Application of a BACH1 molecule in insulin resistance

Abstract

This invention relates to the application of the BACH1 molecule in the diagnosis, prevention, and / or treatment of insulin resistance-related diseases. The BACH1 molecule can serve as a biomarker for the detection of insulin resistance-related diseases. Furthermore, regulating the BACH1 molecule can enhance or inhibit its activity and / or expression, thereby regulating the BACH1-mediated insulin signaling pathway and / or the activity and / or expression of glucose and lipid metabolism-related molecules, thus modulating insulin sensitivity, blood glucose levels, and hepatic lipid deposition, for the prevention and / or treatment of insulin resistance-related diseases.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of a BACH1 molecule in insulin resistance. Background Technology

[0002] The liver is a crucial target organ for insulin. Insulin inhibits glycogenolysis and gluconeogenesis in the liver. When insulin action is weakened, it fails to inhibit hepatic glucose output, a condition known as hepatic insulin resistance or decreased hepatic insulin sensitivity. Insulin resistance manifests as a reduced response to insulin, with normal doses of insulin producing a lower biological effect than normal. Specifically, it involves resistance of insulin target cells (including adipocytes, myocytes, and hepatocytes) to insulin-regulated glucose and lipid metabolism. The liver's situation is more complex, exhibiting selective resistance. Hepatic insulin resistance leads to glucose and lipid metabolism disorders, primarily manifested as weakened glycogenolysis and enhanced gluconeogenesis, resulting in elevated blood glucose levels. Simultaneously, increased lipid synthesis causes lipid deposition in the liver, ultimately leading to the development and progression of metabolic diseases such as type 2 diabetes, non-alcoholic fatty liver disease, and cardiovascular disease.

[0003] However, the mechanisms underlying hepatic insulin resistance are not yet fully understood, and in-depth research into the molecular mechanisms of hepatic insulin resistance is of great significance for the prevention and treatment of insulin resistance-related diseases. Studies have shown that systemic knockout of BACH1 in mice can inhibit methionine-choline deficiency-induced hepatic steatosis and protect mouse pancreatic β-cells from oxidative stress-induced damage; high glucose levels can increase BACH1 expression in human glomerular endothelial cells, participating in the progression of diabetic nephropathy. Therefore, BACH1 is closely related to the progression of metabolic diseases such as diabetes and fatty liver, but whether BACH1 affects hepatic insulin resistance has not yet been reported. Summary of the Invention

[0004] This invention investigated the mechanism by which BACH1 regulates the insulin signaling pathway, finding that insulin resistance can be modulated by regulating the expression of BACH1 molecules.

[0005] A first aspect of the present invention relates to the use of a BACH1 molecule as a biomarker in insulin resistance-related diseases.

[0006] Preferably, the BACH1 molecule includes the BACH1 protein, gene, and / or mRNA.

[0007] Preferably, the biomarker detection sample is derived from blood and / or tissue; more preferably, the tissue includes liver tissue; and even more preferably, the detection sample is derived from hepatocytes.

[0008] A second aspect of the invention relates to the use of a BACH1 molecule detection reagent in the preparation of diagnostic products for insulin resistance-related diseases.

[0009] Preferably, the detection reagent includes:

[0010] 1) Reagents for detecting BACH1 protein expression levels;

[0011] 2) Reagents for detecting Bach1 gene expression levels; and / or,

[0012] 3) Reagents for detecting Bach1 mRNA expression levels.

[0013] Preferably, the reagents for detecting BACH1 molecules include primers, probes, antibodies, enzyme substrates, gene chips, or protein chips.

[0014] Preferably, the primers for detecting BACH1 molecules include a forward primer and a reverse primer; more preferably, the primers include:

[0015] Forward primer 1: 5'-TGTGATTAGCCTGGGAGA-3' (SEQ ID NO: 3),

[0016] Reverse primer 1: 5'-CGATTTCCGACTCAAGGT-3' (SEQ ID NO: 4), or,

[0017] Forward primer 2: 5'-AGCAGTCTTATGGAACCAACTC-3' (SEQ ID NO: 5),

[0018] Reverse primer 2: 5'-CGTTCCTTGGAAGATCTGTGAT-3' (SEQ ID NO: 6).

[0019] A third aspect of the invention relates to a diagnostic product comprising a detection reagent for BACH1 molecules.

[0020] Preferably, the BACH1 molecule includes the BACH1 protein, gene, and / or mRNA.

[0021] Preferably, the detection reagent includes:

[0022] 1) Reagents for detecting BACH1 protein expression levels;

[0023] 2) Reagents for detecting Bach1 gene expression levels; and / or,

[0024] 3) Reagents for detecting Bach1 mRNA expression levels.

[0025] Preferably, the reagents for detecting BACH1 molecules include primers, probes, antibodies, enzyme substrates, gene chips, or protein chips.

[0026] Preferably, the diagnostic products include, but are not limited to, diagnostic kits, primers, probes, antibodies, enzyme substrates, gene chips, or protein chips.

[0027] Preferably, the primers for detecting BACH1 molecules include forward primers and reverse primers; more preferably, the primers are as defined in the second aspect.

[0028] A fourth aspect of the present invention relates to the use of a BACH1 molecule regulatory agent in regulating the activity and / or expression of BACH1 molecule-mediated insulin signaling pathway and / or glucose and lipid metabolism-related molecules, wherein the BACH1 molecule regulatory agent comprises a BACH1 molecule enhancer or a BACH1 molecule inhibitor, wherein the BACH1 molecule enhancer enhances the activity and / or expression of the BACH1 molecule, and the BACH1 molecule inhibitor inhibits the activity and / or expression of the BACH1 molecule.

[0029] Preferably, the BACH1 molecule includes the BACH1 protein, gene, and / or mRNA.

[0030] Preferably, the regulatory agent of the BACH1 molecule enhances or inhibits the activity and / or expression of BACH1-mediated insulin signaling pathway and / or glucose and lipid metabolism-related molecules by inhibiting or enhancing the activity and / or expression of the BACH1 molecule.

[0031] Preferably, the BACH1 molecule-mediated insulin signaling pathway includes protein tyrosine phosphatase non-receptor type 1B (PTP1B), phosphorylation of insulin receptor-β (IR-β), phosphorylation of protein kinase B (PKB, also known as AKT), phosphorylation of glycogen synthase kinase-3β (GSK-3β), phosphorylation of human forkhead box O1 (FOXO1), and the influence on hepatic glycogen synthesis pathway, gluconeogenesis pathway, and / or lipid synthesis pathway; the glucose and lipid metabolism-related molecules include gluconeogenesis genes or their proteins, cholesterol synthesis-related genes or their proteins, fatty acid uptake-related genes or their proteins, fatty acid synthesis-related genes or their proteins, and / or fatty acid β-oxidation-related genes or their proteins.

[0032] More preferably, the BACH1 molecule mediates the interaction between protein tyrosine phosphatase 1B (PTP1B) and the insulin receptor β subunit (IR-β).

[0033] Preferably, the regulating agent includes:

[0034] 1) Vectors containing the Bach1 gene, overexpression or knockout reagents;

[0035] 2) Regulatory factors that enhance or inhibit the expression of the Bach1 gene or mRNA; and / or,

[0036] 3) Reagents that enhance or inhibit the activity of BACH1 protein.

[0037] Preferably, the regulating agent includes, as required by the specific implementation, any reagent in the prior art that can enhance or inhibit the expression level of BACH1 molecules.

[0038] Preferably, the overexpression or knockout includes systemic or local specific overexpression or knockout; more preferably, the overexpression or knockout is liver-specific overexpression or knockout.

[0039] Preferably, the knockout reagent comprises knocking out exon 1, exon 2, exon 3, exon 4 and / or exon 5 of the Bach1 gene.

[0040] Preferably, the regulatory reagents include those used in point mutation, deletion, insertion, antisense polynucleotides, siRNA, shRNA, microRNA, or gene editing techniques; more preferably, the gene editing techniques include DNA homologous recombination based on embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease, and other gene editing techniques.

[0041] Preferably, the overexpression includes using the Cre-LoxP or Flp-Frt gene recombination system.

[0042] In one specific implementation, a single copy of mouse Bach1 is inserted into the H11 site between the mouse CAG promoter and the loxP-STOP-loxP card locus to obtain transgenic mice. Cre recombinase is then introduced to construct mice that specifically overexpress BACH1 in hepatocytes.

[0043] Preferably, the regulatory agent includes an inhibitor of the BACH1 molecule, inhibiting the activity and / or expression of the BACH1 molecule.

[0044] More preferably, the inhibitor comprises:

[0045] 1) Knockout reagents containing the Bach1 gene;

[0046] 2) Regulatory factors that inhibit the expression of the Bach1 gene or mRNA; and / or,

[0047] 3) Reagents that inhibit the activity of BACH1 protein.

[0048] Preferably, the Bach1 gene knockout reagent comprises shRNA of the BACH1 molecule; more preferably, the shRNA comprises:

[0049] CCGCAGGUAUCAAGGAAAUTT (SEQ ID NO: 12),

[0050] GUCAGGAUUUACCUUUGAATT (SEQ ID NO: 13),

[0051] CCAGGUCAAAGGACUUUCATT (SEQ ID NO: 14), or,

[0052] GCGUACACAAUAUCGAGGATT (SEQ ID NO: 15).

[0053] Preferably, the knockout includes knockout using the Cre-LoxP or Flp-Frt gene recombination system, followed by tamoxifen-induced specific knockout.

[0054] In one specific implementation, Bach1 is generated by having loxP sites flanking exons 3 and 4. flox / flox Mice. Heterozygous mice were crossed to obtain homozygous mice. Cre recombinase was introduced to generate hepatocyte-specific Bach1 gene knockout mice.

