A hmga2 gene molecular marker related to duck weight trait, a detection method and application thereof

Abstract

The application provides a duck weight trait related HMGA2 gene molecular marker LINE / CR1 and application thereof in identifying a duck weight trait or breeding a high weight duck, the molecular marker LINE / CR1 is located in an intron region of a duck HMGA2 gene, is an insertion type polymorphic molecular marker, and a nucleotide sequence is shown in SEQ ID NO. 1. The application also provides application of a duck HMGA2 gene molecular marker LINE / CR1 detection substance in identifying a duck weight trait or breeding a high weight duck, the detection substance is a specific primer for amplifying the molecular marker LINE / CR1, and the primer sequences respectively contain DNA molecules shown in SEQ ID NO. 2 and 3. Advantages of the application are that the provided molecular marker LINE / CR1 and specific primer can identify a duck weight trait, can screen out a meat duck with a high weight trait at an early stage, accelerate a breeding process, and have important significance for new breed cultivation of meat ducks in China.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to a molecular marker related to a duck body weight trait, a detection method and application. BACKGROUND

[0002] China is one of the countries with the most abundant waterfowl genetic resources in the world. The waterfowl genetic resources are not only numerous, but also have different characteristics. Based on the different characteristics of local breeds, some special-purpose breeds have been bred. However, the development of waterfowl breeding industry still faces many problems. The main problem is the lack of iconic breeds with international competitiveness. The source of meat duck is mainly introduced from abroad due to the slow growth rate and low feed conversion efficiency. China has become the world's largest producer and consumer of meat ducks. Therefore, it is of great significance to breed fast-growing meat ducks with Chinese independent intellectual property rights. Growth traits have always been one of the key economic traits in genetic improvement of meat-producing livestock and poultry. In traditional breeding, individuals are usually selected based on phenotypic traits determined by individual measurement, sibling determination or offspring determination. However, traditional breeding methods cannot perform early selection, which increases the generation interval and reduces the selection response. Therefore, developing new molecular markers with large effects and using molecular marker-assisted selection to accelerate breeding progress is a feasible solution for improving meat duck germplasm resources.

[0003] HMGA2 gene, full name high mobility group AT-hook 2 protein, is a non-histone chromatin protein that can bind to chromosomes and regulate gene expression at the transcription level by changing gene structure, and is involved in various biological functions such as cell migration and differentiation, and plays an important role in tumor occurrence, cell cycle and apoptosis. Human genome correlation studies have confirmed that the HMGA2 gene is significantly related to height. Mice with HMGA2 gene knockout exhibit dwarfism. SNP site polymorphism analysis and QTL positioning studies have found that the HMGA2 gene is related to chicken body weight weekly gain, and there is a site affecting body weight in this region, which is an important candidate gene for studying growth traits. However, the structural variation of the HMGA2 gene affecting duck growth traits has not been analyzed, which seriously hinders the application of the HMGA2 gene in the breeding of new meat duck varieties. SUMMARY

[0004] In order to identify duck body weight traits or breed high body weight ducks, the present application provides the following technical solutions:

[0005] The application aims to provide a duck weight trait related HMGA2 gene molecular marker LINE / CR1, which is characterized in that the molecular marker LINE / CR1 is located in an intron region of a duck HMGA2 gene, specifically at: duck genome chr 1: 36319887-36322598, is an insertion type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO. 1; the specific primers for amplifying the HMGA2 gene molecular marker LINE / CR1 are composed of primer F2 and primer R2; the primer F2 comprises a DNA molecule shown in SEQ ID NO. 2; and the primer R2 comprises a DNA molecule shown in SEQ ID NO. 3.

[0006] The application further provides the following method:

[0007] The application provides a method for identifying a duck weight trait, which comprises the following steps: detecting a polymorphic molecular marker LINE / CR1 in an intron region of a HMGA2 gene of a duck to be tested, and judging the genotype through electrophoretic detection analysis; and the duck to be tested with the genotype II has a high weight trait.

[0008] The application further provides a method for breeding a high weight duck, which comprises the following steps: detecting a polymorphic molecular marker LINE / CR1 in an intron region of a HMGA2 gene of a duck to be tested, and judging the genotype through electrophoretic detection analysis; and breeding the duck to be tested with the genotype II to obtain a high weight duck.

[0009] In the embodiment of the application, the method for detecting the polymorphic molecular marker LINE / CR1 in the intron region of the HMGA2 gene of the duck to be tested comprises the following steps: performing allele-specific amplification on the duck to be tested with the specific primers, and then performing electrophoretic detection analysis;

[0010] If one 3837bp electrophoretic band can be amplified, the genotype of the duck to be tested is II;

[0011] If two 1126bp and 3837bp electrophoretic bands can be amplified at the same time, the genotype of the duck to be tested is IW;

[0012] If a 1126bp electrophoretic band can be amplified, the genotype of the duck to be tested is WW.

