A method for constructing an animal model of non-alcoholic fatty liver disease

Abstract

The present invention discloses a method for constructing a non-alcoholic fatty liver disease animal model, which belongs to the technical field of model construction. The present invention adopts the method of specifically knocking out the Eva1a gene in the animal liver to establish a non-alcoholic fatty liver disease animal model. The present invention uses Cre-loxp technology as an example to establish a non-alcoholic fatty liver disease animal model. The constructed non-alcoholic fatty liver disease animal model is accompanied by characteristics such as fatty liver and dyslipidemia, and has a high similarity to clinical pathology. It does not distinguish between females and males, and has a significant fatty liver phenotype. The non-alcoholic fatty liver disease animal model of the present invention does not require high-fat feed, has low cost and high efficiency, can be mass-produced by genetic means, and the fatty liver phenotype appears when the mouse is 10 weeks old. It can effectively shorten the establishment period of the non-alcoholic fatty liver disease animal model and greatly save the time cost of medical research on NAFLD.

Description

Technical Field

[0001] The present invention belongs to the technical field of model construction, and particularly relates to a method for constructing a non-alcoholic fatty liver disease animal model. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is a global disease characterized by disrupted hepatic lipid homeostasis leading to triglyceride accumulation, affecting approximately 25% of the world's population. In approximately 10% of cases, NAFLD progresses from the relatively benign hepatic steatosis to non-alcoholic steatohepatitis, and then to cirrhosis and hepatocellular carcinoma. With the global prevalence of obesity and its associated metabolic syndrome, the incidence of NAFLD has increased annually and has become a major cause of chronic liver disease and hepatocellular carcinoma worldwide. Therefore, establishing a stable, reliable, convenient, rapid, and directly accessible heritable animal model of NAFLD is of great significance for studying the pathogenesis and treatment of NAFLD.

[0003] Currently known methods for constructing animal models of non-alcoholic fatty liver disease include gene knockout such as ApoE - / - Mouse or NR4A1 - / - Even after gene knockout, mice still require a high-fat diet to induce non-alcoholic fatty liver disease (NAFLD) in an animal model. This model takes a long time to develop and is not heritable, failing to reflect the pathological process of NAFLD caused by factors other than diet. Furthermore, animal models constructed using different species have poor reliability, and the characteristics of fatty liver disease vary from animal to animal, limiting their reference value. Therefore, there is an urgent need to establish a reliable model with a short development cycle, comprehensive NAFLD pathological features, and stable inheritance, to provide a flexible and convenient tool for studying the pathogenesis and treatment of NAFLD. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for constructing an animal model of non-alcoholic fatty liver disease. The method establishes an animal model of non-alcoholic fatty liver disease by specifically knocking out the Eva1a gene in the animal liver. The method has simple operation, obvious effect, short modeling time and heritable traits.

[0005] The present invention provides a method for constructing an animal model of non-alcoholic fatty liver disease, comprising the following steps: specifically knocking out the Eva1a gene in the animal liver, obtaining the Eva1a - / - The animal is the non-alcoholic fatty liver disease animal model.

[0006] Preferably, the species of animals include mammals.

[0007] The present invention also provides a method for constructing a non-alcoholic fatty liver animal model using the Cre-loxP method, comprising the following steps: (1) constructing the obtained Eva1a flox / flox The animal and an animal carrying a Cre tool are hybridized as parents to obtain an F1 generation; the Cre carried in the tool animal is expressed using a promoter specifically expressed in the liver;

[0008] (2) Screening the F1 generation for the genotype Eva1a flox+ / - Cre + Animals with Eva1a flox / flox Animals are hybridized to obtain the F2 generation;

[0009] (3) Screening the F2 generation for the genotype Eva1a flox+ / + Cre + The non-alcoholic fatty liver disease animal model was obtained.

[0010] Preferably, the promoter for liver-specific expression in step (1) includes Alb.

[0011] Preferably, the screening in step (2) includes performing PCR amplification using a primer pair of the Cre gene, and the genotype of the amplified band is Cre + .

[0012] Preferably, the screening in step (3) comprises PCR identification using primer pairs of gt3, gt5 and Cre genes;

[0013] PCR using the primer pair gt3 resulted in a single band;

[0014] PCR was performed using the primer pair gt5, and only one band was identified as Eva1a flox+ / + Homozygous; if two bands appear, it is Eva1a flox+ / - heterozygote;

[0015] PCR was performed using the Cre primer pair, and the band was identified as Cre. + .