[0055] Preferably, the reagent for inhibiting BACH1 protein activity includes an antibody against BACH1 protein; more preferably, the antibody includes a binding fragment to the BTB functional domain of BACH1 protein. Even more preferably, the antibody against BACH1 protein competitively binds to the BTB functional domain of BACH1 protein, thereby inhibiting the activity of BACH1 protein.

[0056] Preferably, the reagent for inhibiting BACH1 protein activity includes a reagent for mutating BACH1 protein or a BACH1 protein mutant, wherein the BACH1 protein mutation includes inactivating the BTB functional domain of the BACH1 protein; more preferably, the BACH1 protein mutation or BACH1 protein mutant includes deletion, substitution and / or insertion of amino acid residues in the BTB functional domain.

[0057] Preferably, the inhibitor of the BACH1 molecule enhances or inhibits the activity and / or expression of BACH1-mediated insulin signaling pathways and / or glucose and lipid metabolism-related molecules.

[0058] Preferably, the inhibitor of the BACH1 molecule promotes phosphorylation of insulin receptor β, protein kinase B, glycogen synthase kinase-3, and human forkhead box protein O1, and inhibits the expression of gluconeogenesis genes, cholesterol synthesis-related genes, fatty acid synthesis-related genes, or fatty acid uptake-related genes.

[0059] Preferably, the inhibitor of the BACH1 molecule enhances the expression of fatty acid β-oxidation-related genes.

[0060] Preferably, the inhibitor of the BACH1 molecule inhibits the binding of PTP1B to IR-β on the cell membrane, thereby promoting insulin signaling.

[0061] Preferably, the inhibitor of the BACH1 molecule reduces the levels of blood glucose, insulin, triglycerides (TG), total cholesterol (TC), non-esterified fatty acids (NEFA), alkaline phosphatase (ALP), alanine aminotransferase (ALT / GPT), or aspartate aminotransferase (AST / GOT).

[0062] Preferably, the inhibitor of the BACH1 molecule improves glucose tolerance, insulin tolerance, and / or insulin sensitivity.

[0063] Preferably, the regulator of the BACH1 molecule is an enhancer of the BACH1 molecule, which enhances the activity and / or expression of the BACH1 molecule, thereby enhancing or inhibiting the activity and / or expression of BACH1-mediated insulin signaling pathways and / or glucose and lipid metabolism-related molecules.

[0064] Preferably, the enhancer of the BACH1 molecule inhibits phosphorylation of insulin receptor β, protein kinase B, glycogen synthase kinase-3, and human forkhead box protein O1, and promotes the expression of gluconeogenesis genes, cholesterol synthesis-related genes, fatty acid synthesis-related genes, or fatty acid uptake-related genes.

[0065] Preferably, the enhancer of the BACH1 molecule inhibits the BACH1 molecule-mediated insulin signaling pathway. More preferably, the enhancer of the BACH1 molecule enhances the binding of PTP1B to IR-β on the cell membrane, thereby inhibiting insulin signaling.

[0066] Preferably, the enhancer of the BACH1 molecule increases the levels of blood glucose, insulin, triglycerides, total cholesterol, free fatty acids, alkaline phosphatase, alanine aminotransferase, or aspartate aminotransferase.

[0067] Preferably, the enhancer of the BACH1 molecule reduces glucose tolerance, insulin tolerance, and / or insulin sensitivity.

[0068] Preferably, the gluconeogenic genes include genes encoding phosphoenolpyruvate carboxykinase 1 (Pck1) or glucose-6-phosphatase catalytic subunit (G6pc).

[0069] Preferably, the cholesterol synthesis-related genes include genes encoding cholesterol-regulatory element binding protein 1 (Srebp1), 3-hydroxy-3-methylglutaryl-coenzyme Areductase (Hmgcr), ATP-binding cassette transporter G1 (Abcg1), or cholesterol 7α-hydroxylase (Cyp7a1).

[0070] The fatty acid uptake-related genes include genes encoding fatty acid transport protein 1 (FATP1), fatty acid-binding protein 1 (FABP1), or fatty acid translocase (Cluster of differentiation 36, CD36).

[0071] The fatty acid synthesis-related genes include those encoding fatty acid synthase (Fasn), stearoyl-CoA desaturase 1 (Scd1), acetyl-CoA carboxylase α (Acaca), or acetyl-CoA carboxylase β (Acacb).

[0072] The fatty acid β-oxidation-related genes include those encoding pyruvate dehydrogenase kinase 4 (Pdk4), peroxisome proliferator-activated receptor alpha (Ppara), carnitine palmitoyltransferase 1A (Cpt1a), peroxisome acyl-CoA oxidase 1 (Acox1), long-chain acyl-CoA dehydrogenase (LCAD), medium-chain acyl-CoA dehydrogenase (MCAD), or mitochondrial uncoupling protein 2 (UCP2).

[0073] A fifth aspect of the invention relates to the use of a BACH1 molecule regulator in the preparation of a pharmaceutical composition for the prevention and / or treatment of insulin resistance-related diseases, said BACH1 molecule regulator comprising a BACH1 molecule enhancer or a BACH1 molecule inhibitor, said BACH1 molecule enhancer enhances the activity and / or expression of the BACH1 molecule, said BACH1 molecule inhibitor inhibits the activity and / or expression of the BACH1 molecule.

[0074] Preferably, the BACH1 molecule includes the BACH1 protein, gene, and / or mRNA.

[0075] Preferably, the regulating agent is as defined in the fourth aspect.

[0076] Preferably, the regulatory agent is an inhibitor of the BACH1 molecule, which inhibits the activity and / or expression of the BACH1 molecule, or enhances or inhibits the activity and / or expression of BACH1-mediated insulin signaling pathway and / or glucose and lipid metabolism-related molecules.

[0077] Preferably, the inhibitor is as defined in the fourth aspect.

[0078] Part VI of this invention relates to the use of a modulatory agent of the PTP1B molecule in the preparation of pharmaceutical compositions for the prevention and / or treatment of insulin resistance-related diseases.

[0079] Preferably, the regulating agent enhances or inhibits the activity and / or expression of PTP1B molecules.

[0080] Preferably, the PTP1B molecule includes PTP1B protein, gene and / or mRNA.

[0081] Preferably, the regulating agent includes:

[0082] 1) Vectors containing the PTP1B gene, overexpression or knockout reagents;

[0083] 2) Regulatory factors that enhance or inhibit the expression of the PTP1B gene or mRNA; and / or,

[0084] 3) Reagents that enhance or inhibit the activity of PTP1B protein.

[0085] Preferably, the regulating agent includes, as required by the specific implementation, any reagent in the prior art that can regulate the expression level of PTP1B molecules.

[0086] Preferably, the regulatory reagent includes antibodies using PTP1B protein or reagents used in point mutation, deletion, insertion, antisense polynucleotides, siRNA, shRNA, microRNA, or gene editing techniques; more preferably, the gene editing techniques include DNA homologous recombination based on embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease, and other gene editing techniques.

[0087] Preferably, the regulating agent is an inhibitor of PTP1B molecules, inhibiting the activity and / or expression of PTP1B molecules.

[0088] Preferably, the inhibitor comprises:

[0089] 1) Knockout reagents containing the PTP1B gene;

[0090] 2) Regulatory factors that inhibit the expression of the PTP1B gene or mRNA; and / or,

[0091] 3) Reagents to inhibit the activity of PTP1B protein.

[0092] Preferably, the PTP1B molecule includes PTP1B protein, gene and / or mRNA.

[0093] Preferably, the inhibitor comprises siRNA of the PTP1B molecule; more preferably, the siRNA of the PTP1B molecule comprises:

[0094] CCAGGAAGAUAAUGACUAUTT (SEQ ID NO: 16),

[0095] CCGUGGACAUCAAGAAAGUTT (SEQ ID NO: 17), or,

[0096] CCAGGACAUUCGACAUGAATT (SEQ ID NO: 18).

[0097] Preferably, the inhibitor of the PTP1B molecule regulates the phosphorylation of insulin receptor β, phosphorylation of protein kinase B, phosphorylation of glycogen synthase kinase-3, phosphorylation of human forkhead box protein O1, gluconeogenesis genes, cholesterol synthesis-related genes, fatty acid uptake-related genes, fatty acid synthesis-related genes, or fatty acid β-oxidation-related genes.

[0098] Preferably, the inhibitor of the PTP1B molecule inhibits the activity and / or expression of the PTP1B molecule, thereby promoting phosphorylation of insulin receptor β, protein kinase B, glycogen synthase kinase-3, and human forkhead box protein O1, and inhibiting the expression of gluconeogenesis genes, cholesterol synthesis-related genes, fatty acid synthesis-related genes, or fatty acid uptake-related genes.

[0099] Preferably, the inhibitor of the PTP1B molecule inhibits the activity of the PTP1B molecule and / or its expression, thereby enhancing the expression of fatty acid β-oxidation-related genes.

[0100] Preferably, the inhibitor lowers the levels of blood glucose, insulin, triglycerides, total cholesterol, free fatty acids, alkaline phosphatase, alanine aminotransferase, or aspartate aminotransferase.

[0101] Preferably, the modulating agent improves glucose tolerance, insulin tolerance, and / or insulin sensitivity.

[0102] A seventh aspect of the invention relates to a pharmaceutical composition comprising a modulator of a BACH1 molecule or a modulator of a PTP1B molecule.

[0103] Preferably, the BACH1 molecule includes the BACH1 protein, gene, and / or mRNA.

[0104] Preferably, the regulating agent is as defined in the fourth, fifth and / or sixth aspects.

