Application of Protein CsWIN1 in Improving Drought Resistance of Plants

Abstract

The present invention discloses the application of protein CsWIN1 in improving the drought resistance of plants. The amino acid sequence of protein CsWIN1 is shown in SEQ ID NO: 2. Experiments have proved that overexpressing the CsWIN1 gene in cucumber variety 9930 can improve the drought resistance of cucumbers, and the improvement of drought resistance is manifested as an increase in the survival rate after drought treatment. Thus, it can be seen that protein CsWIN1 can improve the stress resistance of plants. The present invention has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of protein CsWIN1 in improving the drought resistance of plants. Background Art

[0002] Drought is the most important environmental factor affecting plant growth and crop yields. Drought has become a serious problem affecting agricultural production. Using genetic engineering methods to improve the drought resistance of crops and enhance the adaptability of agricultural and economic crops to adverse environments is a key and major issue that urgently needs to be solved in the cultivation of new varieties. In recent years, extensive studies have been conducted on the mechanisms by which plants respond to adverse stresses such as drought from physiological, biochemical, metabolic, ecological, genetic, and evolutionary perspectives, accumulating a wealth of data. Especially with the development of molecular biology, people can understand the stress resistance mechanism of plants to drought stress at the molecular level of gene composition, expression regulation, and signal transduction, opening up new ways for using genetic engineering methods to improve the stress resistance performance of plants. Due to the complexity of plant drought-resistant traits, it is very difficult to improve the drought resistance of plants using traditional breeding methods. With the development of molecular biology, genetic engineering methods have opened up new ways for plant drought-resistant breeding, but the isolation of highly efficient drought-resistant genes has become the main factor restricting plant stress-resistant genetic engineering.

[0003] Cucumber (Cucumis sativus L.) is one of the important vegetable crops in China, and its yield and cultivation area rank among the top in the world. Drought stress can cause changes in cucumber morphology and damage to cucumber cells, reduce photosynthetic efficiency, accelerate protein denaturation, and cause leaf wilting. Through in-depth research on the drought resistance mechanism of cucumbers, improving the drought resistance of cucumbers is of great significance for the yield and quality of cucumbers. Summary of the Invention

[0004] The object of the present invention is to improve the drought resistance of plants.

[0005] The present invention first protects the application of protein CsWIN1, which can be S1) or S2):

[0006] S1) Improving the drought resistance of plants;

[0007] S2) Cultivating transgenic plants with improved drought resistance;

[0008] The amino acid sequence of the protein CsWIN1 is shown in SEQ ID NO: 2.

[0009] The present invention also protects the application of a nucleic acid molecule encoding the protein CsWIN1, which can be S1) or S2):

[0010] S1) Improving the drought resistance of plants;

[0011] S2) Cultivate transgenic plants with improved drought resistance.

[0012] In the above application, the nucleic acid molecule encoding the protein CsWIN1 can be b1) or b2):

[0013] b1) The coding region is the DNA molecule shown in SEQ ID NO: 1;

[0014] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1.

[0015] Among them, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0016] Among them, SEQ ID NO: 1 consists of 840 nucleotides, and the nucleotides of SEQ ID NO: 1 encode the amino acid sequence shown in SEQ ID NO: 2.

[0017] In any of the above applications, the plant can be cucumber.

[0018] In any of the above applications, the improvement of plant drought resistance can be manifested as an increase in survival rate after drought treatment.

[0019] The present invention also protects a method for cultivating transgenic plants, including the following steps: increasing the expression level and / or activity of the protein CsWIN1 in the starting plant to obtain transgenic plants; compared with the starting plant, the drought resistance of the transgenic plants is increased;

[0020] The amino acid sequence of the protein CsWIN1 is as shown in SEQ ID NO: 2.

[0021] In the above method, the increase in the expression level and / or activity of the protein CsWIN1 in the starting plant can be achieved by methods well known in the art such as transgenesis, multiple copies, promoter modification, regulatory factors, etc., so as to increase the expression level and / or activity of any of the above-mentioned proteins CsWIN1 in the starting plant.

[0022] In the above method, the increase in the expression level and / or activity of the protein CsWIN1 in the starting plant can be achieved by introducing a nucleic acid molecule encoding the protein CsWIN1 into the starting plant.

[0023] In the above method, the nucleic acid molecule encoding the protein CsWIN1 can be b1) or b2):

[0024] b1) The coding region is the DNA molecule shown in SEQ ID NO: 1;

[0025] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1.

