A polynucleotide for treating cri du chat syndrome

Abstract

The present invention relates to polynucleotides and nucleic acid constructs of CTNND2 truncations. The present invention further relates to AAV viral particles comprising the nucleic acid constructs of the present invention, and compositions comprising the polynucleotides, nucleic acid constructs or viral particles of the present invention. The present invention also relates to methods and uses of the polynucleotides, nucleic acid constructs, viral particles and / or compositions of the present invention.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to gene therapy vectors. Background Art

[0002] Cri Du Chat syndrome is a hereditary neurodevelopmental disorder with chromosomal structural abnormalities caused by partial or complete deletion of the short arm of chromosome 5 (5p microdeletion, 5p deletion), also known as 5p deletion syndrome or pediatric Cri Du Chat syndrome. The size of the deletion of the short arm of chromosome 5 in different individuals with Cri Du Chat syndrome (abbreviated as 5p patients) varies, with the deletion size ranging from 0.5 Mb to 45 Mb (the deletion position ranges from the 5p15 region to the entire short arm). This syndrome is considered the most common rare genetic disease in children with autosomal contiguous gene deletion disorders, lacking treatment means for the cause of the disease, having a poor prognosis, and lacking an accurate correspondence between the gene deletion in the 5p region and the clinical phenotype. It is known that the 5p region contains 563 genes (http: / / genome.ucsc.edu).

[0003] Gene therapy refers to introducing exogenous normal genes into target cells to correct or compensate for diseases caused by defective and abnormal genes for the purpose of treatment. Currently, gene therapy has been applied to the treatment of multiple fields such as rare genetic diseases, malignant tumors, and cardiovascular diseases, and gene therapy has the potential for the treatment of hereditary rare diseases. For example, the gene therapy for hereditary β-thalassemia has officially entered the clinical stage from scientific research. Based on the 5p rat model, we used the latest viral delivery system of the Gradinaru team to specifically design and produce an AAV virus carrying the truncated rat Ctnnd2 gene (the full-length rat Ctnnd2 gene is 4.65 kb, exceeding the carrying capacity of the AAV virus, and the specific principle is shown in Figure 6 ) and simultaneously planned to produce AAV viruses carrying the full-length March6 and Cct5 genes, and planned to use single-gene and multi-gene combination therapy (multi-gene "cocktail" therapy) to supplement the missing key genes to restore or partially restore the brain dysfunction caused by 5p gene deletion, and explore the optimal treatment window and new gene therapy paths.

[0004] In the 1960s, scientists first proposed the concept of curing genetic diseases using gene therapy. This brand-new conceptual strategy aims to obtain long-term therapeutic effects by introducing exogenous genetic material into patients. Gene therapy refers to introducing exogenous normal genes into target cells to correct or compensate for diseases caused by defective and abnormal genes for the purpose of treatment. In the past few decades, the field of gene therapy has made significant progress in treating previously incurable genetic diseases.

[0005] Gene therapy for genetic diseases aims to achieve persistent expression of genes by delivering therapeutic genes to cells, and to ensure that the expression of the therapeutic gene is sufficient to improve or cure the disease with the lowest safety risk. In the 1960s, the American molecular biologist Lederberg J first proposed the preliminary concept of gene therapy, laying the foundation for the development of gene therapy. Adeno-associated virus (AAV) is a type of single-stranded linear DNA defective virus. Due to its high transduction efficiency, non-integrative nature, and ability to specifically infect various tissues and organs, it has been used as a safe and effective viral vector for clinical trials of gene therapy.

[0006] Currently, there is no treatment for cri du chat syndrome, and only treatments for its corresponding symptoms are available, such as surgery or rehabilitation training. Summary of the Invention

[0007] The present invention provides a polynucleotide sequence encoding a truncated form of CTNND2, wherein the protein sequence of the truncated form of CTNND2 is as shown in SEQ ID NO: 2.

[0008] In some embodiments, the polynucleotide sequence is as shown in SEQ ID NO: 1, or a polynucleotide sequence having at least 90% identity with SEQ ID NO: 1.

[0009] On the one hand, the present invention provides a nucleic acid construct, wherein the construct contains the polynucleotide sequence described above.

[0010] In some embodiments, the nucleic acid construct includes transcriptional regulatory elements, and the transcriptional regulatory elements include a promoter and / or an enhancer.

[0011] On the one hand, the present invention provides a vector, wherein the vector contains the polynucleotide sequence or the construct described in the present invention.

[0012] In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0013] In some embodiments, the AAV vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and their hybrids.

[0014] On the one hand, the present invention provides a virus particle comprising the construct described in the present invention.

[0015] On the one hand, the present invention provides a composition comprising the polynucleotide sequence of the present invention, the nucleic acid construct, the vector, or the virus particle described above, and a pharmaceutically acceptable excipient.