[0105] Preferably, the regulatory agent is an inhibitor of the BACH1 molecule, which inhibits the activity and / or expression of the BACH1 molecule, or enhances or inhibits the activity and / or expression of BACH1-mediated insulin signaling pathway and / or glucose and lipid metabolism-related molecules.

[0106] Preferably, the inhibitor is as defined in the fourth and / or fifth aspects.

[0107] Preferably, the regulating agent of the PTP1B molecule is an inhibitor of the PTP1B molecule; more preferably, the inhibitor of the PTP1B molecule is as defined in the sixth aspect.

[0108] An eighth aspect of the invention relates to a method for preventing and / or treating insulin-related diseases, the method comprising administering to a diseased individual an effective amount of a modulatory agent of BACH1 or PTP1B molecules and / or the aforementioned pharmaceutical composition.

[0109] Preferably, the regulatory agent of the BACH1 or PTP1B molecule is as defined in the fourth, fifth and / or sixth aspects.

[0110] Preferably, the diseased individual includes a human or a non-human animal, such as a non-human mammal.

[0111] In any of the above, the insulin resistance-related diseases include, but are not limited to, obesity, diabetes, fatty liver, or cardiovascular and cerebrovascular diseases.

[0112] More preferably, the diabetes includes type 1 diabetes or type 2 diabetes.

[0113] More preferably, the fatty liver includes non-alcoholic fatty liver or alcoholic fatty liver.

[0114] The “cardiovascular and cerebrovascular diseases” described in this invention include, but are not limited to, pulmonary hypertension, arteriosclerosis, angina pectoris, myocardial infarction, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, cerebral thrombosis, cerebral arteritis, cerebral artery injury, cerebral aneurysm, intracranial vascular malformation, or cerebral arteriovenous fistula.

[0115] The "products" described in this invention include reagents for detecting biomarkers and / or reagents for inhibiting biomarkers. These include, but are not limited to, drugs, reagent kits, devices, etc.

[0116] The term "diagnosis" in this invention refers to determining whether a patient has had a disease or condition in the past, at the time of diagnosis, or in the future, or to determining the progression of a disease or its possible future progression.

[0117] The term "treatment" as used in this invention refers to slowing down, interrupting, preventing, controlling, stopping, reducing, mitigating, or reversing a sign, symptom, disorder, condition, or progression or severity of a disease after it has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0118] The term "effective amount" as used in this invention refers to the amount or dose of the medicament of this invention that provides the desired treatment or prevention after being administered to an individual or organ in one or more doses.

[0119] The terms “comprising” or “including” in this invention are open-ended descriptions that include the specified ingredients or steps described, as well as other specified ingredients or steps that do not materially affect them.

[0120] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0121] The "individual" mentioned in this invention can be a human or a non-human animal, and the non-human animal can be a non-human mammal such as a rat, cow, sheep, rabbit, pig, or monkey.

[0122] Beneficial technical effects of the present invention:

[0123] According to the technical solution provided by this invention, we have for the first time discovered that modified Bach1 genes can regulate insulin resistance, and for the first time elucidated how Bach1 genes regulate the insulin signaling pathway. Specifically, we revealed that BACH1 is a negative regulator of hepatic insulin signaling, playing a key role in regulating hepatic insulin sensitivity and glucose homeostasis. A high-fat diet can increase BACH1 expression in the liver. Elevated BACH1 promotes the binding of PTP1B to phosphorylated IR-β on the cell surface, inhibiting the hepatocyte insulin signaling pathway and exacerbating high-fat diet-induced insulin resistance. These findings indicate that inhibiting BACH1 plays an important role in improving insulin sensitivity and glucose tolerance, and BACH1 can serve as a novel target for the prevention and treatment of insulin resistance in various metabolic-related diseases such as diabetes.

[0124] The above only summarizes some aspects of the present invention and is not, and should not be considered as limiting the present invention in any way.

[0125] Unless otherwise specified, the practice of this invention will employ conventional techniques from cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology. These techniques are explained in detail in the following documents. For example:

[0126] 1. Molecular Cloning ALaboratory Manual, 2ndEd., ed.By Sambrook, Fritschand Maniatis (Cold Spring Harbor Laboratory Press: 1989);

[0127] 2. L. Jiang et al., Bach1 represses Wnt / beta-Catenin signaling and angiogenesis. Circ Res 117, 364-375 (2015);

[0128] 3. L. Jiang et al., The Transcription Factor Bach1 Suppresses theDevelopmental Angiogenesis of Zebrafish. Oxid Med Cell Longev 2017, 2143875(2017);

[0129] 4. Oligonucleotide Synthesis (MJGaited., 1984); O. Shalem et al., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014);

[0130] 5. S.Tu et al., Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature 534,387-390(2016).

[0131] All patents and publications mentioned in this specification are incorporated herein by reference in their entirety. Those skilled in the art will recognize that certain modifications may be made to this invention without departing from its spirit or scope. The following embodiments further illustrate the invention in detail and should not be construed as limiting the scope of the invention or the specific methods described herein. Attached Figure Description

[0132] Figure 1 (A) Expression of Bach1 mRNA in hepatocytes of lean and obese individuals from the RNA-seq sequencing database (GEO No.: GSE192742); (B) RT-qPCR detection and (C) WB detection in liver samples from NAFLD and non-NAFLD patients; (D) HE staining, PAS staining, and Bach1 immunohistochemical staining in liver samples from NAFLD and non-NAFLD patients; (E) Quantitative immunohistochemical analysis (n=6); (F) Bach1 mRNA expression in the livers of mice on HSD and CD diets from the RNA-seq sequencing database (GEO No.: GSE182365). mRNA expression; (G) RT-qPCR detection of BACH1 expression in the livers of CD-fed and HFD-fed mice (n=8); (H) WB detection of BACH1 expression in the livers of CD-fed and HFD-fed mice (n=5); (I) WB detection of BACH1 expression in the livers of ob / ob mice (n=4) and (J) db / db mice (n=3); (K) and (L) mouse primary hepatocytes were treated with 1 mM OA or 1 mM PA and BACH1 expression was detected by WB (n=3).

[0133] Figure 2 (A) Agarose gel electrophoresis image of mouse DNA identification, showing the PCR electrophoresis image of the Bach1 flox site; (B) Bach1 LKO (C) Flowchart of mouse modeling; WB technology validated the expression of BACH1 in myocardial (left), muscle (middle) and liver (right) samples; (D) Timeline of mouse insulin resistance modeling.

[0134] Figure 3 Bach1 infants fed with CD or HFD for 12 weeks LKO and Bach1 fl / fl (A) Liver weight (left) and liver weight / body weight ratio (right) in mice (n=8); (B) Fasting blood glucose level (left), fasting insulin level (middle), and HOMA-IR index (right); (C) GTT (left) and area under the curve (AUC) analysis used to quantify GTT results (right); (D) ITT (left) and AUC analysis used to quantify ITT results (right); (E) Bach1 mice fed with CD or HFD for 12 weeks. LKO and Bach1 fl / flPAS staining of mice was used to detect liver glycogen storage (n=8); (F) Mouse liver glycogen detection experiment (n=8); (G) RT-qPCR detection of mRNA expression of Pck1 and G6pc in mouse liver (n=6); (H) WB results, the left figure shows the phosphorylation level of insulin signaling pathway-related molecules (IR-β, AKT, FOXO1, GSK-3β) in mouse liver after 15 minutes of intraperitoneal injection of insulin after fasting overnight, and the right figure shows the gray value of phosphorylated protein / gray value of total protein (n=6).

[0135] Figure 4 Bach1 was fed (AC)CD or HFD for 12 weeks. LKO and Bach1 fl / fl Liver function in mice (n=8), including ALT (A), AST (B), and ALP levels (C); Bach1 mice fed (DF)CD or HFD for 12 weeks. LKO and Bach1 fl / fl Blood lipid levels in mice (n=8) were measured, including TC(D), TG(E), and NEFA(F); Bach1 mice fed (GH)CD or HFD for 12 weeks were also tested. LKO and Bach1 fl / fl Mouse liver tissue was stained with (G)HE and (H)Oil Red O (n=8); (IL)RT-qPCR was used to detect the expression levels of (I) fatty acid uptake, (J) cholesterol synthesis and efflux, (K) fatty acid synthesis, and (L) fatty acid β-oxidation-related genes (n=8).

[0136] Figure 5 (A) Agarose gel electrophoresis image of mouse DNA identification, with the horizontal line indicating the Bach1 Tg site; (B) Bach1 LTG (C) Flowchart of mouse modeling; WB technique to verify the expression of BACH1 in myocardial (left), muscle (middle) and liver (right) samples; (D) Timeline of HFD mouse modeling.

[0137] Figure 6 After 12 weeks of CD or HFD feeding, N TG and Bach1 LTG (A) Liver weight (left) and liver weight / body weight ratio (right) in mice (n=8); (B) Fasting blood glucose level (left), fasting insulin level (middle), and HOMA-IR index (right); (C) GTT (left) and AUC used to quantify GTT results (right); (D) ITT (left) and AUC used to quantify ITT results (right); (E) N after 12 weeks of CD or HFD feeding. TG and Bach1 LTGPAS staining of mice was used to detect liver glycogen storage (n=8); (F) Mouse liver glycogen detection experiment (n=8); (G) RT-qPCR detection of mRNA expression of Pck1 and G6pc in mouse liver (n=6); (H) WB results, where the left figure shows the phosphorylation level of insulin signaling pathway-related molecules (IR-β, AKT, FOXO1, GSK-3β) in mouse liver after 15 minutes of intraperitoneal injection of insulin after fasting overnight, and the right figure shows the gray value of phosphorylated protein / gray value of total protein (n=6).

