Method for preventing and controlling pathogenic organisms of ciliates of aquatic animals

By targeting the DHC7 gene of *Isoceratops aegyptiacus* using the CRISPR-Cas system, an engineered strain was constructed, solving the safety and efficiency issues of existing technologies for controlling *Isoceratops aegyptiacus*. This achieved a highly efficient and pollution-free control effect and promoted targeted drug research.

CN117210475BActive Publication Date: 2026-02-24NINGBO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311160235.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-11
Publication Date
2026-02-24
Estimated Expiration
2043-09-11

AI Technical Summary

Technical Problem

Current technologies lack targeted and efficient methods for controlling aeolian encephalomyelitis. Chemical drugs pose safety and pollution problems, while biological methods have poor targeting and high costs, making it difficult to effectively control aeolian encephalomyelitis.

Method used

Using the CRISPR-Cas system, sgRNA and crRNA targeting the DHC7 gene of *Isocera spp.* were designed, and engineered strains were constructed. The Cas9 and Cas13 proteins were used to efficiently cleave the DNA and RNA of *Isocera spp.* in aquatic animals, achieving targeted prevention and control.

Benefits of technology

This has enabled efficient, safe, and pollution-free control of aberrant encephalomyelitis, improved control efficiency, and expanded the possibilities for research on the function of pathogenic genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117210475B_ABST
    Figure CN117210475B_ABST
Patent Text Reader

Abstract

The application provides a method for preventing and controlling ciliates pathogenic organisms of aquatic animals, that is, an engineering strain for targeting DHC7 gene of heterakis sparrow-saku based on CRISPR system. The method for preventing and controlling ciliates pathogenic organisms of aquatic animals based on CRISPR-Cas system can not only make up for defects such as poor targeting and water pollution of chemical methods, but also overcome problems such as poor targeting and single prevention effect of existing biological methods, and realize efficient and targeted prevention and treatment of heterakis sparrow-saku disease. Meanwhile, the method can be further expanded to study the functions of specific genes, including the role of pathogenic genes in the invasion and pathogenic process of heterakis sparrow-saku, and has a promoting effect on the subsequent research of drugs with higher targeting efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquatic animal disease prevention and control technology, specifically relating to a method for the biological control of ciliate pathogens in aquatic animals. Background Technology

[0002] Scuticociliatosis is one of the most serious diseases among marine aquaculture animals, characterized by diverse hosts, rapid outbreaks, and severe damage. *Mesanophrys sp.* is a facultative parasite that normally lives freely, but can become parasitic under certain conditions, acting as a scavenger. It consumes the cells and tissue debris of certain mollusks, crustaceans, and fish, growing and multiplying within their tissues. *Mesanophrys sp.* primarily infects the hemolymph of the swimming crab (Portunus trituberculatus), parasitizing the crab and feeding on its blood cells and body tissues, ultimately leading to the crab's death and causing significant losses for aquaculture farmers.

[0003] Currently, there is a lack of effective prevention and treatment methods for *Heterocystis* disease. In aquaculture practice, prevention is mainly achieved by spraying formalin into the water. However, formalin solution is highly volatile, and long-term exposure can cause harm to humans and is carcinogenic, making its long-term use in production unsuitable. Some studies have used quinine sulfate injection as a targeted prevention and treatment for *Heterocystis*, but this method requires intra-individual injection and is costly, making it difficult to promote. Furthermore, existing methods for controlling *Heterocystis* are broad-spectrum, resulting in high costs, low efficiency, and varying degrees of negative environmental impact. Currently, there is no targeted and highly effective control program for *Heterocystis* disease. Therefore, establishing a safe, highly targeted, green, and pollution-free method for controlling *Heterocystis* disease is a critical issue that urgently needs to be addressed. Summary of the Invention

[0004] To address the aforementioned problems, this invention establishes a novel biological method based on the CRISPR system for the efficient cleavage of the DNA and RNA sequences of *Isocera spp.* to achieve targeted prevention and control of *Isocera spp.*, providing a new direction for the prevention and control of *Isocera spp.* in aquaculture and contributing to the development of novel antiparasitic drugs targeting *Isocera spp.*

