Cloning, Expression and Application of CmD53 Gene and Its Mutants

Abstract

The present invention discloses the cloning, expression and application of a CmD53 gene and its mutants. The cDNA sequence of the CmD53 gene in the present invention is shown as SEQ ID No: 1; the cDNA sequence of the CmD53 gene mutant (CmD53m) is shown as SEQ ID No: 2. After cloning the CmD53 gene and its mutants, plant expression vectors pORE-R4-Cm D53 and pORE-R4-CmD53m were recombinantly constructed, and the expression vectors were used to overexpress the CmD53 protein or the anti-degradation CmD53 isoform protein in chrysanthemum cells, thereby regulating the flowering period of chrysanthemum. The present invention clones the chrysanthemum CmD53 gene and constructs plant expression vectors of CmD53 and CmD53m, and introduces them into plants by the Agrobacterium-mediated method to explore their effects on the flowering period of chrysanthemum and new strategies, providing excellent gene reserves for the improvement engineering breeding of the chrysanthemum flowering period.

Description

Technical Field

[0001] The present invention relates to a target gene and method for regulating the flowering period of chrysanthemum, and in particular to an expression vector, construction method and application of a CmD53 gene and a mutant thereof. Background Art

[0002] Regulating the flowering period of chrysanthemum (Chrysanthemum morifolium) is key to ensuring year-round market supply. Chrysanthemum production primarily relies on light and temperature regulation for flowering period regulation, which has drawbacks such as high production costs and difficulty ensuring quality.

[0003] The CmD53 gene, derived from a strigolactone signaling pathway gene in the chrysanthemum 'Shenma' variety, is a specific inhibitor of strigolactone (SL) signaling. Its degradation is dependent on SL-induced degradation. Based on previous findings that treatment with the exogenous SL analog rac-GR24 (GR24) advances the flowering period of chrysanthemums, while treatment with the SL synthesis inhibitor (TIS108) delays flowering, the applicant sought to explore the impact of the SL-related CmD53 gene on chrysanthemum flowering and develop new strategies for flowering regulation, thereby providing a valuable genetic resource for chrysanthemum flowering improvement breeding projects. However, no studies have yet been reported on the CmD53 gene regulating flowering time in chrysanthemums. Summary of the Invention

[0004] Objectives of the Invention: The present invention aims to provide a CmD53 gene and its mutants, addressing the problem of obtaining novel targets for regulating the flowering period of chrysanthemums. Another objective of the present invention is to provide a method for cloning the CmD53 gene and its mutants, addressing the problem of obtaining CmD53 genes and their mutants. A third objective of the present invention is to provide a plant expression vector for the CmD53 gene and its mutants, addressing the problem of overexpressing the CmD53 gene and its mutants in chrysanthemum cells. A fourth objective of the present invention is to provide a method for delaying the flowering period of chrysanthemums, addressing the problem of targeting the CmD53 protein for regulating the flowering period of chrysanthemums.

[0005] Technical solution: The cDNA sequence of the CmD53 gene of the present invention is shown in SEQ ID No: 1. The cDNA sequence of the CmD53 gene mutant CmD53m of the present invention is shown in SEQ ID No: 2.

[0006] In a second aspect, the present invention provides a method for cloning the CmD53 gene, which specifically comprises using chrysanthemum cDNA as a template and using CmD53 gene cloning primers to perform a PCR reaction to obtain a CmD53 gene fragment; the CmD53 gene cloning primers are:

[0007] CmD53-F: ATGCCGACGCCGGTAAGCACAGC;

[0008] CmD53-R:TCAACCAACTATGATTCTTGAAGG.

[0009] In some embodiments, the cDNA of chrysanthemum 'Shenma' material was used as a template, and the open reading frame specific primers CmD53-F and CmD53-R were designed according to the CmD53 gene sequence information. PCR reaction was performed, and the product was mixed with pMD 19 -T vector to obtain pMD containing the CmD53 gene sequence 19 -T-CmD53 plasmid. pMD 19 -T-CmD53 plasmid was used to transform DH5α competent cells, and the chrysanthemum CmD53 gene with the sequence of SEQ ID No: 1 was cloned.

[0010] The present invention also provides a method for cloning a CmD53 gene mutant CmD53m, specifically using a recombinant vector containing a CmD53 gene sequence as a template and performing gene site-directed mutagenesis by overlap extension PCR to obtain a CmD53 gene mutant fragment.