[0016] In yet another aspect, the present invention discloses the use of the polynucleotide sequence, the nucleic acid construct, the vector, the virus particle, or the composition described in the present invention in the preparation of a medicament for treating Cri du Chat syndrome in a desired subject.

[0017] In some embodiments, the subject is human. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The present invention can be more fully understood with reference to the following drawings.

[0019] Figure 1 Shows the plasmid map of H9525 pAAV-CMV-EGFP-3xFLAG-tWPA empty plasmid.

[0020] Figure 2 Shows the plasmid map after inserting rCTNND2.

[0021] Figure 3 Shows the protein Marker.

[0022] Figure 4 Shows the results of Western Blot detection.

[0023] Figure 5 Shows the experimental process of gene therapy in 5p model rats.

[0024] Figure 6 Shows the effect of administering gene-targeted nucleic acid drugs in the early stage of development on improving the cognitive function of 5p model rats.

[0025] Figure 7 Shows the effect of administering gene-targeted nucleic acid drugs in the early stage of development on the anxiety-like behavior of 5p model rats.

[0026] Figure 8 Shows the effect of administering gene-targeted nucleic acid drugs in the late stage of development on the cognitive and social behaviors of 5p model rats.

[0027] Figure 9 Shows the knockout range of chromosome 2 in 5p model rats.

[0028] Figure 10 Shows the schematic diagram of the production of 5p model rats.

[0029] Figure 11 Shows the pre-cut pCS vector map.

[0030] Figure 12 Shows the detection results of sgRNA activity.

[0031] Figure 13 Shows the RNA electrophoresis map in the RNA preparation of sgRNA.

[0032] Figure 14 Shows the primer design principle for primer design in the genotyping of F0 generation rats.

[0033] Figure 15 Shows the genotyping of the tails of F0 generation rats, and the identification results with primers EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-Mut-R.

[0034] Figure 16 Shows the primer design principle for primer design in the genotyping of F1 generation rats.

[0035] Figure 17 Shows the genotyping of the tails of F1 generation rats, and the identification results with primers EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-WT-R.

[0036] Figure 18 Shows the genotyping of the tails of F1 generation rats, and the identification results with primers EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-Mut-R.

[0037] Figure 19 Shows the key homologous genes of 5p model rats.

[0038] Figure 20 Shows the growth retardation of 5p model rats.

[0039] Figure 21 Shows the retarded development of motor coordination ability in 5p model rats.

[0040] Figure 22 Shows the hypotonia of 5p model rats.

[0041] Figure 23 Shows that 5p model rats have obvious social disorders.

[0042] Figure 24 Shows that 5p model rats have repetitive stereotyped behaviors and lack of curiosity.

[0043] Figure 25 Shows that 5p model rats exhibit obvious anxiety-like behaviors.

[0044] Figure 26 It shows that the limb balance ability of 5p model rats decreases.

[0045] Figure 27 It shows that 5p model rats have cognitive deficits.

[0046] Figure 28 It shows that the activity of 5p model rats decreases, accompanied by obvious anxiety-like behaviors. Detailed description

[0047] The various different features and aspects of the present invention will be discussed in more detail below.

[0048] The present invention provides a polynucleotide sequence encoding a CTNND2 truncation, the protein sequence of which is shown in SEQ ID NO: 2. In some embodiments, the polynucleotide sequence is as shown in SEQ ID NO: 1, or a polynucleotide sequence having 90.03% identity with SEQ ID NO: 1.

[0049] On the one hand, the present invention provides a nucleic acid construct, wherein the construct contains the polynucleotide sequence described above. Preferably, the nucleic acid construct is a recombinant AAV construct, which contains one or two ITRs and a polyA nucleotide sequence (polyA sequence).

[0050] In some embodiments, the nucleic acid construct includes transcriptional regulatory elements, which include a promoter and / or an enhancer.

[0051] In some specific embodiments, the nucleic acid construct includes:

[0052] a) 5' AAV inverted terminal repeat (ITR);

[0053] b) A first expression cassette, which encodes at least a first open reading frame (ORF) of the CTNND2 truncation under the control of regulatory control sequences that direct its expression;

[0054] c) A polyA sequence; and

[0055] d) 3' AAV ITR.

[0056] In the first expression cassette, transcriptional regulatory elements including a promoter and / or an enhancer are further included.

[0057] On the one hand, the present invention provides a vector, wherein the vector contains the polynucleotide sequence or the construct described in the present invention.

[0058] In some embodiments, the vector is an adeno-associated virus (AAV) vector. The recombinant AAV vector may comprise a nucleic acid molecule containing a 5' AAV ITR, the expression cassette described herein, and a 3' AAV ITR, packaged within an AAV capsid. As used herein, the expression cassette may comprise regulatory elements for one or more open reading frames within each expression cassette and the nucleic acid molecule may optionally comprise additional regulatory elements. The AAV vector may comprise a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3' ITR.