[0016] Preferably, the primer pair designed for gt3 includes gt3-F having a nucleotide sequence as shown in SEQ ID No. 1 and gt3-R having a nucleotide sequence as shown in SEQ ID No. 2;

[0017] The primer pair designed for gt5 includes gt5-F with a nucleotide sequence as shown in SEQ ID No. 3 and gt5-R with a nucleotide sequence as shown in SEQ ID No. 4;

[0018] The primer pair designed for Cre includes Cre-F with a nucleotide sequence as shown in SEQ ID No. 5 and Cre-R with a nucleotide sequence as shown in SEQ ID No. 6.

[0019] Preferably, when the animal is an animal with a long tail, the tail is cut to perform genotyping;

[0020] When the animal has a short tail, blood is collected from the ear to determine the genotype.

[0021] The present invention also provides a method for breeding a non-alcoholic fatty liver disease animal model, comprising the following steps: breeding a non-alcoholic fatty liver disease animal model constructed by the above method with Eva1a flox / flox Animal hybridization, screening genotype is Eva1a flox+ / + Cre + descendants.

[0022] The present invention also provides a non-alcoholic fatty liver disease animal model obtained by the above construction method or the use of the non-alcoholic fatty liver disease animal model constructed by the above method in screening or developing drugs for treating non-alcoholic fatty liver disease.

[0023] Beneficial effects: The present invention provides a method for constructing an animal model of non-alcoholic fatty liver disease, which is established by specifically knocking out the Eva1a gene in the animal liver. The present invention uses Cre-loxp technology as an example to establish an animal model of non-alcoholic fatty liver disease. After crossbreeding with loxp animals, animals expressing the Cre tool specifically in liver parenchymal cells are selected. As Cre is expressed in the liver, the Eva1a gene in the liver is specifically knocked out, and there is no obvious change in the eating and survival of the mice, which can reflect the pathological process of NAFLD caused by non-dietary factors. The non-alcoholic fatty liver disease animal model constructed by the present invention is accompanied by characteristics such as fatty liver and dyslipidemia, has a high similarity to clinical pathology, and does not distinguish between females and males, and has a significant fatty liver phenotype. The non-alcoholic fatty liver disease animal model described in the present invention does not require high-fat feed, is low-cost and highly efficient, can be genetically bred and produced in batches, and fatty liver phenotypes appear in mice at 10 weeks of age. This can effectively shorten the establishment cycle of the non-alcoholic fatty liver disease animal model, greatly saving the time cost of medical research on NAFLD, and providing a good animal model for studying the pathogenesis and treatment strategies of NAFLD. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 Diagram of the breeding strategy for Eva1a gene knockout in mouse liver;

[0026] Figure 2 This is a diagram showing the results of Cre gene identification in the tail of F1 generation mice in Example 1;

[0027] Figure 3 This is a diagram showing the results of identifying the gt3 gene in the tail of F2 mice in Example 1;

[0028] Figure 4 Figure 1 shows the results of the gt5 gene identification in the F2 generation mouse tail.

[0029] Figure 5 This is a diagram showing the results of Cre gene identification in the tail of F2 mice in Example 1;

[0030] Figure 6 This is the result diagram of the food intake of two groups of mice in Example 2;

[0031] Figure 7 This is a graph showing the results of serum alanine aminotransferase, aspartate aminotransferase, triglycerides, total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol in the two groups of mice in Example 2;

[0032] Figure 8 This is the result of liver weight / body weight comparison of two groups of mice in Example 2;

[0033] Figure 9 Eva1a in Example 3 - / - Agarose gel electrophoresis results of Eva1a gene in various tissues and organs of mice;

[0034] Figure 10 Eva1a in Example 3 - / - Western blot results of Eva1a protein expression in mouse liver tissue;

[0035] Figure 11 Eva1a in Example 3 - / - Immunohistochemical results of Eva1a protein expression in mouse liver tissue;

[0036] Figure 12 The figure shows the Oil Red O staining results of liver cells from two groups of mice in Example 4 (scale bar is 50 μm);

[0037] Figure 13 Graph showing the H&E staining results of liver cells from two groups of mice in Example 4 (scale bar: 50 μm). DETAILED DESCRIPTION

[0038] The present invention provides a method for constructing an animal model of non-alcoholic fatty liver disease, comprising the following steps: specifically knocking out the Eva1a gene in the animal liver, obtaining the Eva1a - / - The animal is the non-alcoholic fatty liver disease animal model.