[0011] Preferably, the overlap extension PCR method is:

[0012] (1) Using pMD containing CmD53 gene sequence 19 -T-CmD53 plasmid was used as template, and primer pair 1 and primer pair 2 were used for PCR reaction to obtain target fragment A and target fragment B respectively;

[0013] The primer pair one is:

[0014] CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC;

[0015] CmD53m-SOE-R:AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC;

[0016] The primer pair two is:

[0017] CmD53m-SOE-F: TCTGATCCATCATTTATCACGAATTATATTGCTGAGG;

[0018] CmD53-R4-R: ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG;

[0019] (2) Using target fragment A and target fragment B as common templates, a PCR reaction was performed using primer pair three to obtain a CmD53 gene mutant fragment containing the vector homologous sequence, namely, the CmD53m fragment;

[0020] The primer pair three is:

[0021] CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC;

[0022] CmD53-R4-R:ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG.

[0023] In a third aspect, the present invention provides a plant expression vector, pORE-R4-CmD53, containing the CmD53 gene, and a plant expression vector, pORE-R4-CmD53m, containing the CmD53 gene mutant, CmD53m. The cloned and amplified CmD53 gene fragment or mutant CmD53m fragment is homologously recombined with a pORE-R4 vector plasmid double-digested with BamH I and EcoR I to construct the plant expression vector, pORE-R4-CmD53 or pORE-R4-CmD53m.

[0024] In a fourth aspect, the present invention provides a method for delaying the flowering period of chrysanthemum, comprising increasing the content of CmD53 protein or CmD53 isoprotein CmD53m in chrysanthemum cells; the CmD53 isoprotein CmD53m is resistant to the degradation of chrysanthemum strigolactone and has the same biological function as the CmD53 protein.

[0025] Preferably, the method for increasing the content of CmD53 protein in chrysanthemum cells is: transfecting chrysanthemum cells with the plant expression vector containing the CmD53 gene, thereby overexpressing the CmD53 protein in the chrysanthemum cells.

[0026] Preferably, the method for increasing the content of CmD53 isoprotein CmD53m in chrysanthemum cells is: transfecting chrysanthemum cells with the above-mentioned plant expression vector containing the CmD53 gene mutant CmD53m, and overexpressing the CmD53 mutant CmD53m protein in the chrysanthemum cells, wherein the CmD53 mutant CmD53m protein lacks the RGKT amino acid sequence at positions 699 to 702 compared with the CmD53 protein.

[0027] In some embodiments, the transfection method is preferably Agrobacterium-mediated, specifically comprising transforming EHA105 competent Agrobacterium cells with the plant expression vectors pORE-R4-CmD53 and pORE-R4-CmD53m, respectively, and transforming the chrysanthemum 'Shenma' plant via Agrobacterium-mediated leaf disc infection. Positively transformed plants were screened for kanamycin resistance to obtain positively transformed plants. To identify positively transformed plants, the applicants also performed PCR, qRT-PCR, and Western blot verification for CmD53 and CmD53m. The results demonstrated that both CmD53 and CmD53m were successfully overexpressed in chrysanthemum cells.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the present invention introduces the SL signaling pathway inhibitor CmD53 and the SL degradation-resistant CmD53m gene fragment into chrysanthemum plants, and the flowering time of CmD53 and CmD53m overexpressing transgenic plants is significantly later than that of the wild-type control group plants, thereby obtaining transgenic chrysanthemums with significantly delayed flowering, overcoming the problem of delaying chrysanthemum flowering by supplementary lighting in production, reducing production costs, and improving the ornamental quality of chrysanthemums. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Agarose gel electrophoresis of chrysanthemum CmD53 gene cloning;

[0030] Figure 2 Schematic diagram of the plant expression vectors pORE-R4-CmD53 and pORE-R4-CmD53m; Figure A shows pORE-R4-CmD53, and Figure B shows pORE-R4-CmD53m;

[0031] Figure 3 Figures 2 and 3 show the PCR detection and verification results of positive transformed plants; Figure A shows the PCR amplification and identification of the pORE-R4-CmD53 overexpression line (CmD53-OE) at the DNA level; Figure B shows the PCR amplification and identification of the pORE-R4-CmD53m overexpression line (CmD53m-OE) at the DNA level;