[0026] Among them, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0027] Among them, SEQ ID NO: 1 consists of 840 nucleotides, and the nucleotides of SEQ ID NO: 1 encode the amino acid sequence shown in SEQ ID NO: 2.

[0028] In the above method, the introduction of the nucleic acid molecule encoding the protein CsWIN1 into the starting plant can be achieved by introducing a recombinant vector into the starting plant; the recombinant vector can be a recombinant plasmid obtained by inserting the nucleic acid molecule encoding the protein CsWIN1 into an expression vector. The expression vector can specifically be vector Wmv077.

[0029] The recombinant vector can specifically be recombinant plasmid Wmv077-CsWIN1. The recombinant plasmid Wmv077-CsWIN1 can be a recombinant plasmid obtained by inserting the DNA molecule shown from the 1st to 837th positions at the 5' end of SEQ ID NO: 1 into the recognition site of restriction endonuclease BamHI of vector Wmv077. The transgenic plant can specifically be CsWIN1-OE1 and CsWIN1-OE2 mentioned in the examples. At this time, the starting plant is cucumber, specifically cucumber cultivar 9930.

[0030] The present invention also protects a plant breeding method, which may include the following steps: increasing the content and / or activity of the protein CsWIN1 in the plant, thereby increasing the drought resistance of the plant;

[0031] The amino acid sequence of the protein CsWIN1 is as shown in SEQ ID NO: 2.

[0032] In any of the above methods, the plant can be cucumber.

[0033] In any of the above methods, the increase in drought resistance can be manifested as an increase in the survival rate after drought treatment.

[0034] Any of the above cucumbers can be cucumber cultivar 9930.

[0035] Experimental results show that overexpression of the CsWIN1 gene in cucumber cultivar 9930 can improve the drought resistance of cucumber, and the improvement in drought resistance is manifested as an increase in the survival rate after drought treatment. The protein CsWIN1 can improve the stress resistance of plants. The present invention has important application value. Description of the Drawings

[0036] Figure 1 It is a partial structural schematic diagram of the recombinant plasmid Wmv077-CsWIN1.

[0037] Figure 2 It is the molecular identification of CsWIN1-OE1 and CsWIN1-OE2.

[0038] Figure 3 It is the Western blot analysis of CsWIN1-OE1 and CsWIN1-OE2 proteins.

[0039] Figure 4 It is the growth status of cucumber seedlings after drought treatment and after rehydration recovery. Specific implementation manners

[0040] The present invention will be further described in detail below in conjunction with specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0041] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0042] In the following embodiments, all quantitative tests are set up with three repeated experiments, and the results are averaged.

[0043] The vector Wmv077 is a product of Weimi Biotechnology Co., Ltd., and the product number is WMV1311.

[0044] The cucumber variety 9930 is recorded in the following literature: Miao Tiantian, Li Qiang, Yu Hongjun, Liu Peng, Hao Jia, Jiang Weijie. Effects of exogenous inositol on low temperature resistance of cucumber seedlings. China Vegetables. 2021, Vol.1, Issue(2): 72-79

[0045] Example 1. Cloning of the coding gene of protein CsWIN1 (i.e., CsWIN1 gene)

[0046] 1. Extract the total RNA from the leaves of cucumber variety 9930, and then reverse transcribe the first-strand cDNA with reverse transcriptase, that is, obtain the cDNA of cucumber variety 9930.

[0047] 2. Using the cDNA of cucumber variety 9930 obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of primer F1: 5’-ATGATGTACGGACAAATTA-3’ and primer R1: 5’-TTACTCGCCACTTGTACA-3’, and recover the PCR amplification product of approximately 840 bp.

[0048] 3. Sequence the PCR amplification product recovered in step 2. The sequencing result shows that the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 1.

[0049] Name the gene shown in SEQ ID NO: 1 as the CsWIN1 gene. The CsWIN1 gene encodes the protein

[0050] CsWIN1, and the amino acid sequence of protein CsWIN1 is as shown in SEQ ID NO: 2.

[0051] Example 2. Obtaining of CsWIN1 gene - transformed cucumbers and identification of drought resistance

[0052] I. Construction of recombinant plasmid Wmv077 - CsWIN1

[0053] 1. Using the PCR amplification product recovered in step 2 of Example 1 as a template, perform PCR amplification with the primer pair consisting of primer F2: 5’- GAACACGGGGGA Cgtcgac ATGATGTACGGACAAATTA-3’ (the underlined part is the linker sequence) and primer R2: 5’- GGAACATCGTATG GGTAcat CTCGCCACTTGTACA-3’ (the underlined part is the linker sequence), and recover the DNA fragment of approximately 876 bp.