[0059] In some embodiments, the AAV vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof.

[0060] In one aspect, the invention provides a viral particle comprising the construct described in the invention.

[0061] In one aspect, the invention provides a composition comprising the polynucleotide sequence of the invention, the nucleic acid construct, the vector, or the viral particle, and a pharmaceutically acceptable excipient.

[0062] In yet another aspect, the invention discloses the use of the polynucleotide sequence, the nucleic acid construct, the vector, the viral particle, or the composition described in the invention in the preparation of a medicament for treating cri du chat syndrome disease in a desired subject.

[0063] Any suitable method or route can be used to administer the AAV-containing composition described herein, and optionally for co-administering other active pharmaceutical or therapeutic agents in combination with the AAV-mediated antibody described herein. Routes of administration include, for example, systemic administration, oral administration, intravenous administration, intraperitoneal administration, subcutaneous administration, or intramuscular administration.

[0064] In some embodiments, the subject is a mammal, preferably a human, preferably a child aged 2 - 5 years.

[0065] The following examples are illustrative only and not limiting of the invention described herein. Examples

[0066] Example 1: Preparation of the Vector

[0067] 1. Instrument Information

[0068] Table 1. Main Instrument Information Table

[0069] Instrument Name Instrument Source Cat.No. DNA Electrophoresis Tank Shanghai Tianneng Technology Co., Ltd. HE-120 Constant Voltage Electrophoresis Instrument Shanghai Tianneng Technology Co., Ltd. EPS-300 Gel Imaging Analyzer Peiqing Technology JS-680D Ultra-micro Spectrophotometer Beijing Kaiao Technology Development Co., Ltd. K5600 Electric Thermostatic Water Bath Shanghai Yiheng Scientific Instrument Co., Ltd. DK-8D Clean Bench Suzhou Jiabao Purification Engineering Equipment Co., Ltd. JB-CJ-2FD Water Bath Thermostatic Incubator Shanghai Yiheng Scientific Instrument Co., Ltd. GHP-9050 Constant Temperature Oscillator Shanghai Yiheng Scientific Instrument Co., Ltd. THZ-98AB PCR Instrument Applied Biosystems 2720 thermal cycler Refrigerated High-speed Centrifuge ThermoFisher CL17R Pipette Eppendorf Reference

[0070] 2. Reagent Information

[0071] Reagents: AxyPrep Plasmid DNA Mini Kit; PrimeSTAR HS DNA Polymerase; and Yuan seamless cloning kit.

[0072] Designed and produced AAV virus carrying the truncated rat CTNND2 gene. And designed and produced a rat truncated Ctnnd2 gene homologous to the human CTNND2 X8 gene, and completed the production of the rCtnnd2 nucleic acid drug carried by AAV.CAP-B10-CMV-rCTNND2-P2A-EGFP virus. The specific methods are as follows:

[0073] 1. Obtaining the target gene fragment:

[0074] The target gene was amplified by PCR. The target gene and its upstream and downstream sequences were queried from GenBank, and primers were designed using VectorNTI software.

[0075] PCR amplification of the target gene: Use the high-fidelity PrimeSTAR enzyme to amplify the target gene, and the reaction system and conditions are as follows:

[0076] Table 2. Composition of PCR Reaction Solution

[0077]

[0078] The PCR reaction conditions are set as follows:

[0079] ① 3-Step method

[0080]

[0081] Table 3. Primer Sequence Information Table

[0082] SEQ ID Primer Sequence SEQ ID No: 3 CMV-F cgcaaatgggcggtaggcgtg SEQ ID No: 4 101-R agagacagcaaccaggat

[0083] The PCR product was detected by agarose gel electrophoresis for the amplification effect, and the target gene band was cut from the gel after agarose gel electrophoresis, and gel recovery was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0.

[0084] 2. Preparation of linearized expression vector:

[0085] The expression vector was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg of plasmid, 5 μL of 10x reaction Buffer, 1 μL of each restriction endonuclease, and made up to 50 μL with water, and incubated in a 37°C water bath for more than 2 hours. The digestion products were detected by agarose gel electrophoresis for the digestion effect, and the target vector band was cut out from the gel after agarose gel electrophoresis, and gel extraction was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0.