[0138] Figure 7 (AC) Feeding CD or HFD for 12 weeks Bach1 LTG and N TG Liver function in mice (n=8), including ALT(A), AST(B), and ALP(C), was assessed in mice fed CD or HFD for 12 weeks. LTG and N TG Blood lipid levels in mice (n=8), including TC(D), TG(E), and NEFA(F), N (GH)CD, or HFD fed for 12 weeks. TG and Bach1 LTG Mouse liver tissue was stained with (G)HE and (H)Oil Red O (n=8), and (IL)RT-qPCR was used to detect the expression levels of genes related to (I) fatty acid uptake, (J) cholesterol synthesis and efflux, (K) fatty acid synthesis, and (L) fatty acid β oxidation in the livers of the four groups of mice.

[0139] Figure 8 (A) WB analysis, the left image shows the results from male Bach1 LKO Primary hepatocytes were isolated from mice and stimulated with insulin (100 nM) for 10 minutes. Phosphorylation levels of IR-β, AKT, FOXO1, and GSK-3β, as well as total protein levels, were then measured. The right figure shows the quantitative graph of phosphorylated protein / total protein (n=3) using grayscale analysis. (B) Western blotting analysis; the left figure shows the levels of IR-β, AKT, FOXO1, and GSK-3β phosphorylation and total protein levels from male Bach1 mice. LTG Primary hepatocytes were isolated from mice and stimulated with insulin (100 nM) for 10 minutes. The phosphorylation and total protein levels of IR-β, AKT, FOXO1 and GSK-3β were then measured. The right figure is a quantitative graph of phosphorylated protein / total protein grayscale analysis (n=3).

[0140] Figure 9(A) Western blot analysis: The left image shows the phosphorylation of key molecules in the insulin signaling pathway after HepG2 cells were infected with shCON or shBACH1 adenovirus for 48 hours and stimulated with insulin (100 nM) for 10 minutes. The right image shows the quantitative graph of phosphorylated protein / total protein (n=3). (B) Western blot analysis: The left image shows the phosphorylation of key molecules in the insulin signaling pathway after HepG2 cells were infected with AdBACH1 or AdGFP adenovirus for 48 hours and stimulated with insulin (100 nM) for 10 minutes. The right image shows the quantitative graph of phosphorylated protein / total protein (n=3).

[0141] Figure 10 (A) WB analysis, the left figure is towards Bach1 LKO Primary mouse hepatocytes were transfected with full-length BACH1, BACH1 plasmids lacking the Bzip domain, or BACH1 plasmids lacking the BTB domain for 48 hours. Cells were then stimulated with insulin (100 nM) for 10 minutes. Phosphorylation of key molecules in the insulin signaling pathway was detected. The right figure shows the quantitative graph of phosphorylated protein / total protein (n=3) using grayscale analysis. (B) Co-IP was used to verify the endogenous binding of BACH1 to IR-β, PTP1B, PTEN, and PP2A in primary mouse hepatocytes. Cell lysates were immunoprecipitated with IgG or BACH1. (C) Western blotting was used to detect the protein levels of IR-β, PTP1B, PTEN, PP2A, and BACH1; (D) Western blotting was used to detect the PTP1B protein level in HepG2 cells infected with AdBACH1 or AdGFP adenovirus for 48 hours; (E) Immunofluorescence staining was used to detect BACH1-GFP (green), IR-β-cherry (red), and PTP1B-D181A-BFP (purple) in HepG2 cells, and the cell nuclei were stained with DAPI (blue), scale bar = 20 μm; (F) GST-pull In the down assay, HEK293T cells expressing IR-β-GFP(E) or PTP1B-HA(F) protein were co-incubated with GST-labeled BACH1 protein (GST-BACH1), and the binding of PTP1B-HA and GST-BACH1 or IR-β-GFP and GST-BACH1 was detected by Western blotting. In the (GH)Co-IP assay, HEK293T cells were transfected with two vectors: one encoding PTP1B-HA(G) or IR-β-GFP(H), and the other encoding FLAG-BACH1 or FLAG-BACH1. ΔBTB BACH1 was immunoprecipitated with FLAG antibody, and PTP1B in the precipitate was detected with (G) anti-HA antibody, while IR-β in the precipitate was detected with (H) GFP antibody.

[0142] Figure 11(A) The image above shows Co-IP detection of male Bach1 mice fed with HFD. LKO and Bach1 fl / fl The interaction between IR-β and PTP1B in mouse liver lysate was investigated. Mouse liver lysate was immunoprecipitated with PTP1B antibody, and Western blot analysis was performed using IR-β antibody. The following figure shows a bar chart of quantitative analysis of IR-β protein levels (n=6). (B) Primary hepatocytes were transfected with empty vector plasmid or BACH1-GFP plasmid (green), PTP1B-D181A-BFP plasmid (purple), or IR-β-cherry plasmid (red) for 48 hours. Cells were then treated with 100 nM insulin for 10 minutes. Immunofluorescence staining was used to detect the expression of PTP1B-D181A, IR-β-cherry, and BACH1-GFP. Cell nuclei were stained with DAPI (blue). (C) Western blot analysis: The left figure shows primary mouse hepatocytes infected with AdBACH1 or AdGFP adenovirus and transfected with control siRNA or PTP1B-siRNAs. Forty-eight hours later, the patients were treated with 100 nM insulin for 10 minutes. Western blotting was used to detect the phosphorylation and total protein levels of IR-β, AKT, GSK-3β and FOXO1. The right figure is a grayscale analysis of phosphorylated protein / total protein (n=3).

[0143] Figure 12 : Give N TG and Bach1 LTG Mice were injected intravenously with AAV8-TBG-GFP or AAV-shPtpn1 and then fed with HFD for 12 weeks (n=8). The following data were then collected: (A) Liver weight (left) and liver weight / body weight ratio (right); (B) Fasting blood glucose level (left), fasting insulin level (middle), and HOMA-IR index (right); (C) GTT (left) and AUC used to quantify GTT results (right); (D) ITT (left) and AUC used to quantify ITT results (right); (E) PAS staining of mice to detect liver glycogen storage; (F) Liver glycogen content of mice (n=8); (G) Western blot analysis. The left image shows the phosphorylation level of insulin signaling pathway-related molecules (IR-β, AKT, FOXO1, GSK-3β) in the liver of mice 15 minutes after intraperitoneal injection following overnight fasting. The right image shows the gray value of phosphorylated protein / gray value of total protein (n=6).

[0144] Figure 13 (AC) gives N TG and Bach1 LTGMice were injected intravenously with AAV8-TBG-GFP or AAV-shPtpn1 and then fed with HFD for 12 weeks (n=8). Liver function of the mice was then measured, including serum ALT (A), AST (B), and ALP (C); (DF) blood lipids of the four groups of mice were measured as described above, including TC (D), TG (E), and NEFA (F); (G) HE staining images of mouse livers; (H) Oil Red O staining images of mouse livers.

[0145] Figure 14 Four-week-old db / db mice fed with CD were injected via tail vein with either AAV8-TBG-GFP or AAV-shBach1 (n=8). At 8 weeks of age, (A) fasting blood glucose was measured; (B) GTT (left), with AUC (right) used to quantify the GTT results, the left column representing db / db results and the right column representing db / db+AVV-shBach1; (C) ITT (left), with AUC (right) used to quantify the ITT results, the left column representing db / db results and the right column representing db / db+AVV-shBach1. (A) ach1; (D) GIR; (E) HGP; (F) HGP inhibition; (G) Hepatocyte glycogen content; (H) RT-qPCR detection of Pck1 and G6pc mRNA expression in mouse liver (n=6); (I) WB results, the left figure shows the phosphorylation level of insulin signaling pathway-related molecules (IR-β, AKT, FOXO1, GSK-3β) in mouse liver after 15 minutes of intraperitoneal injection of insulin after fasting overnight, and the right figure shows the gray value of phosphorylated protein / gray value of total protein (n=6). Detailed Implementation

[0146] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0147] In each of the following embodiments, the main equipment and materials are obtained from the following companies:

[0148] 1. Experimental Materials

[0149] 1.1 Experimental animals: Bach1 in this experiment flox / flox Mice and Bach1 TG All mice were obtained from the Nanjing Institute of Biomedical Research, Nanjing University. Liver tissues from wild-type (WT) and leptin mutant (ob / ob) mice were obtained from the laboratory of Pan Dongning, School of Basic Medical Sciences, Fudan University.

[0150] 1.2 Experimental Apparatus:

[0151] NanoDrop2000 (THERMO FISHER, USA); Transfer kit, Real-time quantitative PCR instrument (BIO-RAD); Multifunctional microplate reader (Bio Tek Instruments, USA); Gel image processing system, Constant current and constant voltage electrophoresis system (Tanon); Leica IM50 image acquisition system, Leica Dmi8 fluorescence microscope (Leica).

[0152] 1.3 Antibodies

[0153] Phospho-IR-β (Tyr1345), IR-β (4B8), Phospho-AKT (Ser473), AKT, Phospho-GSK-3β, Phospho-FOXO1 (Thr24), β-ACTIN, and GFP were all from Cell Signaling Technology; GSK-3β, FOXO1, goat anti-rabbit secondary antibody (HRP-labeled), goat anti-mouse secondary antibody (HRP-labeled), and rabbit anti-goat secondary antibody (HRP-labeled) were all from Proteintech; BACH1 was from Santa Cruz; HA was from Santa Cruz; and FLAG was from Sigma.

[0154] 1.4 Primers used for q-PCR

[0155] β-Actin-F(mouse)GGCTGTATTCCCCTCCATCG(SEQ ID NO: 1) Genscript Biotech Co., Ltd.