[0013] The application further provides the following application:

[0014] The application provides an application of the duck HMGA2 gene molecular marker LINE / CR1 or a detection material thereof in identifying a duck weight trait;

[0015] Or, the application provides an application of the duck HMGA2 gene molecular marker LINE / CR1 or a detection material thereof in breeding a high weight duck.

[0016] Or, the application provides a substance for detecting a duck HMGA2 gene molecular marker LINE / CR1 in the preparation of a product for identifying the body weight trait of a duck or breeding a high body weight duck.

[0017] In the embodiments of the present application, the substance for detecting the duck HMGA2 gene molecular marker LINE / CR1 comprises the following 1) or 2):

[0018] 1) specific primers for amplifying the molecular marker LINE / CR1;

[0019] 2) PCR reagents containing the primers;

[0020] The primers consist of primer F2 and primer R2;

[0021] The primer F2 comprises a DNA molecule shown in SEQ ID NO. 2; and the primer R2 comprises a DNA molecule shown in SEQ ID NO. 3;

[0022] The product for identifying the body weight trait of a duck or breeding a high body weight duck comprises a kit or a chip for identifying the body weight trait of a duck or breeding a high body weight duck.

[0023] The present application provides a specific primer for amplifying a duck HMGA2 gene molecular marker LINE / CR1, which consists of primer F2 and primer R2; the primer F2 comprises a DNA molecule shown in SEQ ID NO. 2; and the primer R2 comprises a DNA molecule shown in SEQ ID NO. 3.

[0024] The present application also provides a duck HMGA2 gene molecular marker LINE / CR1, a specific primer, and the above method or application in duck molecular marker assisted breeding.

[0025] Compared with the prior art, the present application has the following beneficial effects:

[0026] The duck HMGA2 gene molecular marker LINE / CR1 and the specific primer provided by the present application can identify the body weight trait of a duck, can screen out a meat duck with a high body weight trait at an early stage, and can accelerate the breeding process, which has important significance for the cultivation of new varieties of meat ducks in China. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is a genomic comparison diagram of two alleles of the intron region of the HMGA2 gene;

[0028] Figure 2 It is the distribution frequency of the duck HMGA2 gene intron insertion type polymorphic molecular marker LINE / CR1;

[0029] Figure 3 The results of PCR detection of the molecular marker LINE / CR1 intron region of the HMGA2 gene;

[0030] Figure 4 PCR amplification program for the HMGA2 gene molecular marker LINE / CR1;

[0031] Figure 5 PCR sequencing was used to reveal the distribution frequencies of the two alleles of the HMGA2 gene;

[0032] Figure 6 Association analysis of HMGA2 gene molecular marker LINE / CR1 with body weight trait. Detailed Implementation

[0033] The embodiments of the present invention will be described in detail below with reference to examples. However, the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used that do not specify the manufacturer are all commercially available conventional products.

[0034] The primers used in this invention were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0035] The wild ancestors of domestic ducks (wild ducks) include mallards and spot-billed ducks;

[0036] Meat-grade commercial ducks include Cherry Valley ducks and Oberlind ducks.

[0037] Example 1 – Extraction of Duck Genomic DNA

[0038] Duck flocks of the above four breeds (Malus mallard, Spot-billed duck, Cherry Valley duck, and Oberlinn duck) were collected, blood was collected from the wing veins, and the blood was placed in anticoagulant tubes. DNA was extracted using the phenol-formaldehyde extraction method and diluted to 60 ng / ul for use as a template.

[0039] Example 2 – Discovery of the polymorphic molecular marker LINE / CR1 in the intron region of the duck HMGA2 gene

[0040] 1. High-throughput sequencing reveals structural variations in the intron region of duck HMGA2.

[0041] Using duck whole-genome resequencing data obtained in our laboratory, we identified genomic structural variations by comparing and analyzing genome depth and coverage. We discovered insertion variations (inserted and wild-type) in the intron regions of the HMGA2 gene, specifically as follows: Figure 1 As shown.

[0042] Using the genomic DNA obtained in Example 1 as an amplification template, and employing the primers shown in Table 1, the reaction system shown in Table 2, and...Figure 4 PCR amplification procedure shown in the detection of wild duck and meat commodity duck HMGA2 intron region structure variation, by statistical genotypes, analysis of the insertion variation in wild duck breed and meat commodity duck in allele frequency, found that the insertion type and wild type in wild duck and meat commodity duck exist significant frequency difference, as shown in detail in Figure 2 .