[0032] Figure 4 This is the qRT-PCR test verification result of the positive transformed plants;

[0033] Figure 5 Statistical graphs of flowering phenotype and bud appearance time of wild type (WT), CmD53-OE and CmD53m-OE plants;

[0034] Figure 6 The figure shows the Western blot detection and verification results of positive transformed plants;

[0035] Figure 7Statistical graph of flowering phenotype and bud appearance time of wild type (WT), CmD53-OE and CmD53m-OE plants under GR24 and TIS108 treatments. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0037] Example 1: Cloning of the Chrysanthemum CmD53 Gene

[0038] 0.2 g of leaves of chrysanthemum 'Shenma' were used as the material, and total RNA from the leaves was extracted according to the instructions of RNA extraction kit (Huayueyang). 18 Primers and reverse transcriptase M-MLV (RNase H-) reagent (TaKaRa) were used to synthesize cDNA according to the manufacturer's instructions, and specific primers were designed to amplify CmD53 based on the sequence information of the CmD53 gene in the chrysanthemum library;

[0039] Upstream primer CmD53-F: ATGCCGACGCCGGTAAGCACAGC (SEQ ID No: 3);

[0040] Downstream primer CmD53-R: TCAACCAACTATGATTCTTGAAGG (SEQ ID No: 4).

[0041] PCR was performed using reverse-transcribed leaf cDNA as a template. The 50 μL reaction system consisted of 10.0 μL of 5× Phusion HF buffer, 2.5 μL each of CmD53-F (10 μM) and CmD53-R (10 μM) primers (10 μM), 4.0 μL of dNTPs (2.5 mM), 0.5 μL of Phusion DNA Polymerase, 1 μL of cDNA template, and 29.5 μL of ddH2O. The reaction procedure was as follows: initial denaturation at 98°C for 30 seconds, followed by 35 cycles of 98°C for 10 seconds, 58°C for 30 seconds, and 72°C for 60 seconds, and extension at 72°C for 10 minutes. The results of agarose gel electrophoresis of the PCR products are shown in the figure. Figure 1 As shown, the fragment size was 2,961 bp. The PCR product was recovered according to the instructions of the gel recovery kit (AXYGEN, USA) and ligated to pMD using the rapid ligase Solution I (TaKaRa). 19 -T vector (TaKaRa), ligation system: Solution I 5μL, pMD 19 -T 1 μL, PCR product 4 μL, ligated and transformed into DH5α competent cells at 16°C overnight, and the sequence was determined to be SEQ ID No: 1.

[0042] Example 2: Construction of plant expression vectors pORE-R4-CmD53 and pORE-R4-CmD53m

[0043] (a) Construction of the plant expression vector pORE-R4-CmD53

[0044] The schematic diagram of the plant expression vector pORE-R4-CmD53 is shown in Figure 2 As shown in A, according to the CmD53 gene sequence, BamH I and EcoR I restriction sites were introduced upstream and downstream, respectively, and primers CmD53-R4-F and CmD53-R4-R were designed:

[0045] CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC (SEQ ID No: 5);

[0046] CmD53-R4-R: ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG (SEQ ID No: 6).

[0047] pMD containing the CmD53 gene sequence 19 -T-CmD53 plasmid was used as template for PCR reaction. The reaction system in 50 μL was as follows: 10.0 μL 5× Phusion HF buffer, 2.5 μL each of primers CmD53-R4-F (10 μM) and CmD53-R4-R (10 μM), 4.0 μL dNTP (2.5 mM), 0.5 μL Phusion DNA Polymerase, and pMD 19 -T-CmD53 plasmid template (1 μL) and ddH2O (29.5 μL) were used. The reaction procedure was as follows: initial denaturation at 98°C for 30 seconds, followed by 35 cycles of 98°C for 10 seconds, 58°C for 30 seconds, and 72°C for 60 seconds, followed by extension at 72°C for 10 minutes. The PCR product was recovered using a gel recovery kit and then double-digested with the pORE-R4 vector using BamHI and EcoRI. The digestion system (50 μL) consisted of 2.0 μg of plasmid / PCR DNA, 2.5 μL each of BamHI and EcoRI, 5.0 μL of 10× QuickCut Green Buffer, and up to 50.0 μL of ddH2O. The reaction was carried out at 37°C for 3 hours. The digestion product was recovered and ligated to the vector using seamless cloning homologous recombination enzymes to generate the plant expression vector pORE-R4-CmD53.