[0156] β-Actin-R (mouse)CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 2) Genscript Biotech Inc.

[0157] Bach1-F(mouse)TGTGATTAGCCTGGGAGA(SEQ ID NO: 3) Genscript Biotech Inc.

[0158] Bach1-R (mouse)CGATTTCCGACTCAAGGT (SEQ ID NO: 4) Genscript Biotech Inc.

[0159] Bach1-F(human)AGCAGTCTTATGGAACCAACTC(SEQ ID NO: 5) Genscript Biotech Inc.

[0160] Bach1-F(human)CGTTCCTTGGAAGATCTGTGAT(SEQ ID NO: 6) Genscript Biotech Inc.

[0161] Pck1-F(mouse)CTGCATAACGGTCTGGACTT(SEQ ID NO: 7) Genscript Biotech Co., Ltd. Pck1-R(mouse)CAGCAACTGCCCGTACTCC(SEQ ID NO: 8) Genscript Biotech Co., Ltd.

[0162] G6pc-F(mouse)CGACTCGCTATCTCCAAGTGA(SEQ ID NO: 9) Genscript Biotech Co., Ltd. G6pc-R(mouse)GGGCGTTGTCCAAACAGAAT(SEQ ID NO: 10) Genscript Biotech Co., Ltd.

[0163] 1.5 shRNA and siRNA sequences

[0164] Scramble UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 11)

[0165] BACH1-shRNA1 CCGCA GGUAU CAAGG AAUTT (SEQ ID NO: 12)

[0166] BACH1-shRNA2 GUCAGGAUUUACCUUUGAATT (SEQ ID NO: 13)

[0167] BACH1-shRNA3 CCAGGUCAAAGGACUUUCATT (SEQ ID NO: 14)

[0168] BACH1-shRNA4 GCGUACACAAUAUCGAGGATT (SEQ ID NO: 15)

[0169] PTP1B-siRNA1 CCAGGAAGAUAAUGACUAUTT (SEQ ID NO: 16)

[0170] PTP1B-siRNA2 CCGUGGACAUCAAGAAAGUTT (SEQ ID NO: 17)

[0171] PTP1B-siRNA3 CCAGGACAUUCGACAUGAATT (SEQ ID NO: 18)

[0172] 2 Experimental Methods

[0173] 2.1 Acquisition of liver samples from patients with non-alcoholic fatty liver disease and normal liver samples

[0174] The human tissue samples used in this application were obtained from Zhongshan Hospital affiliated with Fudan University and approved by the Ethics Committee of Shanghai Medical College of Fudan University (Approval No.: 2016-002). Liver specimens from patients with non-alcoholic fatty liver disease (n=6) were obtained from patients who underwent liver transplantation or liver biopsy. Normal liver tissue (n=6) was obtained from donors who were unsuitable for liver transplantation for non-hepatic reasons. All subjects signed informed consent forms.

[0175] 2.2 Glucose tolerance test (GTT)

[0176] 1) Fast the mice for 8-12 hours at night, but allow them free access to water. Start the experiment between 8 and 9 a.m.

[0177] 2) Prepare an experimental record book and label each mouse with its number;

[0178] 3) Weigh each mouse and calculate the amount of glucose to be injected based on its weight: the injection volume is 2g glucose / kg. Prepare a 30% glucose solution, then the injection volume per mouse is: weight (g) × 6.67;

[0179] 4) Use a pipette to accurately pipette the calculated volume of glucose into a 1.5ml centrifuge tube, and then use an insulin injection to draw up the glucose.

[0180] 5) Measure fasting blood glucose in mice (t=0min): Gently wipe the mouse tail with an alcohol swab, prick the tip of the mouse tail with a sterile needle, gently stroke the mouse tail a few times to let blood seep out from the tip of the tail, let the blood flow into the blood glucose meter test strip, and record the reading at this time.

[0181] 6) Inject glucose: Wipe the mouse's abdominal cavity with an alcohol swab, inject 30% glucose solution with an insulin needle, and immediately press the timer;

[0182] 7) Measure the blood glucose level of mice at 15 min, 30 min, 60 min and 120 min after injection, respectively, according to the method in step 5.

[0183] 2.3 Insulin tolerance test (ITT)

[0184] 1) Fast the mice for 6 hours starting at 8:00 AM until 2:00 PM, while maintaining normal water intake during the fasting period;

[0185] 2) Gently prick the tip of the mouse's tail with a sterile needle and gently stroke the tail to make a drop of blood flow from the tip of the tail. Drop the blood onto the blood glucose test strip and read the blood glucose value with a blood glucose meter as the blood glucose value at 0 min.

[0186] 3) Weigh each mouse and calculate the insulin dosage based on its weight. The injection dosage for each mouse is 1 U / kg. Draw up the insulin with an insulin needle and inject it into the mouse via the peritoneal cavity, and start timing immediately.

[0187] 4) Measure the blood glucose levels of mice at 15 min, 30 min, 60 min, 90 min, and 120 min, and record them in the corresponding experimental record book;

[0188] 5) Feed the mice promptly after the experiment.

[0189] 2.4 Quantitative detection of liver glycogen in this application

[0190] Follow the instructions for the Nanjing Jiancheng reagent kit.

[0191] The formula for calculating tissue samples is as follows:

[0192]

[0193] m 标准 : Standard tube sugar content, 0.01 mg; N: Dilution factor of the sample before testing, liver is generally 100 times.

[0194] 2.5 Other determination methods

[0195] The aspartate aminotransferase (AST / GOT), free fatty acid (NEFA), triglyceride (TG), and cholesterol (TC) measurements were all performed using the microplate method.

[0196] The alkaline phosphatase (ALP) assay was performed using a microenzyme labeling method.

[0197] Alanine aminotransferase (ALT / GPT) is measured using a test kit.

[0198] Example 1: Expression of BACH1 in the livers of obese individuals, NAFLD patients, and obese mice.

[0199] To clarify the role of BACH1 in metabolic disorders, we first analyzed RNA-seq data from the GEO database (GEO no. GSE192742). The results showed that BACH1 mRNA expression was significantly increased in hepatocytes of obese individuals. Figure 1A). We further detected the expression of BACH1 in liver samples from NAFLD (non-alcoholic fatty liver disease) patients using qRT-PCR and Western blotting, and found that BACH1 mRNA in the livers of NAFLD patients ( Figure 1 B) and protein ( Figure 1 C) Expression of all three groups increased significantly, among which Figure 1 The specific details of B are shown in Table 1.

[0200] We then performed PAS and HE staining on the livers of NAFLD patients to detect glycogen content and hepatocyte morphology, and used immunohistochemical staining to detect BACH1 expression levels. The results showed that the livers of NAFLD patients exhibited significant steatosis, increased lipid accumulation, decreased glycogen storage, and significantly increased BACH1 expression. Figure 1 D and 1E), where Figure 1 The specific details of E are shown in Table 2.

[0201] Next, we analyzed single-cell transcriptome sequencing data (GEO accession no. GSE182365) of the livers of mice fed a normal diet (Chow diet, CD) and a high-sucrose diet (HSD). The results showed that the transcriptional level of Bach1 was significantly increased in the livers of HSD-fed mice. Figure 1 F). The expression level of BACH1 in the liver tissue of HFD-induced obese mice and ob / ob mice was then examined. The results showed that mice fed HFD for 12 weeks exhibited a significantly hyperglycemic phenotype compared to mice on a normal diet. Figure 3 B), and the mRNA of BACH1 in the mouse liver ( Figure 1 G) and protein ( Figure 1 H) levels were significantly elevated, among which Figure 1 The specific details of G are shown in Table 3. Similarly, ob / ob mice and db / db mice ( Figure 1 The expression level of BACH1 protein in the livers of I and 1J mice was also significantly higher than that in WT mice. Inducing a cellular insulin resistance model by stimulating mouse primary hepatocytes with PA (palmitic acid) (1 mM) or OA (oleic acid) (1 mM) for 12 hours also showed that BACH1 expression was significantly increased in PA- or OA-treated primary hepatocytes. Figure 1 These experimental data indicate that BACH1 is closely related to insulin resistance, but its specific role and mechanism require further investigation.

[0202] Significant changes in BACH1 expression were detected in all insulin resistance models, demonstrating a statistically significant correlation between BACH1 and insulin resistance. Further PA and OA experiments, simulating states that may exacerbate or progress towards insulin resistance, also confirmed the corresponding changes in BACH1 expression. Therefore, BACH1 can serve as a biomarker; detecting BACH1 expression levels or changes in expression can help determine whether insulin resistance has developed and identify disease states.

[0203]

[0204] Table 3 Figure 1 G raw data

[0205]

[0206] Example 2: Preparation and Study of a Hepatocyte-Specific Bach1 Knockout Model

[0207] Under physiological conditions, insulin regulates hepatic glucose and lipid metabolism homeostasis. Postprandial insulin levels in the liver rise. Insulin specifically binds to the α subunit of the insulin receptor (IR) on the cell membrane surface, causing autophosphorylation of tyrosine residues in the β subunit (IR-β), thereby activating receptor tyrosine kinase activity and further phosphorylating insulin receptor substrates (IRS). The activated IRS binds to the regulatory subunit p85 of phosphatidylinositol-3 kinase (PI3K), leading to PI3K activation. This, in turn, activates the protein kinase B (PKB, also known as AKT) pathway to control cell growth, glucose and lipid metabolism, and survival. In the liver, the insulin signaling pathway transmitted by AKT is crucial for stimulating lipid synthesis and inhibiting hepatic glucose production. FOXO1 is also an important downstream target of the insulin signaling pathway, which can regulate the expression of key enzymes inducing gluconeogenesis, glucose-6-phosphatase (G6Pase, G6PC) and phosphoenolpyruvate carboxykinase (PEPCK), thereby promoting gluconeogenesis. The insulin signaling pathway inhibits gluconeogenesis in hepatocytes through AKT-mediated phosphorylation of human forkhead box O1 (FOXO1); furthermore, insulin activation of AKT can also phosphorylate and inactivate glycogen synthase kinase-3β (GSK-3β), thereby reducing glycogen synthase phosphorylation and promoting glycogen synthesis. Examples 2-4 will further explore how BACH1 affects insulin signaling regulation using Bach1-specific knockout and overexpression models.