[0039] The present invention targets the Eva1a gene in animal liver for specific gene knockout. The method for specific gene knockout is not particularly limited, as long as the Eva1a gene is deleted and expressed only in the liver, while Eva1a remains normally present in other organs. The animals described in the present invention preferably include mammals, and more preferably include mice, rats, rabbits, dogs, pigs, or monkeys.

[0040] The present invention uses the Cre-loxP method as an example to perform specific gene knockout to construct a non-alcoholic fatty liver animal model, which includes the following steps: (1) using the constructed Eva1a flox / flox The animal and an animal carrying a Cre tool are hybridized as parents to obtain an F1 generation; the Cre carried in the tool animal is expressed using a promoter specifically expressed in the liver;

[0041] (2) Screening the F1 generation for the genotype Eva1a flox+ / - Cre + Animals with Eva1a flox / flox Animals are hybridized to obtain the F2 generation;

[0042] (3) Screening the F2 generation for the genotype Eva1a flox+ / + Cre + The non-alcoholic fatty liver disease animal model was obtained.

[0043] The present invention is to construct the obtained Eva1a flox / flox The animal and the animal carrying the Cre tool are hybridized as parents to obtain the F1 generation; the Cre carried in the tool animal is driven by a liver-specific promoter. The present invention does not specifically limit the construction method of the parent, and the construction can be carried out using conventional methods in the art, such as the Eva1a used in the embodiment. flox / floxThe mice have been disclosed in the article by Xin Lin et al. (Liver-specific deletion of Eva1a / Tmem166 aggravates acute liver injury by impairing autophagy), and they have promised to release them to the public within 20 years from the date of application. In the Cre tool-carrying animals of the present invention, Cre is expressed by a liver-specific promoter, such as the promoter Alb selected in the embodiment, i.e., Alb-Cre tool mice are used as parents. Alb-Cre tool mice can be obtained through commercial channels, such as those purchased from Shanghai Southern Model Organisms Technology Development Co., Ltd. It is worth noting that the Eva1a flox / flox The mice and Alb-Cre tool mice were all of SPF grade C57BL / 6 genetic background.

[0044] The present invention preferably performs adaptive culture on the above-mentioned parents, and hybridizes the mice when they are 6 to 8 weeks old and weigh 18 to 22 g. Two genotypes can be generated in the F1 generation mice: Eva1a flox+ / - Cre + and Eva1a flox + / - Cre - .

[0045] After obtaining the F1 generation, the present invention screens the F1 generation for the genotype Eva1a flox+ / - Cre + Animals with Eva1a flox / flox Animal hybridization to obtain the F2 generation.

[0046] The present invention preferably uses the PCR amplification method to screen individuals with Cre genes in the F1 generation as parents for the next generation hybridization. The present invention preferably uses the primer pair of Cre gene for PCR amplification, and the genotype of the amplified band is Cre + . The primer pair designed for Cre in the present invention preferably includes Cre-F (5'-GCCTGCATTACCGGTCGATGC-3') with a nucleotide sequence as shown in SEQ ID No.5 and Cre-R (5'-CAGGGTGTTATAAGCAATCCC-3') with a nucleotide sequence as shown in SEQ ID No.6. When the animal is an animal with a long tail, it is preferred to cut the tail for genotype determination, and the PCR program for the determination is preferably 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C final extension for 7 minutes. When the animal is an animal with a short tail, the genotype is determined by collecting blood from the ear edge. The animal with a short tail is preferably a large animal such as a rabbit, pig, etc.

[0047] The present invention selects Eva1a from F1 generation animals flox+ / - Cre + Animals and Eva1a flox / flox The hybrid produced the F2 generation, and there were four genotypes in the F2 generation animals: Eva1a flox+ / + Cre + 、Eva1a flox+ / - Cre + 、Eva1a flox+ / + Cre - and Eva1a flox+ / - Cre - .