[0048] (b) Construction of plant expression vector pORE-R4-CmD53m

[0049] The schematic diagram of the plant expression vector pORE-R4-CmD53m is as follows Figure 2 As shown in Figure B, the CmD53m protein lacks four amino acid residues (RGKT) at positions 699–702. These residues are mutated or deleted in the rice d53 mutant and the Arabidopsis SMXL6D, which confer resistance to SL-induced degradation (Jiang et al., 2013; Zhou et al., 2013; Wang et al., 2015). 19 -T-CmD53 plasmid was used as a template, and site-directed mutagenesis of the gene was performed by genesplicing by overlap extension PCR (SOE PCR). Two pairs of primers, CmD53-R4-F and CmD53m-SOE-R, and CmD53m-SOE-F and CmD53-R4-R, were designed and used for PCR reaction to obtain two fragments, A and B.

[0050] CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC (SEQ IDNo: 5);

[0051] CmD53m-SOE-R: AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC (SEQ IDNo: 7)

[0052] CmD53m-SOE-F:TCTGATCCATCATTTATCACGAATTATATTGCTGAGG (SEQ IDNo: 8)

[0053] CmD53-R4-R: ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG (SEQ ID No: 6).

[0054] 50 μL PCR reaction system: 5× Phusion HF buffer 10.0 μL, CmD53-R4-F (10 μM) and CmD53m-SOE-R (10 μM) primers [or CmD53m-SOE-F (10 μM) and CmD53-R4-R (10 μM) 2.5 μL each], dNTP (2.5 mM) 4.0 μL, Phusion DNA Polymerase 0.5 μL, pMD 19-T-CmD53 plasmid template (1 μL) and ddH2O (29.5 μL) were added. The reaction procedure was as follows: initial denaturation at 98°C for 30 seconds, followed by 25 cycles of 98°C for 10 seconds, 58°C for 30 seconds, and 72°C for 45 seconds, followed by extension at 72°C for 10 minutes. PCR products, fragments A (2,131 bp) and B (889 bp), were recovered using a gel recovery kit. PCR amplification of fragments A and B using primers CmD53-R4-F and CmD53-R4-R, using fragments A and B as a common template, yielded fragment A+B, the CmD53m gene fragment (2,990 bp) containing the vector homology sequence. 50μL PCR reaction system: 5×Phusion HF buffer 10.0μL, CmD53-R4-F (10μM) and CmD53-R4-R (10μM) 2.5μL each, dNTP (2.5mM) 4.0μL, Phusion DNA Polymerase 0.5μL, fragment A template 1μL, fragment B template 1μL, ddH2O 28.5μL; reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ for 10 seconds, 58℃ for 30 seconds, 72℃ for 60 seconds, 30 cycles; 72℃ extension for 10 minutes. The PCR product was recovered using a gel recovery kit and double-digested with BamHI and EcoRI, respectively. A 50μL digestion system consisted of 2.0μg of Plasmid / PCR DNA, 2.5μL each of BamHI and EcoRI, 5.0μL of 10× QuickCut Green Buffer, and up to 50.0μL of ddH2O. The reaction was performed at 37°C for 3 hours. The digestion product was recovered and ligated to the vector using seamless cloning homologous recombination enzymes to generate the plant expression vector pORE-R4-CmD53m.

[0055] Example 3: Agrobacterium-mediated transformation of CmD53 and CmD53m genes into Chrysanthemum 'Shenma'

[0056] Extract pORE-R4-CmD53 and pORE-R4-CmD53m plasmids, transform EHA105 Agrobacterium competent cells, select positive clones, activate in YEB liquid medium containing 50 mg / L Kan and 50 mg / L Rif, and culture at 28°C with shaking overnight until OD 600The microbial cells were collected by centrifugation at 4000 rpm for 10 minutes at room temperature, and an equal volume of the precipitate was suspended in MS infection buffer for infection. Leaf discs of chrysanthemum 'Shenma' were used as the transformation recipients. They were cultured in the pre-culture medium for 3 days, immersed in the above infection solution for 8-10 minutes, and then the bacterial liquid on the surface of the leaf disc was blotted dry with filter paper before being inoculated onto the co-culture medium. The discs were incubated in the dark for 3 days and then transferred to selective medium for subculture for four generations. When differentiated resistant buds reached 2-3 cm in length, they were transferred to rooting medium to initially obtain resistant plants.