[0208] 1. Constructing hepatocyte-specific Bach1 gene knockout mice (Bach1 LKO )

[0209] We commissioned Nanjing Jicui Pharmaceutical Co., Ltd. to construct Bach1 flox heterozygous mice using homologous recombinant embryo targeting technology. The flox sites are located flanking exons 3 and 4 of Bach1. Later, we bred and mated mice ourselves at the Animal Department of Fudan University. We then crossed the heterozygous Bach1 flox mice to obtain Bach1... fl ox / flo x Homozygous mice were used, and Bach1 was identified using PCR technology. fl ox / flo x homozygous mouse genotype ( Figure 2A). We purchased AAV8-TBG-Cre virus with a hepatocyte-specific promoter from Hanheng Biotechnology (Shanghai) Co., Ltd., and used 1×10⁶ of sterile PBS to... 11 The virus was diluted to 100 μl and injected into mice via the tail vein to obtain hepatocyte-specific knockout of the Bach1 gene (Bach1). LKO ) mice ( Figure 2 B), while mice injected with the control virus served as the control group (Bach1). fl / fl We validated the knockdown efficiency of BACH1 in cardiac, muscle, and liver using Western blotting (WB). Figure 2 C), the results show Bach1 LKO BACH1 is almost not expressed in the liver of mice. Subsequently, we established a high-fat diet-induced insulin resistance mouse model by feeding mice with high-fat diets (HFD) for 12 weeks (20% protein, 60% fat, and 20% carbohydrates). Figure 2 D).

[0210] 2. Hepatocyte-specific knockout of Bach1 can improve HFD-induced insulin resistance.

[0211] We started giving male Bach1 at 10 weeks of age. LKO Mice and control group Bach1 fl / fl Mice were fed either a high-fat diet (HFD) or a chow diet (CD) for 12 weeks. Results showed that the Bach1 mice in the HFD-fed group... LKO Liver weight and liver weight / body weight ratio in mice Figure 3 A) Compared to HFD Bach1 fl / fl The group showed a significant decrease, among which Figure 3 The specific details of A are shown in Table 4-5. To further clarify whether Bach1 affects insulin resistance, we tested Bach1. LKO Mice and Bach1 fl / fl Multiple indicators, including insulin sensitivity and glucose tolerance, were studied in mice. Results showed that under CD feeding conditions, Bach1... fl / fl Mice and Bach1 LKO There were no significant differences in fasting blood glucose and fasting insulin levels in mice; however, after 12 weeks of HFD, Bach1... LKO Fasting blood glucose levels, fasting insulin levels, and the Homeostasis Model Assessment-Insulin Resistance (HOMA-IR) index in mice were measured. Figure 3 B) Significantly reduced, of which Figure 3The specific details of B are shown in Table 6-8. Glucose tolerance test (GTT) Figure 3 C) and the insulin tolerance test (ITT) Figure 3 D) shows that under HFD dietary conditions, Bach1 LKO The mice exhibited higher glucose tolerance and better insulin sensitivity, among which Figure 3 The specific details of C are shown in Tables 9 and 11-14. Figure 3 The specific details of D are shown in Tables 10 and 15-18. This suggests that hepatocyte-specific knockout of Bach1 can improve HFD-induced insulin resistance. Under insulin resistance, the liver's ability to store glycogen and the inhibitory effect of insulin on hepatic gluconeogenesis are reduced. PAS staining ( Figure 3 E) and hepatocyte glycogen content analysis ( Figure 3 F) shows that, compared with the control group, HFD-fed Bach1 mice... LKO The glycogen storage capacity of mice was significantly improved, among which Figure 3 The specific details of F are shown in Table 19. Consistent with glycogen changes, and with HFD Bach1 fl / fl Compared to mice, Bach1 LKO The mRNA levels of the gluconeogenesis genes phosphoenolpyruvate carboxykinase 1 (Pck1) and glucose-6-phosphatase catalytic subunit (G6pc) were significantly reduced in mouse liver. Figure 3 G), where Figure 3 The specific details of G are shown in Table 20. Furthermore, after insulin stimulation, Bach1... LKO The phosphorylation levels of IR-β, AKT, GSK-3β, and FOXO1 in mouse liver tissue were significantly higher than those of Bach1. fl / fl Control group mice. This indicates that hepatocyte-specific knockout of Bach1 significantly improves insulin resistance in HFD-induced obese mice. Figure 3 H).

[0212]

[0213]

[0214] 3. Hepatocyte-specific knockout of Bach1 can improve liver function and hepatic steatosis.

[0215] Obese individuals often experience excessive lipid deposition in the liver due to long-term excessive energy intake, and insulin resistance further promotes this phenomenon. Considering the close relationship between obesity, insulin resistance, and metabolic liver dysfunction, we further investigated the role of BACH1 in HFD-induced hepatic steatosis and liver dysfunction. By detecting liver function-related indicators AST, ALT, and ALP in mouse serum, we found that BACH1 levels correlated with HFD-fed hepatic steatosis and liver dysfunction. fl / fl Compared to mice, HFD Bach1 LKO The liver function of the mice was significantly improved. Figure 4 A-4C), among which Figure 4 The specific details of A-4C are shown in Tables 21-23. Compared with the HFD control group mice, hepatocyte-specific knockout of Bach1 significantly reduced serum TG, TC, and NEFA levels. Figure 4 D-4F), where Figure 4 The specific details of D-4F are shown in Tables 24-26. HE and Oil Red O staining results of liver sections showed that, compared with the control group, Bach1 livers fed with HFD showed... LKO The severity of steatosis in the liver of mice was reduced. Figure 4 In addition, we used RT-qPCR to detect the expression of liver lipid metabolism-related genes, and the results showed that HFD Bach1 LKO In mouse liver, the expression of genes related to cholesterol synthesis (Srebp1, Hmgcr, Abcg1, Cyp7a1), fatty acid uptake (FATP1, FABP1, CD36), and fatty acid synthesis (Fasn, Scd1, Acaca, Acacb) was downregulated. Figure 4 I-4K upregulates the expression of genes associated with fatty acid β-oxidation (Pdk4, Ppara, Cpt1a, Acox1, LCAD, MCAD). Figure 4 L), where Figure 4 The specific details of I-4L are shown in Tables 27-30. These data indicate that hepatic Bach1 deficiency can improve HFD-induced liver dysfunction and hepatic steatosis.

[0216]

[0217] Example 3: Preparation and Study of a Hepatocyte-Specific Bach1 Overexpression Model

[0218] 1. Construction of hepatocyte-specific Bach1 overexpression mice (Bach1 LTG )

[0219] We commissioned Nanjing Jicui Pharmaceutical Co., Ltd. to construct Bach1 flox-overexpressing transgenic mice (loxP-Bach1 transgenic mice, Bach1) using homologous recombinant embryo targeting technology. TG Later, we bred and mated mice ourselves at the Animal Department of Fudan University, and used PCR technology to identify Bach1. TG mouse genotype ( Figure 5 A). Then we purchased AAV8-TBG-Cre virus with a hepatocyte-specific promoter from Hanheng Biotechnology (Shanghai) Co., Ltd., and administered 1×10⁻⁶ 11 The virus was diluted to 100 μl with sterile PBS and injected into mice via the tail vein to obtain mice with hepatocyte-specific overexpression of the Bach1 gene (Bach1). LTG ()( Figure 5 B), while mice injected with the control virus served as the control group (N). TG We used Western blotting (WB) to verify the overexpression efficiency of BACH1 in cardiomyocytes, muscle cells, and liver. The results showed that BACH1 was specifically and highly expressed in hepatocytes. Because the BACH1 overexpressing virus carries a GFP tag, the molecular weight of the exogenously overexpressed BACH1 protein was increased. Figure 5 C). Subsequently, we established a mouse model of insulin resistance by feeding mice a high-fat diet for 12 weeks. Figure 5 D).

[0220] 2. Hepatocyte-specific overexpression of BACH1 can exacerbate HFD-induced insulin resistance.

[0221] Starting from 10 weeks of age, we give males N TG and Bach1 LTG Mice were fed HFD or CD for 12 weeks. Results showed that compared to HFDN... TG Compared to the control group, the HFD-fed Bach1 mice LTG The liver weight and liver weight / body weight ratio of mice were significantly increased. Figure 6 A), where Figure 6 The specific details of A are shown in Tables 31-32. To further investigate the effect of BACH1 on insulin resistance, we tested several indicators, including insulin sensitivity and glucose tolerance in mice. The results showed that after 12 weeks of HFD feeding, Bach1... LTG Fasting blood glucose, fasting insulin levels, and HOMA-IR index were significantly elevated in mice. Figure 6 B), where Figure 6 The specific details of B are shown in Table 33-35. Under CD feeding conditions, Bach1... LTG Mice and control group N TGIn comparison, there were no significant differences among the above indicators. GTT ( Figure 6 C) and ITT( Figure 6 D) Experimental results show that under HFD dietary conditions, Bach1 LTG The mice exhibited phenotypes of impaired glucose tolerance and decreased insulin sensitivity, among which Figure 6 The specific details of C-6D are shown in Table 36-45. PAS staining ( Figure 6 E) and hepatocyte glycogen content analysis ( Figure 6 F) shows that, with HFD N TG Compared to mice fed with HFD, Bach1 mice... LTG Mice showed a significant decrease in glycogen storage capacity and a significant increase in the mRNA levels of gluconeogenesis genes Pck1 and G6pc in the liver. Figure 6 G), where Figure 6 The specific details of F-6G are shown in Tables 46-47. Furthermore, after insulin stimulation, Bach1 fed with HFD... LTG The phosphorylation levels of IR-β, AKT, GSK-3β, and FOXO1 in mouse liver tissue were significantly lower than those in HFD N. TG This indicates that overexpression of Bach1 in hepatocytes inhibits the insulin signaling pathway in the liver of HFD mice. Figure 6 H).