[0048] After obtaining the F2 generation animals, the present invention screens the F2 generation for the genotype Eva1a flox+ / + Cre + The non-alcoholic fatty liver disease animal model is obtained by the screening of the present invention preferably including PCR identification using primer pairs for gt3, gt5, and Cre genes; using the gt3 primer pair for PCR, a single band appears, indicating the presence of a right flox site, but not whether it is homozygous or heterozygous; the absence of a band indicates the loss of the right flox site or PCR reaction failure; using the gt5 primer pair for PCR, a single band is identified as Eva1a flox+ / + Homozygous; if two bands appear, it is Eva1a flox+ / - Heterozygotes; PCR was performed using the Cre primer pair, and the bands that appeared were identified as Cre + .

[0049] The primer pair designed for gt3 of the present invention includes gt3-F (5'-TCTGAGGCGGAAAGAACCAG-3') with a nucleotide sequence as shown in SEQ ID No. 1 and gt3-R (5'-CAGCCCAGGAAATAGGATGA-3') with a nucleotide sequence as shown in SEQ ID No. 2; the primer pair designed for gt5 includes gt5-F (5'-ATCTGTTAGGGACAAGGGTA-3') with a nucleotide sequence as shown in SEQ ID No. 3 and gt5-R (5'-CAAAGGAGAATGGCAAATGG-3') with a nucleotide sequence as shown in SEQ ID No. 4. The method and procedure for PCR verification of the present invention are preferably the same as those described above and are not repeated here.

[0050] Eva1a in the F2 generation animals of the present invention flox+ / + Cre +The genotype is a liver-specific knockout animal of the Eva1a gene, which is the non-alcoholic fatty liver animal model of the present invention. The present invention feeds the non-alcoholic fatty liver animal model normally, and identifies and detects fatty liver indicators when the mice are 10 to 15 weeks old. The method for detecting fatty liver of the present invention preferably includes: liver pathological sectioning, Oil Red O staining, liver index measurement, detection of TG, TC, LDL-C, HDL-C, AST and ALT in mouse serum, and the results show that the mouse has the characteristics of liver steatosis and dyslipidemia, and the established non-alcoholic fatty liver Eva1a - / - The model does not distinguish between females and males.

[0051] The present invention also provides a method for breeding a non-alcoholic fatty liver disease animal model, comprising the following steps: breeding a non-alcoholic fatty liver disease animal model constructed by the above method with Eva1a flox / flox Animal hybridization, screening genotype is Eva1a flox+ / + Cre + descendants.

[0052] The present invention selects Eva1a flox+ / + Cre + With Eva1a flox / flox Hybridization produces two genotypes: Eva1a flox + / + Cre + and Eva1a flox+ / + Cre - The same method as above can be used for genotyping to obtain a large number of Eva1a flox+ / + Cre + Genotyping model, identification of liver-specific knockout of Eva1a gene, and detection of fatty liver markers.

[0053] The present invention also provides a non-alcoholic fatty liver disease animal model obtained by the above construction method or the use of the non-alcoholic fatty liver disease animal model constructed by the above method in screening or developing drugs for treating non-alcoholic fatty liver disease.

[0054] To further illustrate the present invention, a method for constructing a non-alcoholic fatty liver disease animal model provided by the present invention is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0055] Example 1

[0056] Breeding and identification strategies for Eva1a liver-specific knockout mice

[0057] 1) Source of experimental animals: Eva1a with SPF grade C57BL / 6 genetic background flox / floxMice (Xin Lin et al.); Alb-Cre tool mice were purchased from Shanghai South Model Organisms Technology Development Co., Ltd.

[0058] 2) All experimental animals were housed in an SFP-grade animal room maintained at a temperature of 22°C, 50% humidity, and a 12-h light-dark cycle. Six mice per cage were fed a standard diet with free access to water. Regular feed was purchased from Jiangsu Collaborative Biological Company and complies with GB14924.1 "General Quality Standard for Compound Feeds for Laboratory Animals," GB14924.2 "Hygiene Standard for Compound Feeds for Laboratory Animals," GB14924.3 "Nutritional Composition of Compound Feeds for Laboratory Animals," and GB13078-2017 "Hygiene Standard for Feed."

[0059] 3) If Figure 1 As shown, Eva1a was selected when the mice reached 6 to 8 weeks of age. flox+ / + The female mice were co-bred with Alb-Cre male mice. The genotype of the F1 offspring was Eva1a flox+ / - Cre + Mice with Eva1a flox+ / + The mice were further hybridized and the F2 generation genotype was Eva1a flox+ / + Cre + The mice were selected as the target model mice, and the F2 generation genotype was Eva1a flox+ / + Cre - As the control group. And Eva1a in F2 generation flox+ / + Cre + Mice can be combined with Eva1a flox+ / + Continue hybridization to obtain more genotypes for Eva1a flox+ / + Cre + of mice.