[0057] The plant culture medium was based on MS medium (1 L): 4.74 g MS powder + 30 g sucrose + 6.6-7.0 g agar, pH = 5.8;

[0058] Pre- / co-culture medium: MS + 6-BA 1.0 mg + NAA 0.5 mg, pH = 5.8;

[0059] Selection medium 1: MS + 6-BA 1.0 mg + NAA 0.1 mg + 350 mg Carb + 12 mg Kan, pH = 5.8;

[0060] Selection medium 2: MS + 6-BA 1.0 mg + NAA 0.1 mg + 350 mg Carb + 12 mg Kan, pH = 5.8;

[0061] Selection medium 3: MS + 6-BA 1.0 mg + NAA 0.1 mg + 350 mg Carb + 10 mg Kan, pH = 5.8;

[0062] Selection medium 4: MS + 6-BA 1.0 mg + NAA 0.1 mg + 350 mg Carb + 9 mg Kan, pH = 5.8;

[0063] Rooting medium: MS + 8 mg Kan, pH = 5.8;

[0064] Sterilize at 116℃ for 30min. Antibiotics should be added after the culture medium has cooled to below 60℃.

[0065] Example 4: Molecular Identification of CmD53 and CmD53m Transgenic Chrysanthemums

[0066] The resistant plants of chrysanthemum 'Shenma' transformed with CmD53 and CmD53m genes were detected by PCR at the DNA level, qRT-PCR at the transcription level, and Western blot at the protein level.

[0067] (a) PCR detection

[0068] Genomic DNA was extracted from leaves of positively transformed plants screened for kanamycin resistance and wild-type plants. PCR identification primers 35S-F and CmD53-R were designed and used as templates for PCR amplification. The amplification system was as follows: 1.0 μL DNA template, 2.5 μL 10× PCR Buffer, 2.0 μL dNTPs, 0.2 μL rTaq, 1 μL each primer, and 25.0 μL ddH2O. The amplification procedure was as follows: 94°C pre-denaturation for 5 minutes; 35 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 3 minutes; and extension at 72°C for 10 minutes. The amplified product was detected by agarose gel electrophoresis and sequenced, and a 3,259-bp fragment containing CmD53 was amplified. Figure 3 A), a 3,247 bp fragment containing CmD53m ( Figure 3 B); the primer sequences are as follows:

[0069] Upstream primer 35S-F: GACGCACAATCCCACTATCC (SEQ ID No: 9);

[0070] Downstream primer CmD53-R: TCAACCAACTATGATTCTTGAAGG (SEQ ID No: 4).

[0071] Figure 3 Middle M: ​​DL5000 DNA marker.

[0072] (b) qRT-PCR detection

[0073] Total RNA was extracted from leaves of positively transformed plants and wild-type plants, reverse transcribed into first-strand cDNA, and diluted ten-fold for qRT-PCR detection. The amplification system was Premix Ex TaqTMII 10.0μL, Forward primer (10μM) 1.0μL, Reverse primer (10μM) 1.0μL, cDNA template 5.0μL, RNase-free dH2O 3.0μL, amplification program: 95℃ 2min; 95℃ 15sec, 60℃ 15sec, 72℃ 20sec, 40 cycles; finally, a melting curve program was added. Each sample was repeated 3 times. The CT value of each sample was obtained based on data analysis. The expression of the wild-type plant was used as the benchmark value to calculate the relative expression of each transgenic plant and the wild-type gene ( Figure 4 );

[0074] The fragment amplified by the specific primers is 226 bp long, and the primer sequences are:

[0075] Upstream primer CmD53-qRT-F: ATTTGAGCCGTTTGACTTCG (SEQ ID No: 10);

[0076] Downstream primer CmD53-qRT-R: ACCACCCTGCTTCTCCCTAG (SEQ ID No: 11).

[0077] The gene fragment amplified by CmEF1α was used as the internal reference. The fragment length was 151 bp. The primer sequences were:

[0078] Upstream primer CmEF1α-F: TTTTGGTATCTGGTCCTGGAG (SEQ ID No: 12);

[0079] Downstream primer CmEF1α-R: CCATTCAAGCGACAGACTCA (SEQ ID No: 13).