[0054] 2. Digest the vector Wmv077 with the restriction endonuclease BamHI, and recover the 11 kb vector backbone.

[0055] 3. Recombinantly ligate the DNA fragment recovered in step 1 and the vector backbone recovered in step 2 using a recombinase (TransGen Biotech, CU101 - 01) to obtain the recombinant plasmid Wmv077 - CsWIN1.

[0056] Sequence the recombinant plasmid Wmv077 - CsWIN1. The sequencing result shows that the recombinant plasmid Wmv077 - CsWIN1 is a recombinant plasmid obtained by inserting the DNA molecule shown at positions 1 to 837 from the 5’ end of SEQ ID NO: 1 into the restriction endonuclease BamHI recognition site of the vector Wmv077.

[0057] The recombinant plasmid Wmv077-CsWIN1 expresses the protein CsWIN1 shown in SEQ ID NO: 2. The recombinant plasmid Wmv077-CsWIN1 has an HA tag, and the protein CsWIN1 and the HA tag are fused into the CsWIN1-HA protein.

[0058] A partial structural schematic diagram of the recombinant plasmid Wmv077-CsWIN1 is shown in Figure 1 .

[0059] II. Obtaining of recombinant Agrobacterium

[0060] 1. The recombinant plasmid Wmv077-CsWIN1 was introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, named GV3101 / Wmv077-CsWIN1.

[0061] 2. The vector Wmv077 was introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, named GV3101 / Wmv077.

[0062] III. Obtaining and molecular identification of T1 generation CsWIN1 gene-transformed cucumbers

[0063] 1. Obtaining of T0 generation CsWIN1 gene-transformed cucumber seedlings

[0064] (1) Select the seeds of the cucumber variety 9930 that are plump and complete. After peeling, first disinfect them in 70% (v / v) ethanol aqueous solution for 30 s, then place them in 2.0% sodium hypochlorite solution for sterilization for 15 min, and finally rinse them several times with sterile water and sow them on the MS solid medium. After the cotyledons just break through the shell (about 2 - 3 d), cut off the growing point and hypocotyl, and cut off the upper half of both cotyledons, leaving the lower half of the cotyledons as cotyledon explants.

[0065] MS solid medium: Dissolve 4.43 g of MS powder and 30 g of sucrose in an appropriate amount of deionized water, then add 2.5 g of phytagel, and make up the volume to 1 L with deionized water, and adjust the pH value to 5.7 - 5.8.

[0066] (2) Inoculate a single colony of GV3101 / Wmv077-CsWIN1 into YEB liquid medium containing 50 mg / L kanamycin and 70 mg / L rifampicin, and shake it overnight at 28 °C and 200 rpm / min to obtain bacterial liquid 1. Add 2 mL of bacterial liquid 1 to 50 mL of YEB liquid medium containing 50 mg / L kanamycin and 70 mg / L rifampicin, and culture it with shaking at 28 °C to obtain bacterial liquid 2 with an OD

[0062] , , ,

[0066] , , 600nm ,

[0065] , 600nm , ,

[0064] , ,

[0063] of 0.6 - 0.8. Take bacterial liquid 2, centrifuge it at 5000 rpm for 5 min, collect the thalli, then wash them once with 1 / 2 MS liquid medium first, and then dilute them with 1 / 2 MS liquid medium to obtain an OD 600nmThe infection solution is about 0.2.

[0067] 1 / 2 MS liquid medium: Dissolve 2.2 g of MS powder and 30 g of sucrose in an appropriate amount of deionized water, then make up the volume to 1 L with deionized water, and adjust the pH value to 5.7 - 5.8.

[0068] (3) Infect the cotyledon explants with the infection solution obtained in step (2) for 15 min. After the infection is completed, blot the excess infection solution with sterilized filter paper, and inoculate the cotyledon explants with the back facing down on the MS differentiation medium, and culture them in the dark at 28 °C for 2 d.

[0069] MS differentiation medium: Dissolve 4.43 g of MS powder, 30 g of sucrose, 2.5 g of phytagel, 0.5 mg of 6 - BA and 1 mg of ABA in an appropriate amount of deionized water, then make up the volume to 1 L with deionized water, and adjust the pH value to 5.7 - 5.8.