[0043] 2. PCR detection identified two structural variation alleles of HMGA2 intron

[0044] The genomic DNA obtained in Example 1 was used as the amplification template, the primers shown in Table 1, the reaction system shown in Table 2 and Figure 4 PCR amplification procedure shown in the detection of wild duck and meat commodity duck breed HMGA2 gene intron region, by sequencing the amplification product for genotyping, a total of 2 alleles were found, insertion type (type I): there is an insertion at the position of chr 1:36319887-36322598, the nucleotide sequence is shown in SEQ ID NO. 1, the insertion length is 2711bp, the wild type (W type) does not exist at this position. The two alleles were identified by the above PCR technique, and the F2 and R2 primers were used to identify the I allele and the W allele. Electrophoresis detection can obtain W allele band size of 1126bp, I allele band size of 3837bp. WW genotype shows a 1126bp electrophoresis band; IW genotype shows two electrophoresis bands of 1126bp and 3837bp respectively; II genotype shows a 3837bp electrophoresis band, as shown in Figure 3 , the primer sequences of F2 primer and R2 primer are shown in Table 1, the reaction system of PCR amplification is shown in Table 1, and the PCR amplification procedure is shown in Figure 4 .

[0045] Table 1 Two alleles specific primers of HMGA2 intron

[0046] Primer name Primer sequence (5' - 3') Sequence name F2 ACCTCTTTTTCTATCCCAAGACCTATCTG SEQ ID NO. 2 R2 TTCTCACGCAGACCAGCTCATG SEQ ID NO. 3

[0047] Table 2 is the reaction system of PCR amplification

[0048] Ingredient Volume PCR Mix 10ul F2 0.5ul R2 0.5ul DNA 1ul ddH2O 8ul Total 20ul

[0049] Example 3 - Association analysis of duck HMGA2 gene intron region polymorphic molecular marker LINE / CR1 and duck body weight traits

[0050] The genomic DNA obtained in Example 1 was used as the amplification template, the primers shown in Table 1, the reaction system shown in Table 2 and Figure 4PCR amplification procedure shown to detect alleles of duck (greenhead duck, spotty duck) and meat commodity duck (Cherry Valley duck, Obaixing) HMGA2 gene intron region, found that wild-type allele W mainly exists in wild duck (greenhead duck, spotty duck), and I allele mainly exists in meat commodity duck (Cherry Valley duck and Obaixing), the distribution frequency is as shown in Figure 5 .

[0051] Liancheng white duck and Baijia duck have a distant genetic relationship, and are more suitable for resource group construction and gene positioning of traits.

[0052] According to the method described in Example 1, the genomic DNA of 384 individuals of Liancheng white duck x Baijia duck F2 generation resource group was extracted, and then the above-mentioned PCR was used to identify the genotypes of the molecular marker LINE / CR1 of 384 individuals of Liancheng white duck x Baijia duck F2 generation resource group. After identification, the F2 generation resource group was corresponding to the phenotypic data, that is, one individual corresponds to one genotype data and one set of phenotype data. The data was input into the SPSS software, the general linear model was selected, and the genotype data was added as a fixed effect. The results of single-point variation general linear model association analysis of duck F2 generation resource group were obtained by analysis. If the p value is less than 0.05, it is considered that the variation site is significantly related to the trait.

[0053] Based on the single-point variation general linear model association analysis of F2 generation resource group, it was found that allele I was significantly positively correlated with high body weight of duck, and allele W was significantly positively correlated with low body weight of duck. The association analysis results are shown in Figure 6 , which shows that the duck HMGA2 gene intron region polymorphic molecular marker LINE / CR1 can be used to identify the body weight of duck.

[0054] Example 4—Application of HMGA2 gene intron region polymorphic molecular marker LINE / CR1 and its detection material

[0055] I. Application of HMGA2 gene intron region polymorphic molecular marker LINE / CR1 and its detection material in identifying body weight of duck

[0056] Step 1, collect the duck group to be tested, collect blood from the wing vein, put the blood into an anticoagulant tube, extract DNA by phenol imitation method, and dilute to 60 ng / ul as an amplification template for standby;

[0057] Step 2, using the above-mentioned allele PCR technology, taking the diluted genomic DNA as a template, using the primer F2 and primer R2 to detect the polymorphic molecular marker LINE / CR1 of HMGA2 intron region, and detecting and analyzing by electrophoresis,

[0058] If a 3837 bp electrophoretic band can be amplified, the genotype of the duck to be tested is II;

[0059] If two electrophoresis bands of 1126bp and 3837bp can be amplified simultaneously, the genotype of the duck to be tested is IW;

[0060] If an electrophoresis band of 1126bp can be amplified, the genotype of the duck to be tested is WW.

[0061] Step 3, according to the genotype results, the duck to be tested with genotype II has high weight trait.