[0222]

[0223] 3. Hepatocyte-specific overexpression of Bach1 can exacerbate HFD-induced liver dysfunction and hepatic steatosis.

[0224] By detecting liver function-related indicators AST, ALT, and ALP in mouse serum, we found that N was related to HFD-fed mice. TG Compared to mice, HFD Bach1 LTG The liver function indicators in mice showed a trend toward more severe impairment. Figure 7 A-7C), among which Figure 7 The specific details of A-7C are shown in Tables 48-50. Furthermore, regarding HFD N... TG Compared with mice, hepatocyte-specific overexpression of Bach1 tended to increase serum TG, TC and NEFA levels. Figure 7 D-7F), among which Figure 7 The specific details of D-7F are shown in Tables 51-53. HE and Oil Red O staining results of liver sections showed that, compared with the control group, Bach1 livers fed with HFD showed... LTG The steatosis of the liver in mice was significantly aggravated. Figure 7In addition, we used RT-qPCR to detect the expression of liver lipid metabolism-related genes, and the results showed that HFD Bach1 LTG In mouse liver, the expression of genes related to cholesterol efflux (Srebp1, Hmgcr, Abcg1, Cyp7a1), fatty acid uptake (FATP1, FABP1, CD36), and fatty acid synthesis (Fasn, Scd1, Acaca, Acacb) was upregulated. Figure 7 I-7K) showed no significant changes in the expression of genes related to fatty acid β-oxidation (Pdk4, Acox1, LCAD, MCAD, UCP2). Figure 7 L), where Figure 7 The specific details of I-7J are shown in Tables 54-57. These data indicate that hepatocyte-specific overexpression of Bach1 can, to some extent, exacerbate HFD-induced liver dysfunction and hepatic steatosis.

[0225]

[0226] Example 4: Regulation of the insulin signaling pathway by BACH1 in hepatocytes

[0227] 1BACH1 negatively regulates the insulin signaling pathway in primary mouse hepatocytes.

[0228] To further clarify Bach1 LKO The specific mechanism by which insulin sensitivity in mice is improved is derived from Bach1. LKO Mice and Bach1 fl / fl Primary hepatocytes were isolated from mice and stimulated with insulin (100 nM) for 10 min. The results showed that Bach1 knockout promoted an increase in the phosphorylation levels of IR-β, AKT, GSK-3β, and FOXO1 in primary hepatocytes after insulin stimulation. Figure 8 A). And in Bach1 LTG Primary hepatocytes isolated from mice ( Figure 8 In B), the opposite results were observed: overexpression of BACH1 inhibited the phosphorylation of IR-β, AKT, GSK-3β, and FOXO1 after insulin stimulation. These results indicate that BACH1 can negatively regulate the insulin signaling pathway in primary mouse hepatocytes.

[0229] 2BACH1 negatively regulates the insulin signaling pathway in HepG2.

[0230] We further examined the role of BACH1 in the insulin signaling pathway in HepG2 cells. The results showed that knocking down BACH1 with the adenovirus-mediated interference vector (shBACH1) significantly promoted phosphorylation of the insulin signaling pathway after insulin stimulation. Figure 9 A). However, the opposite result was observed in HepG2 cells induced by BACH1 adenovirus vector overexpression (AdBACH1): BACH1 overexpression inhibited the phosphorylation of IR-β, AKT, GSK-3β, and FOXO1 in HepG2 hepatocytes after insulin stimulation. Figure 9 B). These results further indicate that BACH1 can negatively regulate the insulin signaling pathway in hepatocytes.

[0231] Example 5: Mechanism of BACH1 regulating the insulin signaling pathway

[0232] PTP1B, a negative regulator of insulin signaling, is widely expressed in various tissues, including the liver, skeletal muscle, adipose tissue, and brain, playing a crucial role in insulin resistance. Studies have shown that abnormal PTP1B expression is closely related to diabetes and insulin resistance, and upregulation of PTP1B expression in the liver leads to impaired insulin signaling pathways. Examples 5-6 will further explore the relationship between BACH1 and the insulin signaling pathway, focusing on PTP1B.

[0233] 1BACH1 regulates the insulin signaling pathway through its BTB domain.

[0234] The N-terminus of BACH1 contains a BTB / POZ domain that interacts with other proteins, while the C-terminus contains a Bzip domain responsible for DNA binding and regulating gene transcription. To determine which domain BACH1 regulates the insulin signaling pathway, we overexpressed full-length BACH1, BACH1 lacking the BTB domain, and BACH1 lacking the Bzip domain in primary hepatocytes with BACH1 knockout, and examined the phosphate activation levels of the insulin signaling pathway. We found that insulin stimulation causes Bach1 to... LKO Phosphorylation levels of IR-β, AKT, GSK-3β, and FOXO1 were significantly increased in primary hepatocytes, while full-length BACH1 labeled with HA (BACH1-HA) and BACH1 lacking the Bzip domain were significantly inhibited (BACH1... ΔBzip -HA), but not suppressed by BACH1 lacking the N-terminal BTB domain (BACH1 ΔBTB -HA)( Figure 10 A). These results suggest that BACH1's regulation of the insulin signaling pathway may not depend on its Bzip domain, and that the BTB domain of BACH1 is essential for regulating insulin signaling.

[0235] 2BACH1 interacts with PTP1B and IR-β in hepatocytes.

[0236] Given the role of BACH1 in regulating IR-β phosphorylation, we aimed to further clarify whether BACH1 directly regulates IR-β phosphorylation or regulates it by recruiting negative regulators (such as phospholipases). After reviewing the literature, we found that phospholipase PTP1B (dephosphorylating IR-β and IRS), serine / threonine protein phosphatase 2A (PP2A) (dephosphorylating AKT and PI3K), and PTEN (dephosphorylating phosphatidylinositol 3,4,5-triphosphate) are important negative regulators of insulin signaling. Therefore, we used a Co-IP (immunoprecipitation) assay to detect the binding of BACH1 to these three enzymes. The results showed that BACH1 interacts with IR-β and PTP1B, but does not bind to PTEN and PP2A. Figure 10 B). Furthermore, overexpression of BACH1 in hepatocytes had no significant effect on the protein expression of IR-β and PTP1B. Figure 8 B and Figure 10 C), suggesting that BACH1 does not regulate the protein expression of IR-β and PTP1B. Next, we constructed a substrate-binding mutant of PTP1B (PTP1B-D181A). PTP1B-D181A retained the ability to bind to IR-β but could not dephosphorylate its substrate. We co-transfected HepG2 cells with BACH1-GFP, PTP1B-D181A-BFP, and IR-β-cherry. Immunofluorescence staining showed that these three proteins were mainly co-localized around the nucleus. Figure 10 D). Consistent with this, GST-pulldown experiments also showed that GST-labeled BACH1 and IR-β-GFP ( Figure 10 E) and PTP1B-HA ( Figure 10 F) all have direct interactions.

[0237] 3BACH1 interacts with PTP1B and IR-β through the BTB domain.

[0238] We aimed to further clarify the specific domains by which BACH1 binds to PTP1B and IR-β, so we performed Co-IP experiments in HEK293T cells. We transfected HEK293T cells with two vectors: one encoding PTP1B-HA or IR-β-GFP, and the other encoding either the complete BACH1 sequence (FLAG-BACH1) or a BACH1 deletion sequence lacking the BTB domain (FLAG-BACH1). ΔBTB The results showed that PTP1B bound to the intact BACH1 sequence, but not to the BACH1 plasmid. ΔBTB Combining ( Figure 10G). Similarly, IR-β also interacts with the intact BACH1 sequence, but not with BACH1. ΔBTB Combining ( Figure 10 We conclude that BACH1 interacts directly with PTP1B and IR-β, and this interaction is mediated by the BTB domain at the N-terminus of BACH1.

[0239] 4BACH1 promotes the interaction between PTP1B and IR-β.

[0240] To clarify whether BACH1 affects the interaction between IR-β and PTP1B, we fed Bach1 with HFD. fl / fl Mice and Bach1 LKO A Co-IP assay was performed on mouse livers to examine the interaction between IR-β and PTP1B in liver tissue before and after insulin stimulation. The results showed that insulin stimulation promoted the formation of the PTP1B-IR-β complex, while Bach1... LKO The PTP1B-IR-β complex was significantly reduced in mouse liver. Figure 11 A). This indicates that the absence of BACH1 inhibits the binding of IR-β and PTP1B upon insulin stimulation. Consistent with these results, immunofluorescence results in HepG2 cells showed that BACH1 promotes the perinuclear accumulation of IR-β upon insulin stimulation and increases the perinuclear interaction between PTP1B-D181A and IR-β. Figure 11 B).

[0241] 5. Knocking down or inhibiting PTP1B partially improves the inhibitory effect of BACH1 on the insulin signaling pathway.