[0086] 3. Insertion of the target gene into the linearized expression vector:

[0087] Using a seamless cloning kit suitable for single target gene insertion fragments (Heyuan seamless cloning kit, product number: OBCR(A)-50), the target gene fragment and the linearized vector were added to a centrifuge tube at a molar ratio of 2:1 for recombination reaction:

[0088]

[0089] Optimal amount of inserted fragment used = [0.04 × number of bases of inserted fragment (2082 bp)] = 83.28 ng (0.03 pmol)

[0090] Optimal amount of linearized vector used = [0.02 × number of bases of linearized vector (4696 bp)] = 93.92 ng (0.03 pmol)

[0091] x = Optimal amount of inserted fragment used (83.28 ng) / Concentration of the fragment obtained in the experiment (ng / μL)

[0092] y = Optimal amount of linearized vector used (93.92 ng) / Concentration of the empty plasmid obtained in the experiment (ng / μL)

[0093] After mixing, incubate at 37°C for 30 minutes, then transfer to ice and place for 5 minutes. Direct transformation or storage at -20°C and thaw for transformation when needed.

[0094] 4. Preparation and transformation of competent cells:

[0095] Preparation and transformation of DH5α competent cells (Thermo Fisher, product number: 18265017).

[0096] 5. Colony PCR identification of positive transformants:

[0097] The transformants grown on the plate were picked and resuspended in 10 μL of LB culture medium, and 1 μL was taken as a template for colony PCR identification. The reaction system and PCR cycling conditions are as follows:

[0098] Table 4. Composition of PCR reaction solution

[0099]

[0100] PCR reaction conditions

[0101] 3StepPCR

[0102]

[0103] The primer sequences are SEQ ID No: 3 and SEQ ID No: 4.

[0104] 6. Sending positive clones for sequencing:

[0105] The positive clones obtained by colony identification were sent to a sequencing company for sequencing verification. The sequencing results were aligned and analyzed using SnapGene software.

[0106] 7. Small-scale plasmid extraction:

[0107] For the positive clones that passed the sequencing, plasmid minipreps were arranged. The AxyPrep Plasmid DNA Miniprep Kit (Axygen; Catalog No.: AP-MN-P-50) was used for plasmid extraction.

[0108] 8. Plasmid expression detection experiment

[0109] 8.1 Experimental purpose

[0110] To detect the expression of Ctnnd2 protein after plasmid H23108 was transfected into 293T cells.

[0111] Table 5. Information table of main reagents and instruments

[0112] Reagent Name Manufacturer Catalog Number Western and IP Cell Lysis Buffer Beyotime P0013 PMSF Beyotime ST505 Pierce BCA Protein Assay Kit Thermo 23225 <![CDATA[PageRuler TM Prestained Protein Ladder]]> Thermo 26617 LumiBest Excellent ECL Luminescent Solution share-bio SB-WB011 Constant Voltage and Current Electrophoresis Instrument Tianneng EPS-600 Mini Vertical Electrophoresis Tank Tianneng VE-180 Transfer Electrophoresis Tank Tianneng VE-186

[0113] 8.2 Experimental method

[0114] To detect the expression of Ctnnd2 protein after plasmid H23108 was transfected into 293T cells.

[0115] 8.2.1 Total protein extraction

[0116] Take out the Western and IP cell lysis buffer and protease inhibitor PMSF from -20°C. Add 10 μL of PMSF to every 990 μL of cell lysis buffer and place it on ice. Take out the sterilized EP tubes, make marks, and place them on ice at 4°C. Take out the cells from the incubator, discard the cell culture medium, and wash the cells 1 - 2 times with PBS. Discard the PBS, add an appropriate amount of pre-cooled Western and IP cell lysis buffer (containing PMSF), and lyse the cells on ice for 30 minutes. Scrape the cells and transfer the samples into EP tubes. Transfer the centrifuge tubes containing the lysed cells to a pre-cooled high-speed and low-temperature centrifuge, and centrifuge at 4°C and 12,000 rpm for 5 - 10 minutes.

[0117] 8.2.2 Protein concentration measurement

[0118] Cell protein solution: Withdraw 3 μL from the stock solution, then add 27 μL of PBS to dilute it 10 times.

[0119] Preparation of BCA working solution: According to the number of samples, prepare an appropriate amount of BCA working solution according to the volume ratio of A to B of 50:1 and mix well.

[0120] Prepare the standard protein gradient: Dilute the 2000 μg / mL BSA standard to 0, 25, 125, 250, 500, 750, 1000, 1500, 2000 μg / mL.

[0121] Protein concentration determination: Take 25 μL of each of the standard and sample and add them to a 96-well plate. Add 200 μL of BCA working solution to each well and place it at 37°C for 30 minutes. Measure the absorbance at A562 with an enzyme-linked immunosorbent assay (ELISA) reader. Calculate the protein concentration of the sample according to the standard curve and the volume of the sample used.

[0122] 8.2.3 Sample preparation

[0123] For each well's calculated data, expand and dilute it in equal volume according to the actual amount of the sample mother liquor, then add loading buffer. Add it according to a ratio of 1:4 (loading buffer: cell solution), mix, then boil at 95°C for 5 minutes, place it on a dry ice box, and then centrifuge at 4°C and 12,000 g for 5 minutes.