[0005] This invention first provides a target gene for *Hemicera heteroceratops*, the sequence of which is the DHC7 gene:

[0006] ATGATTTTGGTAAGACACGGTCTCATGGTCGTAGGAATGCC

[0007] CTTTTCCGGAAAAACTTCAATTTTACACACCCTAGCAGGCGCTT

[0008] TAACAAAATTAGAAGAAAGAGGAAAAATGAACGAACACAGAA

[0009] CCAAAATTATAACTTTAAATCCTAAATCTATCAATATGAAACTTC

[0010] TTTATGGGTATGCTGATGAAGTATCCCACGAGTGGGAAGATGGA

[0011] GTTTTGGCCAAAAAATATAAAGTTTTCTCAAAAGATGAAAGTAC

[0012] AGACAGAAAATGGTTAATTTTCGATGGACCTATTGATGCTGTTT

[0013] GGATCGAAAATATGAATACCGTGCTTGATGATAATAAAAAACTT

[0014] TGTTTAAATTCAGGAGAAATTATTGCCATGAATAATACTATGAAT

[0015] ATGATCTCGAACCCATGGATTTGGAAGCCGCTTCGCCCGCTAC

[0016] CGTATCCAGATGTGGTATGATTTATATGGAACCCGAATCAATGGG

[0017] ATGGGTTCCTATTTTCTACTCTTGGTTATAA(SEQ ID NO:1),

[0018] In another aspect, the present invention provides an sgRNA targeting the DHC7 gene, which is sgRNA1 or sgRNA2, wherein the sequence of sgRNA1 is as follows: TCGATCCAAACAGCATCAATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:2);

[0019] The sequence of sgRNA2 is as follows:

[0020] CTTTTCAAAGGTATCACCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 3);

[0021] Another aspect of the present invention provides a crRNA targeting the DHC7 gene, which is crRNA1 or crRNA2, wherein the sequence of crRNA1 is as follows:

[0022] GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACATTTTCGATCCAAACAGCATCAATAGGT(SEQID NO:4);

[0023] The sequence of crRNA2 is as follows:

[0024] GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACCGGAGGTGATACCTTTGAAAAGTGGTAA(SEQID NO:5);

[0025] The present invention also provides an engineered strain established by the CRISPR-Cas method, wherein the engineered strain carries a plasmid for expressing Cas9 protein and the above-mentioned sgRNA.

[0026] The present invention also provides another engineered strain based on the CRISPR-Cas method, wherein the engineered strain carries a plasmid for expressing Cas13 protein and the above-mentioned crRNA.

[0027] The engineered strain constructed in this invention is the DE3 engineered strain.

[0028] This invention provides one use of the engineered strain in the control of Heterocystis aeruginosa.

[0029] The present invention also provides a product for preventing and treating *Isocera spp.*, wherein the product contains the aforementioned engineered strain.

[0030] This invention presents a CRISPR-Cas-based method for the biological control of aquatic ciliate pathogens. It overcomes the shortcomings of chemical methods, such as poor targeting and water pollution, and also addresses the limitations of existing biological methods, which offer only single preventative effects and poor targeting. This method achieves highly efficient and targeted control of *Heteroceratops aegyptiacus* disease. Furthermore, this method allows for further research into the function of specific genes, including the role of pathogenic genes in the *Heteroceratops aegyptiacus* invasion and pathogenesis process, thus promoting the development of drugs with higher targeting efficiency. Attached Figure Description

[0031] Figure 1 Schematic diagram of the construction of Cas9 and Cas13 engineered bacteria.