[0242] We aimed to further clarify whether PTP1B is involved in the regulation of insulin sensitivity by BACH1. Therefore, we treated mouse primary hepatocytes with siRNA targeting and knocking down PTP1B (si-PTP1B). The results showed that BACH1 overexpression significantly inhibited insulin-stimulated phosphorylation of IR-β, AKT, GSK-3β, and FOXO1, and this inhibition could be partially mitigated by si-PTP1B. Figure 11 C).

[0243] Example 6: Effect of hepatocyte-specific knockdown of PTP1B on BACH1

[0244] 1. Hepatocyte-specific knockdown of PTP1B can partially improve the BACH1-induced impairment of insulin sensitivity and glucose tolerance in HFD mice.

[0245] To confirm the role of PTP1B in BACH1-mediated insulin resistance in mice, we commissioned Hanheng Technology to construct an AAV virus (AAV-shPtpn1) that specifically knocks down PTP1B in hepatocytes. We then used Bach1... LTG Mouse or N TG Mice were injected intravenously with AAV-shPtpn1 virus or control virus AAV8-TBG-GFP at 8 weeks of age, and then fed HFD for 12 weeks starting at 10 weeks of age. Western blot results showed that PTP1B was significantly knocked down by AAV-shPtpn1 in mouse liver. Figure 12 G). Furthermore, knockdown of PTP1B in hepatocytes significantly reduced Bach1 levels. LTG Liver weight and liver weight / body weight ratio in mice Figure 12 A), where Figure 12 The specific details of A are shown in Tables 58-59. To further clarify the role of PTP1B in BACH1-regulated insulin resistance in mice, we examined insulin sensitivity and glucose tolerance-related indicators in mice. The results showed that hepatocyte-specific knockdown of PTP1B significantly reduced Bach1 insulin resistance in mice fed with HFD. LTG The rise in fasting blood glucose and fasting insulin in mice ( Figure 12 B). Furthermore, knocking down PTP1B also partially improved Bach1 in HFD-fed individuals. LTG The increase in the HOMA-IR index in mice ( Figure 12 B), where Figure 12 The specific details of PTP1B are shown in Tables 60-62. Consistent with this, the results of GTT and ITT showed that hepatocyte-specific knockdown of PTP1B improved glucose tolerance in mice. Figure 12 C) and insulin sensitivity ( Figure 12 D), where Figure 12 The specific details of CD are shown in Tables 63-72. PAS staining ( Figure 12 E) and hepatocyte glycogen content analysis ( Figure 12 F) shows that hepatocyte-specific knockdown of PTP1B significantly improved Bach1 LTG Decreased glycogen storage capacity in mice, among which Figure 12 The specific details of F are shown in Table 73. Furthermore, after insulin stimulation, Bach1 fed with HFD... LTG The phosphorylation levels of IR-β, AKT, GSK-3β, and FOXO1 in mouse liver tissue were significantly lower than those of N. TG In control mice, hepatocyte-specific knockdown of PTP1B significantly increased the phosphorylation level of the insulin signaling pathway. Figure 12 G).

[0246]

[0247] Table 73 Figure 12 Specific data on Liver glycogen in F

[0248]

[0249] 2. Hepatocyte-specific knockdown of PTP1B can partially improve liver function damage and hepatic steatosis in BACH1-promoted HFD mice.

[0250] We further investigated the role of PTP1B in BACH1-regulated hepatic steatosis and liver dysfunction. By detecting liver function-related indicators AST, ALT, and ALP in mouse serum, we found that hepatocyte-specific knockdown of PTP1B could partially ameliorate the BACH1-induced liver dysfunction. Figure 13 A-13C), among which Figure 13 The specific details of AC are shown in Tables 74-76. Furthermore, regarding HFD Bach1... LTG Compared with mice, hepatocyte-specific knockdown of PTP1B reduced elevated serum levels of TG, TC, and NEFA. Figure 13 D-13F), among which Figure 13 The specific details of DF are shown in Tables 77-79. Consistent with this, HE and Oil Red O staining of liver sections also showed that hepatocyte-specific knockdown of PTP1B alleviated BACH1-promoted hepatic steatosis. Figure 13 These data suggest that hepatocyte-specific knockdown of PTP1B can partially improve BACH1-induced liver function impairment and hepatic steatosis.

[0251]

[0252] Example 7: Application of BACH1 in improving hyperglycemia and insulin resistance

[0253] To determine whether BACH1 has a therapeutic effect on insulin resistance in diabetic mice, we injected 4-week-old male db / db diabetic mice (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) via tail vein injection with either AAV-shCon or AAV-shBach1 virus (2 x 10^6). 11 Vg / mouse)(Bach1-shRNA (5'-3') sequence GCGUACACAAUAUCGAGGATT, SEQ ID NO: 15) specifically knocked down Bach1 in mouse hepatocytes to determine whether knocking down BACH1 could treat insulin resistance and hyperglycemia phenotype in db / db diabetic mice. Western blot results showed that tail vein injection of AAV-shBach1 significantly knocked down BACH1 in mouse livers (vg / mouse). Figure 14I). After AAV injection, we fed Chow Diet (CD) db / db mice with a normal diet for 4 weeks, and then measured relevant indicators. The results showed that knockdown of BACH1 reduced fasting blood glucose in db / db mice ( Figure 14 A) Glucose tolerance ( Figure 14 B) and insulin tolerance ( Figure 14 C) Improvement and enhancement of the hepatic insulin signaling pathway ( Figure 14 I), where Figure 14 The specific details of AC are shown in Tables 80-86.

[0254] To more accurately examine the effect of BACH1 knockdown on insulin sensitivity, we conducted a hyperinsulin-norglucose clamp experiment in db / db mice. The results showed that the glucose infusion rate (GIR) in BACH1 knockdown mice was significantly higher than that in control mice. Figure 14 D), where Figure 14 The specific details of D are shown in Table 87. Compared with the control group, the inhibitory effect of insulin stimulation on hepatic glucose production (HGP) was significantly enhanced in BACH1 knockdown mice. Figure 14 E-14F), among which Figure 14 The specific details of EF are shown in Tables 88-89. Therefore, hepatocyte-specific knockdown of BACH1 lowers blood glucose levels by increasing insulin sensitivity and reducing hepatic glucose production. Simultaneously, knockdown of BACH1 in db / db mouse hepatocytes enhances glycogen content in mouse hepatocytes and reduces the expression of gluconeogenesis-related genes in the liver. Figure 14 G-14H), among which Figure 14 The specific details of GH are shown in Tables 90-91. These results indicate that inhibiting BACH1 expression can reduce hyperglycemia in diabetic mice, increase insulin signaling pathways and insulin sensitivity, reduce hepatic glucose production, and improve the insulin resistance phenotype in diabetic mice.

[0255]

[0256]

[0257] Table 91 Figure 14 Specific data on gluconeogeness in H

[0258]

[0259] Although the present invention has been described in detail by way of preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention.

Claims

1. The application of a BACH1 molecule detection reagent in the preparation of diagnostic products for insulin resistance-related diseases, wherein the insulin resistance-related diseases are non-alcoholic fatty liver disease or diabetes mellitus.

2. The application according to claim 1, characterized in that, The detection reagents include: 1) Reagents for detecting BACH1 protein expression levels; 2) Detection Bach1 Reagents for gene expression levels; and / or, 3) Detection Bach1 Reagents for assessing mRNA expression levels.

3. The use of an inhibitor of a BACH1 molecule in the preparation of a pharmaceutical composition for the prevention and / or treatment of insulin resistance-related diseases, characterized in that, The inhibitor of the BACH1 molecule inhibits the activity and / or expression of the BACH1 molecule, wherein the inhibitor of the BACH1 molecule is... Bach1 Gene knockdown reagents; The Bach1 The gene knockdown agent is the shRNA of the BACH1 molecule, and the shRNA is: CCGCAGGUAUCAAGGAAAUTT (SEQ ID NO: 12), GUCAGGAUUUACCUUUGAATT (SEQ ID NO: 13), CCAGGUCAAAGGACUUUCATT (SEQ ID NO: 14); or, GCGUACACAAUAUCGAGGATT (SEQ ID NO: 15), The insulin resistance-related diseases mentioned are non-alcoholic fatty liver disease or diabetes.

4. The application according to claim 3, characterized in that, The inhibitors of the BACH1 molecule reduce blood glucose, insulin, triglycerides, total cholesterol, free fatty acids, alkaline phosphatase, alanine aminotransferase, or aspartate aminotransferase levels.

5. The application according to claim 3, characterized in that, Inhibitors of the BACH1 molecule improve glucose tolerance, insulin tolerance, and / or enhance insulin sensitivity.

6. The application according to claim 3, characterized in that, The inhibitors of the BACH1 molecule inhibit or enhance the activity and / or expression of BACH1-mediated insulin signaling pathways and / or glucose and lipid metabolism-related molecules.

7. The application according to claim 6, characterized in that, The BACH1 molecule-mediated insulin signaling pathway includes protein tyrosine phosphatase 1B, phosphorylation of insulin receptor β, phosphorylation of protein kinase B, phosphorylation of glycogen synthase kinase-3, phosphorylation of human forkhead box protein O1, and influence on liver glycogen synthesis, gluconeogenesis, or lipid synthesis pathways; the glucose and lipid metabolism-related molecules include gluconeogenesis genes or their proteins, cholesterol synthesis-related genes or their proteins, fatty acid uptake-related genes or their proteins, fatty acid synthesis-related genes or their proteins, or fatty acid β-oxidation-related genes or their proteins.

8. The application according to claim 6, characterized in that, The inhibitor of the BACH1 molecule inhibits the interaction between protein tyrosine phosphatase 1B (PTP1B) and the insulin receptor β subunit (IR-β).

Images