[0060] 4) Number the ears of mice 7 to 14 days after birth, and cut their tails around 6 weeks to determine their genotypes.

[0061] 5) Purchase a mouse genotyping rapid identification kit from Novozymes (Nanjing). Soak the mouse tail in lysis buffer containing proteinase K. Incubate at 55°C for 20 minutes, then heat at 95°C or boil for 5 minutes to inactivate the proteinase K. Vortex the lysate thoroughly, centrifuge at 12,000 rpm for 5 minutes, and remove the supernatant. Extract genomic DNA and use 1 μl of the supernatant directly for PCR.

[0062] 6) Design primers Cre-R and Cre-R on the Cre gene. When the mouse tail gene contains Cre, the length of the PCR fragment is 481 bp.

[0063] 7) A fragment containing loxP sites downstream of the Eva1a gene was named gt3, and upstream and downstream primers gt3-F and gt3-R were designed. The length of the fragment after PCR was 502 bp.

[0064] 8) A fragment containing a loxP site upstream of the Eva1a gene was named gt5. Upstream and downstream primers gt5-F and gt3-R were designed. When the mouse tail gene does not contain a loxP site, the length of the fragment after PCR is 332 bp. When it contains a loxP site, the length of the fragment after PCR is 450 bp.

[0065] 9) PCR reaction system (25 μL): 2xTaq Plus MasterMix 12.5 μL, genomic DNA 1 μL, primer F (10 μM) 1 μL, primer R (10 μM) 1 μL, and ddH2O to make up.

[0066] 10) PCR reaction conditions were as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and final extension at 72°C for 7 min.

[0067] 11) Genotype identification: Place 5 μL of the above PCR product in 1×TAE electrophoresis buffer, run it on a 1.5% agarose gel, and take a picture.

[0068] The results are as follows Figures 2 to 5 As shown, the Cre gene was detected in F1 mice. + The mice were numbered 2, 3, 4, 5, 6, 9 ( Figure 2 ). In the F2 generation, gt3 was detected, and a 502bp band was detected in mice No. 112, No. 113, No. 114 and No. 115 ( Figure 3 In the F2 generation, two bands of 450 bp and 332 bp were amplified from mice No. 111 and No. 115, which were Eva1a flox+ / - Heterozygous: mice No. 112, 113, and 114 could only amplify a 450 bp band, which is Eva1a flox+ / + Homozygous ( Figure 4 ). In the F2 generation, Cre was detected, and among mice No. 112, No. 113, and No. 114, only No. 113 could amplify the Cre gene fragment ( Figure 5 ).

[0069] Based on the above results, the genotype of mouse No. 113 is Eva1a flox+ / + Cre + , is the target model mouse, the genotype of mice No. 112 and No. 114 is Eva1a flox+ / + Cre -Mice of the same genotype born in the same litter were used as control mice.

[0070] Example 2

[0071] Measurement of food intake, liver index, and serological indicators in normal mice and Eva1a liver gene knockout mice

[0072] 1) Food intake measurement: Eva1a flox+ / + Cre + Genotype mice (target model mice) and littermates of Eva1a flox+ / + Cre - The mice of the same genotype (control mice) were reared in the same adaptive manner, with 4 mice per cage, until they were 10 to 15 weeks old. The food intake of each group of mice was recorded in detail every two days. The feed was weighed using an electronic balance and fed to normal mice and mice with the genotype Eva1a in equal amounts. flox+ / + Cre + For the experimental mice, the remaining feed was weighed every two days, and the difference in weight before and after was the food intake of each group of mice in these three days.

[0073] 2) Serological Indication Testing: Two groups of mice (10-15 weeks old) housed at the same time were fasted the night before and anesthetized with 10% chloral hydrate intraperitoneally. Blood was collected from the orbits, and serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were measured using an automated biochemical analyzer. The specific steps are as follows:

[0074] ① Anesthesia: The mice in both groups were anesthetized by intraperitoneal injection of 10% chloral hydrate.