[0032] Figure 2 Cas9-targeted inhibition effect;

[0033] Figure 3 : Cas13 targeted inhibition effect diagram. Detailed Implementation

[0034] The CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system originates from the prokaryotic immune system, used to resist the invasion of foreign genetic material, such as bacteriophages and foreign plasmids. It has spawned various tools for gene editing, gene knockdown, and gene interference. The CRISPR-Cas9 system consists of the Cas9 protein, which has endonuclease function, and a guide RNA sequence (sgRNA) targeting the target gene. The sgRNA includes a 20 nt spacer sequence and a 76 nt scaffold sequence, enabling it to target and cleave DNA sequences. The CRISPR-Cas13 system consists of the Cas13 protein, which has endonuclease function, and a guide RNA sequence (crRNA) targeting the target RNA. The crRNA includes a 36 nt direct repeat sequence and a 28 nt spacer sequence, enabling it to target and cleave the target RNA sequence.

[0035] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings.

[0036] Example 1: Culture of Heterocystis and Bacteria

[0037] The continuous culture system of *Isocera spp.* used in this embodiment was 20 ml (culture system shown in Table 1), mainly composed of 5% (v / v) Leibovitz's L-15 medium (Solarbio, LA9510) and 1% (v / v) streptomycin and penicillin dual antibiotics, with the remaining volume made up using sterilized artificial seawater. The artificial seawater, with a salinity of 23 psu, was filtered through a 0.2 μm filter membrane, autoclaved at 121°C for 20 min, cooled, and stored at room temperature. The above culture system was added to 50 ml sterile Erlenmeyer flasks, placed in a 20°C incubator for static incubation, and sealed with sealing film at the mouth of the flasks. Feeding experiments used *Isocera spp.* that had reached the stationary phase (approximately 30,000 ind / ml).

[0038] Table 1: Continuous passage culture system of *Heterocereus angiotensinus*

[0039]

[0040] Molecular cloning was performed using *Escherichia coli* DH5α strain, and *Heterocystis aeruginosa* was fed with *E. coli* DE3 and its derivatives. *E. coli* was cultured in liquid LB medium (10 g / L peptone, 5 g / L yeast, 10 g / L NaCl) at 37°C with shaking at 180 rpm, or in solid LB agar plates (liquid LB medium supplemented with 1.5% agar powder) at 37°C in a static incubator. The absorbance of the cultures at 600 nm was measured using a spectrophotometer to determine the growth status of *E. coli*. The engineered strains DH5α and DE3 required supplementation with kanamycin (50 mg / L) in both solid and liquid LB agar plates during culture, while the wild-type strain did not.

[0041] Example 2: Acquisition of the target gene DHC7 and design of sgRNA and crRNA

[0042] 2.1 Obtaining the target gene DHC7

[0043] The sequence of the DHC7 gene of *Heterocerebralis praecox* (SEQ ID NO:1) was obtained by amplification, and primers were designed using Primer Primier 6. MightyAmp was used... TM DNA Polymerase Ver.3 was used for PCR. The PCR products were detected by 1% agarose gel electrophoresis, and then the gel was cut and recovered. The cut PCR products were recovered using the easystep Super Gel & PCR gel extraction kit. The obtained 28S and DHC7 products were then ligated. -Blunt, following the kit instructions, picked white monoclonal antibodies and added them to 500 μL of LB liquid medium supplemented with kanamycin (50 mg / L). Incubate at 37°C and 220 rpm for 6 hours. Once E. coli growth is visible to the naked eye, use MightyAmp... TM DNAPolymerase Ver.3 was used for bacterial culture PCR verification. The plasmid was sequenced using primers M13F and M13R. The sequencing results were compared with the DHC7 sequence. Then, the sequencing results of the upstream and downstream fragments were merged using Seqman software to obtain the full length of the target gene.

[0044] 2.2 Design of sgRNA and crRNA targeting gene DHC7

[0045] sgRNA and crRNA are designed according to the sgRNA design rules of the CRISPR / Cas9 system, where the design rules are as follows:

[0046] ① A 20nt interval sequence, followed by a 5'-NGG (PAM sequence).