[0080] Figure 4 In the figure, each group represents the relative expression levels of the CmD53 gene in the wild type (WT), CmD53-OE transgenic lines (OE-1, OE-2, OE-3), and CmD53m-OE transgenic lines (mOE-1, mOE-2, mOE-3).

[0081] (c) Western blot detection

[0082] Tissue culture seedlings of wild-type, CmD53 overexpressing transgenic plants, and CmD53m overexpressing transgenic plants grown on MS medium for 3 weeks were transferred to MS medium containing 50 μM MG132 for 2 h, and then transferred to MS medium containing 10 μM GR24. Samples were taken at 0, 10, and 30 min after treatment. 0.2 g of plant tissue was ground into powder in liquid nitrogen and 1 ml of Pierce TM IP lysis buffer (containing 1× protease inhibitor) was shaken and mixed, and then allowed to stand on ice for 20 minutes, and then centrifuged at 13,000×g for 10 minutes at 4°C. The supernatant was aspirated into a new tube and protein quantification was performed using a BCA protein concentration assay kit. 30 μg of protein sample was added with 5× SDS-PAGE loading buffer to 1×, mixed evenly, and boiled for 10 minutes. SDS-PAGE gel electrophoresis was performed (130V, 90 minutes). The protein was analyzed on a GenScript eBlot TMTransfer to PVDF membrane on L1 fast wet transfer instrument for 12 minutes. Block with blocking solution at room temperature for 15 minutes, wash the membrane three times with 1× PBS (containing 0.05% Tween-20), each time for 10 minutes; primary antibodies were CmD53 antibody (Abmart) and Actin antibody (Invitrogen) diluted 1:1000 in primary antibody diluent, incubated overnight at 4°C, and washed three times; secondary antibodies were rabbit anti-antibody and mouse anti-antibody diluted 1:10000 in secondary antibody diluent, incubated at 4°C for 4 hours, and developed with enhanced chemiluminescence reagent (Thermo Scientific, USA). Western blot results showed ( Figure 6 CmD53 protein levels were detected in wild-type (WT), CmD53-OE-1, and CmD53m-OE-1 plants at different time points under 10 μM GR24 treatment (using Actin protein levels as a loading control). In WT plants treated with GR24, CmD53 protein levels rapidly decreased within 30 minutes. Endogenous CmD53 protein and CmD53-GFP fusion protein in CmD53-OE-1 plants also underwent significant degradation within 30 minutes. In CmD53m-OE-1 plants, endogenous CmD53 protein also underwent degradation, but CmD53m-GFP protein remained stable in the presence of GR24, indicating that CmD53m is insensitive to GR24-mediated degradation.

[0083] Example 5: Statistical analysis of flowering time of CmD53 and CmD53m overexpressing transgenic plants

[0084] The CmD53 and CmD53m overexpressing transgenic chrysanthemums were cultured in a long-day culture room for one month and then transplanted. The chrysanthemum seedlings were topped. After 2-3 weeks, wild-type and transgenic chrysanthemum cuttings were collected for cuttings. The chrysanthemum cuttings were inserted into a matrix tray containing nutrient soil, vermiculite and perlite in a 1:1:1 (v / v / v) ratio. The culture medium was kept at a temperature of 23±1°C and a light intensity of 100 μmol / m -2 s -1 After two weeks of rooting in a long-day (16h light / 8h dark) culture room, the cuttings were transplanted into 7cm diameter pots for cultivation. Plants grown for 45 days under long-day conditions were transplanted into short-day conditions and their budding was observed. The budding time for each plant was recorded. By observing the phenotype of CmD53 or CmD53m transgenic chrysanthemums, it was found that compared with WT plants, both CmD53-OE and CmD53m-OE plants showed delayed flowering ( Figure 5 Figure A shows the flowering phenotypes of wild-type (WT), CmD53-OE, and CmD53m-OE plants. Images were taken at the bud and flowering stages; red arrows indicate flower buds; scale bar = 2 cm. Figure 5Figure B shows the statistics of flower bud appearance time of wild type (WT), CmD53-OE and CmD53m-OE plants (n=30).