[0075] ② Pick up the mouse and place it on the blood collection table. Use the thumb and index finger of your left hand to grasp the skin between the two ears of the mouse to fix the mouse, and gently press both sides of the neck. Venous return will be blocked, so that the eyeballs will fully protrude. At this time, it can be determined that the retroorbital venous plexus is congested.

[0076] ③ Hold the blood collection tube with your right hand, make the tip of the tube form a 45° angle with the mouse's face, insert it along the inner edge of the eye into the back of the eyeball, and pierce toward the fundus. When you feel resistance, rotate the tube gently to cut the venous plexus, and the blood will flow into the tube.

[0077] ④ Slowly adjust the angle of the blood collection tube so that it is horizontal or tilted slightly downward. The assistant collects blood using a 0.5ml EP tube below the end of the tube and marks the ear tag on the 0.5ml EP tube. After blood collection is complete, remove the blood collection tube, relax your left hand, and gently apply pressure to the eye socket with a sterile gauze pad to stop bleeding.

[0078] ⑤Separate serum: Allow the EP tube containing the collected blood to stand at room temperature for 1–2 hours to allow the blood to coagulate naturally. Centrifuge at 4°C, 4000 rpm / min for 30 minutes. Use a micropipette to draw up the serum, place it in a sterile EP tube, and store it in a -80°C freezer.

[0079] ⑥ After collecting all the samples, they will be tested on the computer together for indicators such as TC, TG, LDL-C, HDL-C, AST and ALT.

[0080] 3) Liver index determination: calculate liver weight / body weight

[0081] ① Weigh each mouse in the two groups housed at the same time. After orbital blood sampling, sacrifice the mice by cervical dislocation. Secure the mice in a supine position, and wet the chest and abdominal fur with distilled water.

[0082] ② Use tweezers to clamp the skin in the middle of the mouse's abdomen, cut the skin along the middle of the abdomen towards the head to the bottom of the xiphoid process, and then cut the skin towards the tail end, exposing the subcutaneous fascia, muscles, etc. layer by layer, opening the abdominal cavity, and fully exposing all organs.

[0083] ③ Find and remove the mouse liver, place it on sterile gauze, wipe away any blood remaining on the surface of the liver, place the liver in a sterile culture dish, weigh it, and calculate the ratio of liver weight to body weight for each mouse.

[0084] The results are as follows Figures 6 to 8 As shown: There was no significant difference in food intake between the two groups of mice ( Figure 6 ); Compared with normal mice, the ALT, AST, and TG of the target model mice were significantly increased (P<0.05), while there were no significant differences in TC, HDL-C, and LDL-C. This indicates that the target model mice had significantly increased alanine aminotransferase, aspartate aminotransferase, and triglycerides in their blood at 10 to 15 weeks of age, indicating hyperlipidemia and decreased liver function ( Figure 7 ); and there was no significant difference in liver index between the two groups of mice ( Figure 8 ).

[0085] Example 3

[0086] Identification of the liver-specific knockout effect of the Eva1a gene

[0087] 1) Knockout organ specificity detection: Take the target model mouse (genotype Eva1a flox+ / + Cre + DNA was extracted from liver, spleen, heart, lung, and brain tissues of the 1.5% genotype (1000 cells / 1000 cells / 1000 cells) using a genomic DNA extraction kit purchased from Nanjing Novozymes. PCR was performed using primers targeting Eva1a and the internal reference gene ACTB, following the PCR reaction system and procedure described in Example 1. PCR products were identified by agarose gel electrophoresis at a 1.5% agarose gel concentration. The primer sequences used in the PCR were:

[0088] Eva1a-F(SEQ ID No.7):CCTTGGCCGCCTTGGTGATGAG

[0089] Eva1a-R(SEQ ID No.8):TACCATCCTCGCTGTCGCTGCT

[0090] ACTB-F(SEQ ID No.9):CCCGGCTGTATTCCCCTCCAT

[0091] ACTB-R(SEQ ID No.10):CCTCTCTTGCTCTGGGCCTCGT

[0092] 2) Biochemical detection of protein expression of knockout gene: Take target model mice (genotype Eva1a flox+ / + Cre + ) were used to extract proteins from liver tissues, and Eva1a protein was detected by western blot.

[0093] ① Use surgical scissors to cut off liver tissue about the size of soybeans and place it into a homogenizer. Grind on ice. Add 100 μL of lysis buffer (containing 1% volume PMSF) per mg of tissue and lyse for 30 minutes. Centrifuge and collect the supernatant into a 1.5 mL EP tube.