[0047] ②The sgRNA sequence cannot contain 6 or more consecutive T's;

[0048] ③NGG cannot have 3 consecutive Ts in the first 6 bps;

[0049] ④ The GC content should be between 25% and 80%. For the crRNA design of the CRISPR / Cas13 system: select a 28nt sequence on the template strand, without considering flanking sequence preference.

[0050] ⑤ The final obtained guide sgRNA sequence for Cas9 and guide crRNA sequence for Cas13 are shown in Table 2.

[0051] Table 2: Guide RNA sequence information for sequences targeting the DHC7 gene

[0052]

[0053] Example 3: Construction of recombinant vector and transformation into DE3 engineered strain

[0054] 1. Construction of CRISPR / Cas9 vectors

[0055] A pBBR-MCS empty vector containing pBBR-MCS was constructed, with the pBBR replicon having an added multiple cloning site, SV40 NLS, 6Xhistag, and other markers. The SpCas9 gene sequence was amplified from the commercial plasmid PMJ922, with SacI and BamHI digestion sites added at both ends. After double digestion, the purified target fragment was ligated into pBBR-MCS using T4 DNA ligase, digested with the same enzymes. The ligation product was then transformed into DH5α competent cells. After colony culture, plasmid extraction and enzyme digestion verification were performed before assays, and the recombinant vector was named pBBR1-Cas9 expression vector. The sgRNA sequence was synthesized by Sangon Biotec. The sgRNA expression cassette was ligated into the pBBR-Cas9 expression vector to construct the pCas9-sgRNA recombinant vector, which was then validated and finally transformed into expression strain DE3.

[0056] 2. Construction of CRISPR / Cas13 vector

[0057] Similarly, the target sequence of Cas13 was amplified from the commercial plasmid pC0040. SacI and BamHI digestion sites were added to both ends, followed by double digestion. The purified target fragment was ligated into pBBR-MCS using T4 DNA ligase and verified using the same procedure. The Cas13 expression vector pBBR-Lwacas13a was constructed using the above molecular cloning operations. The Cas13a and crRNA co-expression vector was constructed by designing a DR-spacer-DR sequence, synthesizing it artificially, and ligating it into the pBBR-Lwa vector to construct the pCas13-crRNA series vectors. Finally, these vectors were transformed into the DE3 expression strain for further processing. Primer sequence information is shown in Table 3.

[0058] Table 3: Primer Sequence Information Table

[0059]

[0060] Finally, Cas9 series engineered bacteria and Cas13 series engineered bacteria were constructed. Figure 1 Specifically, this includes:

[0061] 1) pBBR1-Cas9 / E.coli DE3 expressing only Cas9 protein

[0062] 2) pBBR1-sgRNA1 / E.coli DE3 and pBBR1-sgRNA2 / E.coli DE3, which express only the guide sequence sgRNA.

[0063] 3) pBBR1-Cas9-sgRNA1 / E. coli DE3 and pBBR1-Cas9-sgRNA2 / E. coli DE3 strains co-expressing Cas9 protein and sgRNA

[0064] 4) pBBR1-Cas13 / E. coli DE3, which expresses only the Cas13 protein.

[0065] 5) pBBR1-crRNA1 / E.coli DE3 and pBBR1-crRNA2 / E.coli DE3, which express only the guide sequence crRNA.

[0066] 6) pBBR1-Cas13-crRNA1 / E.coli DE3 and pBBR1-Cas13-crRNA2 / E.coli DE3 strains co-expressing Cas13 protein and sgRNA.

[0067] Example 4: Testing the insecticidal effect of engineered strains on Isoniazid by feeding it to the parasite.

[0068] The constructed Cas9 and Cas13 engineered bacteria were used to feed *Isoceraria esculenta* to test their insecticidal effect. The DE3 engineered strain was cultured in LB liquid medium supplemented with kanamycin (50 mg / L). The feeding experiment included a control group expressing only Cas9 / Cas13 and only sgRNA / crRNA, and an inhibition group expressing both Cas9+sgRNA and Cas13+crRNA.