[0124] 8.2.4 SDS-PAGE gel preparation

[0125] Align two clean glass plates and place them in the clamp, then tighten and fix them on the glue-filling bracket; prepare the separating gel liquid (the preparation system is shown in Table 5 in detail), and gently stir and mix evenly; immediately add the separating gel liquid into the sandwich of the glass plate until the gel is about 5 cm high; slowly add deionized water to the top of the liquid surface in the sandwich until it is full. Let the gel polymerize at room temperature for 30 minutes. After polymerization, a clear refraction line can be seen at the interface between the top deionized water and the gel; pour out the top deionized water and try to dry it with absorbent paper as much as possible; prepare 5% stacking gel liquid (the preparation system is shown in Table 6 in detail), add the liquid to the sandwich of the glass plate until it reaches the top of the sandwich; insert a 1.5-mm-thick comb into the stacking gel liquid in the sandwich, and if necessary, add more stacking gel liquid to fill the remaining space. Let the stacking gel polymerize at room temperature for 30 minutes.

[0126] Table 6. SDS-PAGE Separating Gel Recipe Table

[0127]

[0128]

[0129] Table 7. SDS-PAGE Stacking Gel (5% Acrylamide) Recipe Table

[0130]

[0131] 8.2.5 SDS-PAGE Gel Electrophoresis

[0132] Fix the gel plate in the inner slot of the electrophoresis device, place the fixed gel plate in the outer slot, and add an appropriate amount of 1× SDS electrophoresis buffer to the outer slot. And add electrophoresis buffer to the inner slot until it just submerges the gel loading wells;

[0133] Carefully pull out the comb to avoid tearing the polyacrylamide gel loading wells. After pulling out the comb, rinse and fill the loading wells with 1× SDS electrophoresis buffer;

[0134] Load the sample and perform SDS-PAGE electrophoresis. Connect the power supply, first electrophorese at 80 V for 30 minutes until the bromophenol blue dye enters the separating gel from the stacking gel, and then adjust the voltage to 120 V and continue electrophoresis for 70 minutes until the bromophenol blue reaches the bottom of the gel;

[0135] 8.2.6 Blotting

[0136] Before the electrophoresis ends, prepare 1 PVDF membrane and 6 filter papers of the same size as the gel. Activate the PVDF membrane with methanol for 5 minutes, then equilibrate it in the buffer for 15 minutes; equilibrate the filter papers in the transfer buffer for 15 minutes; place the transfer clip, two sponge pads, the filter papers, and the soaked membrane in the tray containing the transfer solution; open the clip to keep the black side horizontal. Place a sponge pad on it. Place three layers of filter papers on the pad and remove the air bubbles; pry off the glass plate, gently scrape off the stacking gel, rinse the gel once in ddH2O, and then rinse it once in 1× transfer buffer. Carefully cover the separating gel with the filter paper and align it with the filter paper by hand. Cover the membrane on the gel, covering the entire gel and removing the air bubbles. Cover 3 filter papers on the membrane and remove the air bubbles. Finally, cover with another sponge pad and close the clip; place the clip in the transfer tank, with the black side of the clip facing the black side of the tank and the white side of the clip facing the red side of the tank. Electrotransfer generates heat, so place an ice block on one side of the tank to cool it down. Generally, transfer at 300 mA for 2 hours. Turn off the power and remove the connected wires, discard the electrophoresis buffer, and take out the gel sandwich.

[0137] 8.2.7 Immunoreaction

[0138] Table 8. Antibody Information Table

[0139] Antibody Name Brand Catalog Number Dilution Ratio 2A Novus NBP2-59627 1:1000 Goat Anti-mouseIgG Beyotime A0216 1:3000 GAPDH Bioworld AP0063 1:10000 Goat Anti-rabbit IgG Beyotime A0208 1:3000

[0140] Transfer the membrane to an incubation box containing 5% non-fat milk in TBST and shake it on a shaker at room temperature for 1 hour to block; dilute the primary antibody to an appropriate concentration with TBST containing 5% non-fat milk; take out the membrane from the blocking solution, place the protein side of the membrane facing up on the surface of the antibody solution, and lift the four corners of the membrane to drive out the remaining air bubbles; incubate it with shaking on a shaker at 4°C overnight; wash it three times with TBST on a shaker at room temperature for 10 minutes each time; dilute the secondary antibody in the same way and contact it with the membrane. After incubating for 1 - 2 hours at room temperature, wash it three times with TBST on a shaker at room temperature for 10 minutes each time for chemiluminescence reaction.

[0141] 8.2.8 Chemiluminescence

[0142] Mix equal volumes of reagent A and reagent B; place the membrane with the protein side facing up on a white board, drop the luminescent solution on the membrane to fully cover the membrane surface, and then put it into an imager for photographing.