[0085] The wild-type and transgenic plants were further treated with the exogenous synthetic analog of GR24 and the synthetic inhibitor TIS108 to observe the flowering phenotype. GR24 or TIS108 was prepared into a 100mM stock solution with dimethyl sulfoxide (DMSO). When used, the stock solution was diluted with clean water to a working concentration of 10μM. The solvent DMSO was used as a control group (Mock). The cuttings grown for 40 days under long-day conditions were sprayed with the whole plant. First, they were sprayed once every other day under long-day conditions. After spraying three times, they were switched to short-day conditions (8h light / 16h dark) and then sprayed once every other day for three times, for a total of six times. Spray until the water droplets naturally drip off. After spraying, moisturize the leaves and keep them moist. The plants were cultured under short-day conditions and the budding situation of each plant was observed and the budding time of each plant was recorded. After GR24 treatment, the flowering period of CmD53m-OE was advanced by a smaller number of days than that of CmD53-OE after GR24 treatment ( Figure 7 Figure A shows the flowering phenotypes of wild-type (WT), CmD53-OE, and CmD53m-OE plants under GR24 and TIS108 treatments. Mock: solvent control; GR: GR24; TIS: TIS108; Scale bar = 2 cm; Figure 7 Figure B shows the statistics of flower bud appearance time of wild-type (WT), CmD53-OE, and CmD53m-OE plants under GR24 and TIS108 treatment (n=12). Since CmD53m is no longer sensitive to GR24-mediated degradation, the effect of CmD53m overexpression in delaying flowering is more stable and efficient.

Claims

1. A CmD53 gene, characterized in that: Its cDNA sequence is shown in SEQ ID No:

1.

2. A method for cloning the CmD53 gene according to claim 1, characterized in that: The method comprises using chrysanthemum cDNA as a template and using CmD53 gene cloning primers to perform a PCR reaction to obtain a CmD53 gene fragment; the CmD53 gene cloning primers are: CmD53-F: ATGCCGACGCCGGTAAGCACAGC; CmD53-R:TCAACCAACTATGATTCTTGAAGG.

3. A plant expression vector containing the CmD53 gene according to claim 1.

4. A CmD53 gene mutant, characterized in that: Its cDNA sequence is shown in SEQ ID No:

2.

5. A method for cloning a CmD53 gene mutant according to claim 4, characterized in that: The method comprises taking a recombinant vector containing a CmD53 gene sequence as a template and performing gene site-directed mutagenesis by using overlap extension PCR to obtain a CmD53 gene mutant fragment.

6. The method for cloning a CmD53 gene mutant according to claim 5, characterized in that: The method of the overlap extension PCR is: (1) Using pMD containing CmD53 gene sequence 19 -T-CmD53 plasmid was used as template, and primer pair 1 and primer pair 2 were used for PCR reaction to obtain target fragment A and target fragment B respectively; The primer pair one is: CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC; CmD53m-SOE-R:AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC; The primer pair two is: CmD53m-SOE-F:TCTGATCCATCATTTATCACGAATTATATTGCTGAGG; CmD53-R4-R: ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG; Using target fragment A and target fragment B as common templates, a PCR reaction was performed using primer pair three to obtain a CmD53 gene mutant fragment containing a vector homologous sequence; The primer pair three is: CmD53-R4-F:tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC; CmD53-R4-R:ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG.

7. A plant expression vector containing the CmD53 gene mutant according to claim 4.

8. A method for delaying the flowering period of chrysanthemum, characterized in that: The method comprises increasing the expression level of CmD53 protein and / or CmD53 isoprotein in chrysanthemum cells; the CmD53 isoprotein is resistant to degradation of chrysanthemum strigolactone and has the same biological function as the CmD53 protein; the chrysanthemum is chrysanthemum 'Shenma'; the CmD53 isoprotein is a CmD53 gene mutant protein, the CmD53 mutant protein lacks the RGKT amino acid sequence at positions 699-702 compared to the CmD53 protein, and the CmD53 protein is a protein translated from the CmD53 gene shown in the sequence SEQ ID No:

1.

9. The method for delaying the flowering period of chrysanthemum according to claim 8, characterized in that: The method for increasing the expression level of CmD53 protein in chrysanthemum cells comprises: transfecting the expression vector according to claim 3 into chrysanthemum cells to overexpress CmD53 protein in the chrysanthemum cells.

10. The method for delaying the flowering period of chrysanthemum according to claim 8, characterized in that: The method for increasing the expression level of CmD53 isoprotein in chrysanthemum cells comprises: transfecting the expression vector according to claim 7 into chrysanthemum cells to overexpress CmD53 mutant protein in the chrysanthemum cells.

Images