[0069] The control groups are as follows: engineered strains expressing only Cas9 protein (pBBR1-Cas9 / E.coli DE3), only the guide sequence sgRNA (pBBR1-sgRNA1 / E.coli DE3), and only the guide sequence sgRNA (pBBR1-sgRNA2 / E.coli DE3) serve as CRISPR-Cas9 series control groups; engineered strains expressing only Cas9 protein (pBBR1-Cas13 / E.coli DE3), only the guide sequence crRNA (pBBR1-crRNA1 / E.coli DE3), and only the guide sequence crRNA (pBBR1-crRNA2 / E.coli DE3) serve as CRISPR-Cas13 series control groups.

[0070] The experimental groups are the pBBR1-Cas9-sgRNA1 / E.coliDE3 and pBBR1-Cas9-sgRNA2 / E.coliDE3 strains co-expressing Cas9 protein and sgRNA constructed in the examples, which serve as the CRISPR-Cas9 series experimental groups; and the pBBR1-Cas13-crRNA1 / E.coliDE3 and pBBR1-Cas13-crRNA2 / E.coliDE3 strains co-expressing Cas13 protein and sgRNA serve as the CRISPR-Cas13 series experimental groups.

[0071] The growth conditions for the engineered bacteria and the bacterial-ciliary culture system were carried out according to the method in Example 1.

[0072] GraphPad Prism 9.4.1 (GraphPad Software, San Diego, California USA, www.graphpad.com) was used to plot the growth data. SPSS 26.0 (IBM released in 2019. IBM SPSS statistics for Windows, version 26.) was used to analyze the growth data.

[0073] The Tukey method was used to compare the growth data of the two groups, and a t-test was employed. A p-value less than 0.05 was considered significant, otherwise it was considered insignificant. Specific statistical data are shown in Table 4 below:

[0074] Table 4: Statistics on growth of control group and experimental group

[0075]

[0076] Note: Inhibition rate and significance data are compared between the experimental group and the Cas9 or Cas13 group. "-" indicates that it was not calculated.

[0077] Table 4 shows that, under the same target DHC7 gene sequence, expression of only Cas9 / Cas13 or only sgRNA / crRNA did not show an inhibitory effect on *Ischemicum heterotropoides*. When Cas protein and guide RNA were co-expressed, the Cas13 and Cas9 systems showed different inhibition rates against *Ischemicum heterotropoides*. The average inhibition rate of Cas13 against *Ischemicum heterotropoides* was 86.80%, significantly higher than that of Cas9 (52.17%), indicating that under the current conditions, the Cas13 system was more effective than Cas9. The inhibition rates of Cas13 and Cas9 systems targeting different sites of the same gene showed significant differences. The inhibition rates of the Cas13 system were 89.37% and 84.22%, respectively, both significantly higher than the control group; the inhibition rates of the Cas9 system were 56.49% and 47.85%, respectively, both significantly higher than the control group. This indicates that the target site affects the inhibitory efficiency of the Cas system.

Claims

1. The application of engineered strains in the preparation of products for the prevention and control of *Heterocystis suis*, characterized in that, The engineered strain carries a recombinant expression vector for expressing Cas9 protein and sgRNA or carries a recombinant expression vector for expressing Cas13 protein and crRNA. The sgRNA sequence is SEQ ID NO:2 or SEQ ID NO:3; the crRNA sequence is SEQ ID NO:4 or SEQ ID NO:

5.

2. A product for preventing and treating *Heterocystis suis*, characterized in that, The product contains engineered bacterial strains; The engineered strain carries a recombinant expression vector for expressing Cas9 protein and sgRNA or carries a recombinant expression vector for expressing Cas13 protein and crRNA. The sgRNA sequence is SEQ ID NO:2 or SEQ ID NO:3; the crRNA sequence is SEQ ID NO:4 or SEQ ID NO:

5.

3. The article of claim 2, characterized in that, The product in question is a live bacteria agent.