[0143] 8.3 Results

[0144] It is predicted that the Ctnnd2 protein is about 79 / 106 KDa, Figure 4 and the experimental results show that a protein band was detected between Marker 70 - 100 KDa.

[0145] Example 2: In Vivo Experimental Results

[0146] AsFigure 5 As shown in the process, the constructed targeted nucleic acid drug was injected into 5p model rats via the tail vein, and behavioral and related experiments were conducted 4 - 12 weeks after administration. Then, the animals were fed normally for a long time, and the social behavior, anxiety-like behavior, and cognitive function of the animals were tested at 6 months, 9 months, and 12 months of drug use to evaluate the long-term efficacy of the drug. The results showed that 4 - 8 weeks after administration to rats at 3 - 4 weeks of age, the impaired novel object preference memory, object location recognition memory, and object location exchange recognition cognitive function of 5p model rats were improved. However, the improvement of anxiety-like behavior in 5p model rats by tail vein injection of rCTNND2 gene-targeted nucleic acid drug was not obvious.

[0147] Figure 6 A - B shows that 4 - 8 weeks after tail vein injection of rCTNND2 gene-targeted nucleic acid drug into 5p model rats, whether compared with 5p model rats injected with empty AAV or with their own behavior before drug administration, the impaired novel object preference memory function of 5p model rats was significantly improved; Figure 6 C - D After tail vein injection of rCTNND2 gene-targeted nucleic acid drug, the object location recognition memory and object location exchange recognition cognitive function of 5p model rats were also significantly improved.

[0148] As Figure 7 shown, 4 - 8 weeks after tail vein injection of rCTTND2 gene-targeted nucleic acid drug into 5p model rats, like 5p model rats injected with empty AAV, they still showed obvious anxiety-like behavior, suggesting that the anxiety-like behavior of 5p model rats was not improved after tail vein injection of rCTNND2 gene-targeted nucleic acid drug.

[0149] Figure 8 As shown in A - B, administering rCTNND2 gene-targeted nucleic acid drug to 5p model rats at 8 weeks of age at birth did not significantly improve the novel object preference memory function and three-chamber social behavior of the animals, but had a certain degree of improvement on the anxiety-like behavior of 5p model rats, suggesting that tail vein injection of rCTNND2 gene-targeted nucleic acid drug in the late stage of puberty had a worse effect than administering the drug soon after birth, and the administration time was crucial.

[0150] Example 3: Biological preparation of 5p model rats

[0151] 1. Sequencing confirmation of target sequence

[0152] For different strains, the target gene sequences may vary. To ensure the efficiency of the designed Cas9 / sgRNA, it is first necessary to perform PCR amplification and sequencing verification on the target site sequence of SD rat tails to ensure that the sgRNA recognition sequence is exactly the same as the SD rat tail DNA sequence. The PCR primers are as follows:

[0153] Table 9. Primer sequence table

[0154]

[0155] PCR and sequencing were performed on the DNA of SD rat tails, and the results proved that the target sequence of the SD rat tail was completely consistent with the sequences given by Genebank and Ensembl.

[0156] 2. Design and construction of Cas9 / sgRNA

[0157] 2.1. Design of Cas9 / sgRNA

[0158] Based on the design principle of sgRNA, 8 sgRNAs were designed at the 5' target site and 14 sgRNAs were designed in the 3' target site region. The corresponding targeting sequences are as follows:

[0159] Table 10. Information table of targeting sequences corresponding to sgRNA

[0160]

[0161]

[0162] 2.2. Construction of Cas9 / sgRNA plasmid

[0163] Oligos were synthesized according to the designed sgRNA sequences and ligated into the pCS-4G vector by Gibson method. After transformation of the ligation products, the samples were sent for sequencing and verified to be correct. The pre-cut pCS vector map is as Figure 11 shown.

[0164] 3. Activity detection of Cas9 / sgRNA

[0165] For the activity detection of sgRNA, a CRISPR / Cas9 activity detection method independently developed by Beijing Biocytogen - UCATM method was used. It has the advantages of no species restriction, high throughput, wide adaptability, high sensitivity, simplicity, etc. EGE-ZLM-048-A-sgRNA3 and EGE-ZLM-048-A-sgRNA20 were comprehensively selected for the next experiment. The detection results are as Figure 12 shown.

[0166] 4. RNA preparation of sgRNA

[0167] EGE-ZLM-048-A-sgRNA3 and EGE-ZLM-048-A-sgRNA20 were subjected to in vitro transcription to obtain the RNA for microinjection. The RNA electrophoresis map is as Figure 13 shown.

[0168] 5. Microinjection of Cas9 / sgRNA

[0169] The Cas9 / sgRNA was microinjected into rat fertilized eggs, and the birth situation of F0 rats after injection was as follows.