[0070] (4) After completing step (3), transfer the cotyledon explants to the MS differentiation medium containing 25 mg / L of kanamycin and 500 mg / L of carbenicillin, and culture them under alternating light and dark conditions at 28 °C (16 h light culture / 8 h dark culture, light intensity is 2000 lx) for 15 - 20 d to obtain resistant buds about 1 - 1.5 cm.

[0071] (5) After completing step (4), cut off the resistant buds and transfer them to the MS rooting medium containing 100 mg / L of kanamycin to induce rooting, and obtain resistant cucumber seedlings with 5 - 6 leaves (at this time, the cucumber roots develop well).

[0072] MS rooting medium: Dissolve 4.43 g of MS powder, 30 g of sucrose and 2.5 g of phytagel in an appropriate amount of deionized water, then make up the volume to 1 L with deionized water, and adjust the pH value to 5.7 - 5.8.

[0073] (6) After completing step (5), transfer the resistant cucumber seedlings into flower pots filled with sterile soil, cover them with plastic wrap to keep moisture, culture them in an artificial climate chamber for one week, then transfer them to the greenhouse and adapt them in the greenhouse for 3 - 5 d, and finally transfer them to the greenhouse for routine management to obtain T0 generation transgenic CsWIN1 gene cucumber seedlings.

[0074] 2. Obtaining of T1 generation transgenic CsWIN1 gene cucumber

[0075] (1) Self - cross the T0 generation transgenic CsWIN1 gene cucumber seedlings to obtain T1 generation transgenic CsWIN1 gene cucumber seeds.

[0076] (2) Sow the T1 generation of CsWIN1 - transgenic cucumber seeds on MS solid medium containing hygromycin. The cucumber seedlings that can grow normally are the T1 generation of CsWIN1 - transgenic cucumbers. Name the two T1 generation CsWIN1 - transgenic cucumber lines CsWIN1 - OE1 and CsWIN1 - OE2 respectively.

[0077] According to the above steps, replace GV3101 / Wmv077 - CsWIN1 with GV3101 / Wmv077, and keep other steps unchanged to obtain the T1 generation of transgenic cucumbers with empty vector.

[0078] 3. Molecular identification

[0079] Extract the genomic DNA of the cucumber seedlings to be tested (T1 generation seedlings of CsWIN1 - OE1, T1 generation seedlings of CsWIN1 - OE2, seedlings of T1 generation transgenic cucumbers with empty vector, or seedlings of cucumber variety 9930, and all seedlings have the same growth days), and use it as a template. Perform PCR amplification with the primer pair composed of 5’ - CCAGATCCCCCGAATTAAAGC - 3’ and 5’ - CTCGCCACTTGTACATTTTGC - 3’ to obtain the PCR amplification product; then make the following judgment: If a DNA fragment of about 1700bp is contained in a certain PCR amplification product, the cucumber seedling to be tested corresponding to this PCR amplification product is a positive seedling.

[0080] The agarose gel electrophoresis results of the PCR amplification products of the T1 generation seedlings of CsWIN1 - OE1 and the T1 generation seedlings of CsWIN1 - OE2 are shown in Figure 2 (Mark is DNA Marker).

[0081] The results show that the T1 generation seedlings of CsWIN1 - OE1 and the T1 generation seedlings of CsWIN1 - OE2 are both positive seedlings. The seedlings of the T1 generation transgenic cucumbers with empty vector and cucumber variety 9930 are not positive seedlings.

[0082] IV. Western blot analysis of T1 generation CsWIN1 - transgenic cucumbers

[0083] 1. Total protein extraction

[0084] Extract the total proteins from the true leaves of cucumber seedlings to be tested (T1 generation seedlings of CsWIN1 - OE1, T1 generation seedlings of CsWIN1 - OE2, T1 generation cucumber seedlings transformed with empty vector, or cucumber variety 9930 seedlings, and all seedlings have the same growth days). The specific steps are as follows: Grind the true leaves of cucumber seedlings to be tested in liquid nitrogen, transfer the ground freeze-dried powder into a centrifuge tube containing 300 - 800 μL of protein extraction buffer (the solute and its concentration are 100 - 150 mM NaCl, 10% glycerol, 5 mM DTT (Solarbio, D8220), 1% (v / v) NP40 (Sigma, 18896), 1% (v / v) protease inhibitor (Sigma - P9599), and 1 mM PSFM (Solarbio, P0100), and the solvent is pH 7.5, 50 mM Tris - HCl buffer), incubate on ice for 30 min after homogenization, centrifuge at 4°C and 12000 rpm for 20 min, collect the supernatant, and the supernatant is the total protein of the true leaves of cucumber seedlings to be tested, hereinafter referred to as the total protein of cucumber seedlings to be tested).