[0062] II. Application of polymorphic molecular marker LINE / CR1 in intron region of HMGA2 gene and its detection material in breeding high weight ducks

[0063] Step 1, collect the duck group to be tested, collect blood from wing vein, put the blood into an anticoagulant tube, extract DNA by phenol emulsion method, and dilute to 60ng / ul as amplification template for standby;

[0064] Step 2, using the above allele PCR technology, taking the diluted genomic DNA as template, using the primer F2 and primer R2 to detect the polymorphic molecular marker LINE / CR1 in the intron region of HMGA2, and detecting and analyzing by electrophoresis,

[0065] If an electrophoresis band of 3837bp can be amplified, the genotype of the duck to be tested is II;

[0066] If two electrophoresis bands of 1126bp and 3837bp can be amplified simultaneously, the genotype of the duck to be tested is IW;

[0067] If an electrophoresis band of 1126bp can be amplified, the genotype of the duck to be tested is WW.

[0068] Step 3, according to the genotype results, combine the breeding program to select individuals with genotype II for breeding, improve the weight trait of the duck group, and obtain high weight ducks.

Claims

1. A method for identifying the weight trait of a duck to be tested, characterized in that, The procedure includes the following steps: Allele-specific amplification of the HMGA2 gene molecular marker LINE / CR1 is performed on the test ducks using specific primers. Electrophoretic analysis reveals that if a 3837 bp band is amplified, the genotype is II. Test ducks with genotype II exhibit high body weight. The specific primers for amplifying the HMGA2 gene molecular marker LINE / CR1 consist of primer F2 and primer R2. Primer F2 is a DNA molecule as shown in SEQ ID NO.

2. Primer R2 is a DNA molecule as shown in SEQ ID NO.3; the duck to be tested is Liancheng White Duck and / or Baigai Duck.

2. A method for breeding high-weight ducks, characterized in that, The procedure includes the following steps: Allele-specific amplification of the HMGA2 gene molecular marker LINE / CR1 is performed on the test ducks using specific primers. Electrophoretic analysis reveals that if a 3837bp band is amplified, the genotype is II. Ducks with genotype II are selected for breeding to obtain high-weight ducks. The specific primers for amplifying the HMGA2 gene molecular marker LINE / CR1 consist of primer F2 and primer R2. Primer F2 is a DNA molecule as shown in SEQ ID NO.

2. Primer R2 is a DNA molecule as shown in SEQ ID NO.3; the duck to be tested is Liancheng White Duck and / or Baigai Duck.

3. The application of substances that detect the molecular marker LINE / CR1 of the duck HMGA2 gene in the identification of duck weight traits, characterized by: The substance used to detect the duck HMGA2 gene molecular marker LINE / CR1 includes specific primers for amplifying the molecular marker LINE / CR1; The specific primer consists of primer F2 and primer R2; primer F2 is a DNA molecule as shown in SEQ ID NO.2; Primer R2 is a DNA molecule as shown in SEQ ID NO.3; if the duck being tested can be amplified to obtain a 3837bp electrophoretic band, then the genotype is II, indicating that the duck being tested has the high weight trait.

4. The application of substances that detect the molecular marker LINE / CR1 of the duck HMGA2 gene in the breeding of high-weight ducks, characterized by: The substance used to detect the duck HMGA2 gene molecular marker LINE / CR1 includes specific primers for amplifying the molecular marker LINE / CR1; The specific primer consists of primer F2 and primer R2; primer F2 is a DNA molecule as shown in SEQ ID NO.2; Primer R2 is a DNA molecule as shown in SEQ ID NO.3; the duck to be bred is Liancheng White Duck and / or White-modified Duck; the high-weight duck has genotype II and has a 3837bp electrophoretic band.

5. The application of substances that detect the molecular marker LINE / CR1 of the duck HMGA2 gene in the preparation of products for identifying duck weight traits or breeding high-weight ducks, characterized in that: The substance for detecting the duck HMGA2 gene molecular marker LINE / CR1 includes specific primers for amplifying the molecular marker LINE / CR1; The specific primer consists of primer F2 and primer R2; primer F2 is a DNA molecule as shown in SEQ ID NO.2; Primer R2 is a DNA molecule as shown in SEQ ID NO.3; the product for identifying duck weight traits or breeding high-weight ducks includes a kit and a chip for identifying duck weight traits or breeding high-weight ducks; the duck to be identified or bred is Liancheng White Duck and / or White-modified Duck; the high-weight duck has genotype II and has a 3837bp electrophoretic band.

6. The method according to claim 1 or 2, or the application according to any one of claims 3-5, in marker-assisted breeding of duck weights, characterized in that: The breeding ducks are Liancheng White Ducks and / or Baigai Ducks.

Images