[0170] Table 11. Birth situation of F0 rats after injecting Cas9 / sgRNA into rat fertilized eggs

[0171]

[0172] 6. Genotype identification of F0 rats

[0173] Gene knockout rats were constructed by injecting Cas9 / sgRNA into fertilized eggs. Since the cleavage rate of embryos is very fast in the early stage, the obtained F0 rats are chimeras. Therefore, the F0 genotype obtained by identifying the tails of F0 rats is only for reference and cannot represent that they must be heritable gene mutant types. The heritable genotype needs to be determined after detecting the tails of F1 rats.

[0174] 6.1. Design of identification primers

[0175] The primer design principle is as Figure 14 shown.

[0176] The primer information is as follows:

[0177] Table 12. Identification primer information table

[0178]

[0179] PCR conditions: 2x Taq Plus Master Mix II (Dye Plus) progress

[0180] Enzyme: 2x Taq Plus Master Mix II (Dye Plus)

[0181] Table 13. PCR reaction conditions and procedures

[0182]

[0183] 6.2. Genotype identification of F0 rat tails

[0184] The identification results are as Figure 15 shown. Primers: EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-Mut-R. Through PCR amplification and product sequencing, it was shown that EM48-0002, EM48-0004, EM48-0005, EM48-0007, EM48-0008, EM48-0019, EM48-0028, EM48-0032, EM48-0045 and EM48-0052 were positive F0 rats.

[0185] 7. Genotyping of F1 Rats

[0186] Some of the positive F0 rats identified above were mated with wild-type rats to obtain F1 rats with stable genotypes. The mating results are as follows:

[0187] Table 14. Mating of F0 Rats with Wild-Type Rats

[0188]

[0189] 7.1. Design of Identification Primers

[0190] The primer design principle is as Figure 16 shown.

[0191] The primer information is as follows:

[0192] Table 15. Primer Sequence Information Table for Identification

[0193]

[0194] Polymerase chain reaction conditions: 2x Taq Plus Master Mix II (Dye Plus) progress

[0195] Enzyme: 2x Taq Plus Master Mix II (Dye Plus)

[0196] Table 16. PCR Reaction Conditions and Procedures

[0197]

[0198] Genotyping of the tails of F1 rats. The identification results are as Figure 17 shown. Primers: EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-WT-R; as Figure 18 shown. Primers: EGE-ZLM-048-A-WT-F / EGE-ZLM-048-A-Mut-R.

[0199] Sequencing results of F1 rats:

[0200] 1EM48-0001, 1EM48-0004, 1EM48-0005, 1EM48-0007, 1EM48-0009, 1EM48-0010, 1EM48-0011, 1EM48-0012, 1EM48-0013, 1EM48-0015, 1EM48-0016, and 1EM48-0020 are positive F1 rats.

[0201] We used the positive rats for subsequent experiments.

[0202] The rat gene homologous to the human 5p gene is located on rat chromosome 2. A 1.68 Mb fragment is knocked out, which contains multiple genes related to growth and development. Preliminary results show that homozygous 5p model rats die in utero, while heterozygous 5p model rats can survive, but with growth and development retardation. Their body weight and body length are significantly lower than those of normal rats. Compared with age-matched control rats, 5p model rats have reduced muscle tone, and these phenotypes are highly consistent with those of 5p patients.

[0203] Figure 19 qPCR experiments confirmed that Ctnnd2, Cct5, Marchf6, and Ankrd33b, the key pathogenic homologous genes of cri-du-chat syndrome, are deleted in 5p model rats.

[0204] Figure 20 A - C show that the body weight, body length, and tail length of 5p model rats are significantly smaller than those of control rats. Figure 20 D - E show that compared with control rats, there are no significant changes in the auricle development of 5p model rats and the time of the first eye opening of neonatal rats.

[0205] Interestingly, compared with control rats, the first response of 5p model neonatal rats to environmental sounds after birth is significantly earlier, indicating that 5p model rats are hypersensitive to surrounding environmental sounds, and this phenotype is also highly consistent with that of 5p patients. Similar to Ctnnd2 knockout mice, we detected the social behavior of the animals. The results of the three-chamber social behavior test showed that 5p model rats have severe social disorders. Similar to the characteristics of cri-du-chat syndrome patients, the grooming time of 5p model rats increased significantly, showing repetitive stereotyped behaviors, and at the same time accompanied by a decrease in curiosity about the surrounding environment, indicating that 5p model rats have typical autistic-like behaviors. The open field experiment showed that the activity range of 5p model rats decreased significantly, mainly concentrated in the peripheral area of the open field, and the staying time in the central area decreased significantly, indicating that the animals have obvious anxiety-like behaviors; the elevated plus maze experiment also confirmed the obvious anxiety-like behaviors of 5p model rats. We also detected the limb balance ability and posture gait of the animals. The results showed that there was a certain degree of loss of motor balance coordination in 5p model rats, suggesting abnormal functions of the cerebellum and extrapyramidal system in 5p model rats. Further behavioral experiments showed that there were obvious deficiencies in the novel object preference memory, object location recognition memory, and object location exchange recognition cognitive functions of 5p model rats, which were highly consistent with the mental retardation of cri-du-chat syndrome patients.