[0085] 2. Protein immunoblot analysis

[0086] (1) Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS - PAGE)

[0087] Add an appropriate amount of 5×SDS loading buffer (Yisheng Company) to the total protein of cucumber seedlings to be tested, heat in a 95°C metal bath for 10 min, centrifuge at 12000 rpm for 30 min and then load the sample; Select a 10% MOPS precast gel (GenScript), place it on a Bio - Rad protein electrophoresis apparatus, add 1× electrophoresis buffer, and perform electrophoresis at a constant voltage of 140 V for 1 h.

[0088] (2) Membrane transfer

[0089] Take filter paper (specification: 10 cm × 7.5 cm, Biosharp, BS - TPB - 03B) and PVDF membrane (specification: 8.5 cm × 5.5 cm, Millipore, IPVH00010), use a Bio - Rad wet transfer tank, transfer the membrane by the sandwich method (from the negative electrode to the positive electrode: filter paper - gel - PVDF membrane - filter paper), add transfer buffer (Coolaber, SL1324), and transfer the membrane at a constant current of 220 mA for 1.5 h.

[0090] (3) Blocking

[0091] After completing step (2), take out the PVDF membrane and put it into an antibody incubation box, add 10 mL of blocking solution, and gently shake on a shaker for 6 h.

[0092] The blocking solution is a 5% skim milk (CST, 9999S) solution (the solvent is 1×TBST buffer (a product of Huaxingbochuang Company, product catalog number HX1893)).

[0093] (4) Primary antibody incubation

[0094] After completing step (3), replace with 10 mL of fresh blocking solution, then add Anti-HA antibody (a product of Jingjie Biotech Co., Ltd., product catalog number PTM-5389) as the primary antibody, and incubate overnight at 4°C; then rinse with 1×TBST three times, 10 minutes each time.

[0095] (5) Secondary antibody incubation

[0096] After completing step (4), add Anti-rabbit lgG, HRP-linked Antibody (a product of CST Company, product catalog number 7074S) as the secondary antibody, and incubate at room temperature for 50 minutes; then rinse with 1×TBST three times, 10 minutes each time.

[0097] (6) Luminescence development

[0098] After completing step (5), cover the membrane with ECL luminescence solution (prepared by mixing solution A and solution B in a 1:1 ratio from a product with catalog number E412-05 of Novoprotein Co., Ltd.) and react for 3 minutes, then place it in a luminescence detector (ChemiDocTM Touch Imaging System) to detect the luminescence situation.

[0099] According to the above steps, replace Anti-HA antibody with Anti-actin antibody (a product of Huaxingbochuang Company, product catalog number HX1843), replace Anti-rabbit lgG, HRP-linked Antibody with Anti-mouse lgG, HRP-linked Antibody (a product of CST Company, product catalog number 7076S), and keep other steps unchanged as the internal reference.

[0100] Partial detection results are shown in Figure 3(9930 is the seedling of cucumber variety 9930, CsWIN1-OE1 is the T1 generation seedling of CsWIN1-OE1, and CsWIN1-OE2 is the T1 generation seedling of CsWIN1-OE2). The results showed that, compared with the seedlings of cucumber variety 9930, the content of CsWIN1-HA protein in the T1 generation seedlings of CsWIN1-OE1 and CsWIN1-OE2 was significantly increased, that is, the content of protein CsWIN1 in the T1 generation seedlings of CsWIN1-OE1 and CsWIN1-OE2 was significantly increased. Among them, the content of protein CsWIN1 in the T1 generation seedlings of CsWIN1-OE2 increased to a higher degree and was used for subsequent drought resistance identification.

[0101] V. Drought Resistance Identification of T1 Generation CsWIN1 Transgenic Cucumbers

[0102] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows:

[0103] 1. Take the cucumber seeds to be tested (T1 generation seeds of CsWIN1-OE2 or cucumber variety 9930 seeds), first disinfect them in 70% (v / v) ethanol aqueous solution for 30 s, then place them in 2.0% sodium hypochlorite solution for sterilization for 15 min, and finally rinse them several times with sterile water and sow them in a flower pot (with a diameter of 7 cm, a pot height of 7.3 cm, and a bottom diameter of 5 cm) containing 40 g of nutrient soil, and cultivate them normally for 14 days to obtain the cucumber seedlings to be tested before drought treatment.