[0094] ② Take out part of the protein sample and measure the concentration using the BCA kit. The remaining protein samples were divided into aliquots, added with 5× Loading Buffer and boiled for 10 minutes for denaturation before loading.

[0095] ③ Prepare 1.5% concentration of SDS-PAGE gel, load 40 μg of sample into each well, maintain constant voltage at 80V for about 20 minutes, then change to 120V, and stop electrophoresis when bromophenol blue moves to the bottom of the gel plate.

[0096] ④ The PVDF membrane was pre-activated by soaking in methanol for 5 min. The gel and PVDF membrane were placed on the black plywood in sequence, and both sides were covered with filter paper and sponge pads respectively. The assembled electroporation clamp was placed in the electroporation tank and electroporated at a constant current of 300 mA for 2 h.

[0097] ⑤ Block with 5% BSA at room temperature for 2 hours, incubate with Eva1a primary antibody and internal reference β-actin primary antibody in a 4°C refrigerator overnight, return to temperature, wash three times with TBST, add diluted corresponding secondary antibody and incubate on a shaker at room temperature for 1 hour, and repeat the membrane washing step.

[0098] ⑥ Prepare ECL chemiluminescence working solution, cover the entire membrane, and transfer to a darkroom for development.

[0099] 3) Immunohistochemical detection of protein expression of knockout gene: Take target model mice (genotype Eva1a flox+ / + Cre + Freshly excised liver tissue was fixed with 4% paraformaldehyde and embedded in paraffin to prepare tissue wax blocks. 5 μm thick sections were routinely dewaxed, hydrated, and subjected to sodium citrate antigen retrieval after elimination of endogenous peroxidase with hydrogen peroxide. After blocking with goat serum, Eva1a primary antibody or IgG control antibody was added dropwise at 4°C overnight. The next day, the sections were removed, washed, and secondary antibody was added dropwise. After thorough rinsing with PBS, DAB color development was performed, counterstained with hematoxylin, dried, mounted, and observed and photographed.

[0100] The results are as follows Figures 9 to 11 As shown, the reference gene ACTB and the target knockout gene Eva1a can be detected in the heart, spleen, brain, and lung of the target model mouse, while only the reference gene ACTB can be detected in the liver, and the target gene Eva1a cannot be detected, indicating that the Eva1a gene in the liver has been specifically knocked out ( Figure 9 ); Compared with normal mice, the expression of Eva1a protein in the liver protein of the target model mice was significantly decreased, indicating that the Eva1a gene level in the target model mice was significantly reduced ( Figure 10 ); Compared with normal mice, the expression of Eva1a protein in the liver protein of the target model mice was significantly decreased, and the IgG negative control showed that the experimental method had no interference ( Figure 11 ). This indicates that the expression of the Eva1a gene in the target model mice decreased sharply.

[0101] In summary, the genotype is Eva1a flox+ / + Cre + The target model mice had Eva1a specifically knocked out in their livers, and the knockout effect was very good.

[0102] Example 4

[0103] Liver tissue pathology staining related experiments

[0104] 1) Oil Red O staining of liver tissue: The control mice (Eva1a + / + ) and model mice (Eva1a - / - Freshly isolated livers were fixed with 4% paraformaldehyde, embedded in OCT, and sectioned using a Leica CM1520 cryostat. Staining was performed as follows: rinse with distilled water → 60% isopropanol for 2 minutes → rinse with ice water → stain with Oil Red O working solution in the dark for 10 minutes → 60% isopropanol for several seconds (to remove background color) → rinse with ice water → hematoxylin for 5 minutes → rinse with ice water. After staining, the sections were dried, mounted with glycerol-gelatin, and photographed.

[0105] The results are as follows Figure 12As shown, the liver structure of the control mice was clear, without lipid droplet deposition, and Eva1a - / - The oil red staining in the liver cells of the model mice was very obvious, indicating a large amount of lipid droplets deposited.