[0206] Figure 21 A - B show that the development of the righting reflex in the plane and in the air of 5p model rats is delayed; Figure 21 C shows that the time of the first body rotation movement after birth of 5p model rats is slightly delayed, but there is no significant difference compared with control rats. Figure 21Figure D shows that there was no significant change in the time of the first crawl and negative geotaxis in the 5p model neonatal mice compared with the control mice. Figure 21 Figure E shows that the first reactivity to environmental sounds in the 5p model neonatal mice was significantly earlier than that in the control mice, indicating the hypersensitivity of the 5p model rats to environmental sounds.

[0207] Figure 22 Figures A - B show that the total time and score of rope grasping in the 5p model rats were significantly decreased compared with the control normal rats, indicating the reduced muscle tension in the 5p model rats.

[0208] Figure 23 It shows that the 5p model rats have obvious social disorders.

[0209] Figure 24 Figure A shows that the grooming time of the 5p model rats was significantly increased, suggesting the repetitive stereotyped behavior in the 5p model rats. Figure 24 Figure B shows that the digging time of the 5p model rats in the cage was significantly decreased compared with the control rats, indicating the lack of curiosity about the surrounding things in the 5p model rats.

[0210] Figure 25 A, Open - field test: The time of the 5p model rats staying in the central area of the open - field was significantly decreased, showing obvious anxiety - like behaviors, but the movement speed of the animals in the open - field did not change. Figure 25 Figure B shows that the 5p model rats also showed obvious anxiety - like behaviors in the elevated plus - maze test, further supporting the results of the open - field test.

[0211] Figure 26 Figure A shows that the limb balance ability test of the 5p model rats was abnormal. Figure 26 Figure B shows that the movement postures and gaits of the 5p model rats were basically normal, indicating that there was no obvious lack of motor coordination in the 5p model rats, suggesting a certain degree of abnormality in the cerebellar and extrapyramidal system functions of the 5p model rats.

[0212] Figure 27 Figures A - C show that there were obvious deficiencies in the novel object preference memory, object location recognition memory, and object location exchange recognition cognitive functions of the 5p model rats.

[0213] In summary, the phenotypes of these 5p model rats were highly consistent with those of patients with cri - du - chat syndrome. Worldwide, the rodent model we established for the first time not only verified the key gene of cri - du - chat syndrome but also laid a solid foundation for in - depth research on the pathogenesis of rare childhood neurological diseases and their drug development.

[0214]

[0215]

[0216] Incorporation by reference

[0217] The entire contents of each patent and scientific document mentioned herein are incorporated herein by reference for all purposes.

[0218] Equivalence

[0219] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Accordingly, the above-described embodiments are to be considered in all respects as illustrative and not restrictive of the invention described herein. Thus, the scope of the present invention is indicated by the appended claims rather than by the foregoing description, and is intended to include all modifications within the meaning and scope of equivalents of the claims.

Claims

1. A polynucleotide encoding a truncated form of CTNND2, wherein the protein sequence of the truncated form of CTNND2 is as shown in SEQ ID NO:

2.

2. The polynucleotide according to claim 1, wherein, The polynucleotide sequence is as shown in SEQ ID NO:

1.

3. A nucleic acid construct, wherein, The nucleic acid construct contains the polynucleotide as described in claim 1 or 2.

4. The nucleic acid construct according to claim 3, further comprising a transcriptional regulatory element, the transcriptional regulatory element comprising a promoter and / or an enhancer.

5. A vector, wherein, The vector contains the polynucleotide as described in claim 1 or 2 or the nucleic acid construct as described in claim 3 or 4.

6. The vector according to claim 5, wherein the vector is an adeno-associated virus (AAV) vector.

7. The vector according to claim 6, wherein the AAV vector is selected from the group consisting of: AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and hybrids thereof.

8. A viral particle, wherein, It comprises the nucleic acid construct as described in claim 3 or 4.

9. A composition comprising the polynucleotide according to claim 1 or 2, the nucleic acid construct according to claim 3 or 4, the vector according to any one of claims 5 to 7, or the viral particle according to claim 8, and a pharmaceutically acceptable excipient.

10. Use of the polynucleotide according to claim 1 or 2, the nucleic acid construct according to claim 3 or 4, the vector according to any one of claims 5 to 7, the viral particle according to claim 8, or the composition according to claim 9 in the preparation of a medicament for treating cri du chat syndrome in a subject in need thereof.

11. The use according to claim 10, wherein the subject is a human.

12. The use according to claim 10, wherein the subject is a child.

Images