[0104] To ensure the consistency of experimental conditions as much as possible, 1 cucumber seedling to be tested was transplanted into each flower pot. Water 30 mL every day to ensure that the soil is moist and the plants are not short of water, and cultivate them in the same incubator.

[0105] 2. After completing step 1, take 4 cucumber seedlings to be tested before drought treatment with basically the same growth state, stop watering for 3 days or 6 days to obtain the cucumber seedlings to be tested after drought treatment.

[0106] 3. After completing step 2, take the cucumber seedlings to be tested after drought treatment, add 50 mL of water (poured in two times) and resume cultivation for 1 night to obtain the cucumber seedlings to be tested after rehydration.

[0107] 4. Observe the growth states of the cucumber seedlings to be tested before drought treatment, the cucumber seedlings after drought treatment, and the cucumber seedlings to be tested after rehydration and recovery; count the survival rate of the cucumber seedlings to be tested after rehydration.

[0108] The growth states of the cucumber seedlings to be tested after drought treatment and after rehydration and recovery are shown in Figure 4(9930 is cucumber variety 9930, and CsWIN1OE is CsWIN1-OE2). The results showed that before drought treatment, there was no significant difference in the growth status between the T1 generation of CsWIN1 transgenic cucumber (CsWIN1-OE2) and cucumber variety 9930; after 3 days of drought treatment, compared with cucumber variety 9930, the growth status of the T1 generation of CsWIN1 transgenic cucumber (CsWIN1-OE2) was better, and the survival rate was significantly increased (the survival rate of the T1 generation of CsWIN1 transgenic cucumber (CsWIN1-OE2) was 100%, and the survival rate of cucumber variety 9930 was 75%); after 6 days of drought treatment, compared with cucumber variety 9930, the growth status of the T1 generation of CsWIN1 transgenic cucumber (CsWIN1-OE2) was better, and the survival rate was significantly increased (the survival rate of the T1 generation of CsWIN1 transgenic cucumber (CsWIN1-OE2) was 100%, and the survival rate of cucumber variety 9930 was 0%).

[0109] The above results indicate that by introducing the CsWIN1 gene into cucumbers to increase the expression level of protein CsWIN1, the drought resistance of cucumbers can be enhanced; the enhancement of drought resistance is manifested as an increase in the survival rate of cucumber seedlings under drought stress.

[0110] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including changes made by using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. Use of the overexpressed protein CsWIN1, which is S1) or S2): S1) Improving the drought resistance of cucumbers; S2) Cultivating transgenic cucumbers with improved drought resistance; The amino acid sequence of the protein CsWIN1 is shown in SEQ ID NO:

2.

2. Use of the overexpressed nucleic acid molecule encoding the protein CsWIN1 described in claim 1, which is S1) or S2): S1) Improving the drought resistance of cucumbers; S2) Cultivating transgenic cucumbers with improved drought resistance.

3. The application according to claim 2, wherein: The nucleic acid molecule encoding the protein CsWIN1 described in claim 1 is b1) or b2): b1) The coding region is the DNA molecule shown in SEQ ID NO: 1; b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO:

1.

4. The application according to any one of claims 1 to 3, characterized in that: The improvement of the drought resistance of cucumbers is manifested as an increase in the survival rate after drought treatment.

5. A method for cultivating transgenic cucumbers, comprising the following steps: increasing the expression level of the protein CsWIN1 in the starting cucumbers to obtain transgenic cucumbers; compared with the starting cucumbers, the drought resistance of the transgenic cucumbers is increased; The amino acid sequence of the protein CsWIN1 is shown in SEQ ID NO:

2.

6. The method according to claim 5, wherein: The increase in the expression level of the protein CsWIN1 in the starting cucumbers is achieved by introducing the nucleic acid molecule encoding the protein CsWIN1 into the starting cucumbers.

7. A cucumber breeding method, comprising the following steps: increasing the content of the protein CsWIN1 in cucumbers, thereby increasing the drought resistance of cucumbers; The amino acid sequence of the protein CsWIN1 is shown in SEQ ID NO:

2.

8. The method according to any one of claims 5 to 7, characterized in that: The increase in drought resistance is manifested as an increase in the survival rate after drought treatment.

Images