtgtcgc tgcctcgcag 1500 ctgcgtatga attttactgt gcaggagtca ggtgcgtaca ggttcttgag gccacgtgta 1560 cgtgcatgca tggcacgatg gcaaatatgg tatgcctaat gcccccctat atgcccgcca 1620 gactcgtggc ttcgtataat gatgtagtac acagtaagac taagaacaag ttaaatctat 1680 ataacttgc taatcggtca tcgtcgttac atctcttaag atccaaaac agcgacacga 1740 ggaaatgctc gatctattca gttctcgtg tcaaagctgt ataattaa gatatatta 1800 gagaaaagca actactacc agtcctatga tagcgtcgtg cacatactcg cggatttgaa 1860 agtcgtttag gagacgata tggtctccag aacacaattt tgaccttta ttttacaaa 1920 aaataaaaaaaata tattgtatattattattagaag tattttttac aagacaatt 1980 tattcatata atttttttat ttgtaaactt aacaatttaa aagttattga tgatttatat 2040 tcttaatatt tgactcaac cttattcaa atatttcta aatcttatac cttccatatt 2100 ttcaattaaa tgtgtagaaa atatactac tttatttata atatcaata atattttgt 2160 tatttttta taaagttat tattttaga acgagagag tactctgtag tgtagtgtag 2220 tgtcatgtcg tgtcgtgtag tgtcatgtca ataaatcggc ataatagtga tccgcgtatt 2280 gtcctcccgg cctataccta cattacatcc ccgctcttgg ccttgcg tgcgagagca 2340 gtgccgccag cccgtcactc atcaaactt ttgtatatat attatatat aataata 2400 cgtataatat acatggaggt cctggcgaaa gcttaattag ctgtcaatcg tgagcgggtg 2460 agagtgagag gagaggacca cgaaacgaca atttgggcca acactctctt taactcaaga 2520 gagcgaactt gcatgccaga gactaggcat gccgtgcgga ggggtcacga tcttcttgag 2580 gcgcgcacag gagctttccg ccatcttcat ggcctccgcg ttggtctctc gcacccgcag 2640 atccccagta ctgtgcaaag gcgtactttt ggctagcttc cccagagtcg ccttcatctg 2700 atcgcacgct agtacgtagt agctcctaga ggtccagccg tccaggtccc tgtccgtgtg 2760 gccccgtggg attaatggca ggcccacgcc ggccgtaatg atttccggcc tttatgttga 2820 cactactgac gctgagagtg agaggtgcag ctagctgtgg acggcgagaa gtcccgctcc 2880 ggctgcggca catcggcgcc cgctttggac agtatacgga gctttcagcc tgcgctatgc 2940 tcacgacgcg cggtcgattt atattgattg tcggccgtcc agcagcctct tctcagcaaa 3000 tgatatagat tagcgccatg aacacacagg cacacgatta ctacggccta ctgcacacac 3060 atcattaagt agcgcgcgcg atctcaatta gttgcaccaa actcatgttg aactgtcaag 3120 ctagcgtggt gtgatatagt ggctggaaaa ttgtgacgtt gttgtcctgg aaaaactgcg 3180 aggagaggag tagtacctag tgtgttacta gaagtagtac gtaggttgaa gcacgatggc 3240. actgatctag gctgccagtg aaatgcatat gtcaccatcg tacctcgatc gatctccttg 3300 cgacgactta tcgtatttgc tccgaatccg atgcttgcag gtggtccctg atcgccagcc 3360 accttcccgg ccgaacagac aacgagatca agaaccactg gaactcgcac ctcagccgcc agatccacac gtaccgccgg aaatacaccg ccgggccgga caccaccatc accatcgaca tgagcaagct gcagagcgcc gcaagcgcc gcggcggcag gactccgggc cggtcgccga 3540 ggagcagcgc cagcagcagc aagagcaaga aagagtaataa gcagccggac cctgagcctg aaccggagtc cggcgacgcg aaaggcgcgt ccagcccggc caccgtcacc atcgacgacg 3660 acgacaagcg gcacggcggc aggaccccgg gcctgtcaac gaagagcgct ggcagcagca gcaagaccaa cagcaagcag acggaccccg agcccgagcc cgagccggag tccggcgacg cgaaaggcgc gtccagcccg gccaccgccg cgacgtcggc ggcgcacagc gccgtggtgg 3840 accaggatcc gaaccagccc aacagcagca gcggcagcac ggccgacggg ccctgcagcg 3900 aggacgcgac cgggccgtgg gtgctggacc cgatagacct cggggacctc tgccaggccg 3960 agagcgagat agacgccttg gtgtctatcg gggccggcca cgattcggtt gccgaagcat 4020 ttcacggggt cggtggtgag gcccaggtgg acgacctgtt cgacatggac tgggacggct 4080 tcgcggccca tctatggggc gaaccggctc cggagcagat cgaccagagc gcgcagctgc 4140 agccataa 4148

Claims

1. Application of protein or biological materials related to the protein in improving salt tolerance of plants; the plant is Arabidopsis thaliana; The protein is the protein shown in a) or b) below: a) the amino acid sequence is the protein shown in SEQ ID NO: 2; b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2; The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

2. The use according to claim 1, characterized in that: A1) The nucleic acid molecule is a cDNA molecule whose coding sequence is shown in Sequence 1 or a genomic DNA molecule shown in Sequence 3.

3. Use of the protein described in claim 1 or the related biological materials described in claim 1 or 2 in cultivating transgenic plants with improved salt tolerance; the plant is Arabidopsis thaliana.

4. Use of the protein described in claim 1 or the related biological materials described in claim 1 or 2 in plant breeding; the purpose of the breeding is to cultivate salt-tolerant plant varieties; the plant is Arabidopsis thaliana.

5. A method for cultivating transgenic plants with improved salt tolerance, comprising the steps of increasing the expression level and / or activity of the protein described in claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher salt tolerance than the recipient plant; and the plant is Arabidopsis thaliana.

6. The method according to claim 5, characterized in that: The salt tolerance of the transgenic plant is higher than that of the recipient plant, which is reflected in that the germination rate and / or survival rate of the transgenic plant under salt stress is higher than that of the recipient plant.

7. The method according to claim 5 or 6, characterized in that: The method for increasing the expression level and / or activity of the protein of claim 1 in the recipient plant is to overexpress the protein of claim 1 in the recipient plant; The overexpression method is to introduce the gene encoding the protein of claim 1 into a recipient plant.

Images