[0106] 2) Hematoxylin-eosin (HE) staining of liver tissue: Freshly dissected liver tissue from both groups of mice was fixed with 4% paraformaldehyde and embedded in paraffin. Tissue blocks were prepared and 5 μm thick sections were sliced. The sections were baked at 60°C for 2 hours, then dewaxed in xylene for 1 hour, and then in xylene for 30 minutes. The sections were then treated with 100% ethanol, 95% ethanol, 95% ethanol, 80% ethanol, and 70% ethanol for 5 minutes, followed by distilled water for 10 minutes. Hematoxylin staining was performed for 5-8 minutes, followed by a 2-minute rinse in tap water, 1% hydrochloric acid ethanol for 2 seconds, a 10-minute rinse in tap water, anti-blueing for 10 minutes, eosin staining for 2-3 minutes, a 2-minute rinse in tap water, 70% ethanol for 20 seconds, 80% ethanol for 30 seconds, 90% ethanol for 1 minute, 95% ethanol for 1 minute, 100% ethanol I for 1 minute, 100% ethanol II for 1 minute, xylene I for 3 minutes, and xylene II for 3 minutes. After staining, the sections were mounted with neutral gum and, after solidification, observed and photographed.

[0107] The results are as follows Figure 13 As shown, compared with control mice, Eva1a - / - Dense vacuoles appeared in the liver cells of mice, which were the structures of lipid droplets. There was no significant difference in the clarity of the liver tissue structure between the two groups of mice, indicating that there was no obvious inflammatory infiltration.

[0108] In summary, liver-specific Eva1a knockout mice were successfully constructed. Compared with control mice, liver Eva1a - / - The knockout mice showed significant hepatic steatosis and elevated blood lipids, but no significant increase in liver weight or change in food intake. The liver tissue structure and morphology remained intact, with no inflammatory infiltration, making this a typical model of isolated non-alcoholic fatty liver disease. However, since the mice were only 10 to 15 weeks old, NAFLD may worsen with age. This model, which is not induced by a high-fat diet, is a heritable, non-diet-induced model of non-alcoholic fatty liver disease and can provide a rapid and convenient model for studying the pathogenesis of NAFLD and developing therapeutic drugs.

[0109] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for constructing a non-alcoholic fatty liver disease animal model using the Cre-loxP method, characterized in that: The following steps are involved: (1) The constructed Eva1a flox / flox The animal and an animal carrying a Cre tool are hybridized as parents to obtain an F1 generation; the Cre carried in the tool animal is expressed using an Alb promoter that is specifically expressed in the liver; (2) Screening the F1 generation for the genotype Eva1a flox+ / - Cre + Animals with Eva1a flox / flox Animals are hybridized to obtain the F2 generation; (3) Screening the F2 generation for the genotype Eva1a flox+ / + Cre + The non-alcoholic fatty liver disease animal model is obtained by screening animals, wherein the screening comprises identifying the non-alcoholic fatty liver disease animal model by PCR using primers of gt3, gt5 and Cre genes; PCR using the primer pair gt3 resulted in a single band; PCR was performed using the primer pair gt5, and only one band was identified as Eva1a flox+ / + Homozygous; if two bands appear, it is Eva1a flox+ / - heterozygote; PCR was performed using the Cre primer pair, and the band was identified as Cre. + ; The primer pair designed for gt3 includes gt3-F with a nucleotide sequence as shown in SEQ ID No. 1 and gt3-R with a nucleotide sequence as shown in SEQ ID No. 2; The primer pair designed for gt5 includes gt5-F with a nucleotide sequence as shown in SEQ ID No. 3 and gt5-R with a nucleotide sequence as shown in SEQ ID No. 4; The primer pair designed for Cre includes Cre-F with a nucleotide sequence as shown in SEQ ID No. 5 and Cre-R with a nucleotide sequence as shown in SEQ ID No.

6.

2. The method according to claim 1, characterized in that The screening in step (2) includes PCR amplification using primers of the Cre gene, and the genotype of the amplified band is Cre + .

3. The method according to claim 1, characterized in that When the animal is a long-tailed animal, the tail is cut to perform genotyping; When the animal has a short tail, blood is collected from the ear to determine the genotype.

4. A method for breeding an animal model of non-alcoholic fatty liver disease, characterized in that: The method comprises the following steps: combining the non-alcoholic fatty liver animal model constructed by the method according to any one of claims 1 to 3 with Eva1a flox / flox Animal hybridization, screening genotype is Eva1a flox+ / + Cre + descendants.

5. Use of the non-alcoholic fatty liver disease animal model constructed by the method according to any one of claims 1 to 3 in screening or developing drugs for treating non-alcoholic fatty liver disease.

Images