A nanobody targeting Nipah virus G protein, a polymerized nanobody and its application

Abstract

The present invention provides a nanobody, a polymerized nanobody and an application thereof targeting Nipah virus G protein, and belongs to the field of nanobody technology. The present invention is based on phage display technology, constructs a natural NiV G protein nanobody library based on phage display, and screens and obtains nanobodies targeting NiV G protein with good specificity and high affinity. In addition, the present invention polymerizes monovalent nanobodies together through a short GS Linker connection sequence, converts them into a multivalent form, and then further improves the expression level through prokaryotic expression condition optimization, and further shows that the polymerized nanobody has a higher affinity with the target protein through ELISA and Western Blot methods.

Description

Technical Field

[0001] The present invention belongs to the technical field of nano antibodies, and in particular relates to a nano antibody targeting Nipah virus G protein, a polymerized nano antibody and applications thereof. Background Art

[0002] Nipah virus disease is a highly lethal zoonosis caused by Nipah Virus (NiV), which mainly causes acute damage to the central nervous system and respiratory system. The main natural hosts of the virus are fruit bats of the family Pteropus. Pigs, cattle, horses, goats, cats, dogs, mice, rabbits, foxes, birds of prey, and starlings are also natural hosts of NiV. Fruit bats have a wide range of activities, and NiV may be transmitted between fruit bats in a certain area. Therefore, countries and regions where the same species of bats are distributed will face the risk of virus mutation and epidemic outbreaks.

[0003] NiV is an enveloped pleomorphic virus belonging to the genus Henipavirus of the family Paramyxoviridae. The genome of the virus consists of a non-segmented negative-sense single-stranded RNA of approximately 18.2 kb, encoding six structural proteins: nucleocapsid (N), phosphoprotein (P), matrix protein (M), fusion protein (F), glycoprotein (G), and RNA polymerase (L). N, P, and L together with viral RNA form a ribonucleoprotein complex, which is associated with the transcription and replication of the viral genome. The M protein is involved in maintaining the morphology of the viral envelope, and the F protein and G protein are involved in protein fusion and adsorption, which are associated with viral invasion. The G protein binds to the host cell membrane proteins ephrin-B2 and ephrin-B3. Since there are currently no antiviral drugs or vaccines for NiV, only supportive treatment can be given, so research and development of highly sensitive and specific diagnostic tools as well as antiviral drugs and vaccines are needed to help prevent and control future outbreaks. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a nanobody and a polymerized nanobody targeting Nipah virus G protein, which have the advantages of good specificity and high affinity, and can be expressed in large quantities using a prokaryotic expression system, and have good solubility, low cost and good biological activity.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a nanobody targeting Nipah virus G protein, the amino acid sequence of the nanobody is shown in SEQ ID NO.1.

[0007] The present invention also provides a multimeric nanobody targeting Nipah virus G protein, wherein the multimeric nanobody is obtained by polymerizing at least two of the above nanobodies using a GS Linker sequence.

[0008] Preferably, the amino acid sequence of the GS Linker sequence is shown as SEQ ID NO.2.

[0009] Preferably, the amino acid sequence of the multimeric nanobody comprises SEQ ID NO.3 or SEQ ID NO.4.

[0010] The present invention also provides a gene encoding the above-mentioned nano-antibody, and the nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0011] The present invention also provides a gene encoding the above-mentioned multimeric nanobody, and the nucleotide sequences of the gene encoding the multimeric nanobody with amino acid sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0012] The invention also provides an expression vector containing the gene.

[0013] Preferably, the expression vector comprises PDX-init phagemid, pET-22b or pSB-init.

[0014] The present invention also provides a host cell containing the above expression vector.

[0015] The present invention also provides the use of any one of the following in the preparation of a Nipah virus detection product, an anti-Nipah virus drug or an anti-Nipah virus vaccine:

[0016] (1) the above-mentioned nanobody; (2) the above-mentioned multimeric nanobody; (3) the above-mentioned gene; (4) the above-mentioned expression vector; (5) the above-mentioned host cell.

[0017] Beneficial effects of the present invention:

[0018] The present invention is based on phage display technology, and a natural NiV G protein nanoantibody library based on phage display is constructed, and nanoantibodies targeting NiV G protein with good specificity and high affinity are screened. In addition, the present invention polymerizes monovalent nanoantibodies together through a short GS Linker connection sequence, converts them into a multivalent form, and then further improves the expression level through prokaryotic expression condition optimization, and further demonstrates that the polymerized nanoantibodies have a higher affinity with the target protein through ELISA and Western Blot methods.

[0019] Compared with traditional antibodies, the nanoantibodies of the present invention have the advantages of small molecular weight, good degradation resistance and stability, can be expressed by prokaryotes, low large-scale production cost, easy product characterization, low post-translational modification, good uniformity and tissue penetration, and easy absorption. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of nested PCR amplification of alpaca VHH gene, where the left picture is the result of the first round of PCR, and the right picture is the result of the second round of PCR. M in both pictures represents marker, and 1 and 2 represent two parallel experiments;

[0021] Figure 2 Schematic diagram of positive clone identification of the Nanobody library of the present invention, Figure 2 1-20 in the figure represent the PCR results of 20 recombinant phage clones, and M represents the marker;

[0022] Figure 3 The titer determination result of the phage display library of the present invention;

[0023] Figure 4 This is a total of five rounds of post-screening enrichment detection for the present invention;

[0024] Figure 5 This is a schematic diagram of identifying positive clones of the recombinant phage of the present invention;

[0025] Figure 6 Schematic diagram of SDS-PAGE (left figure) and Western Blot (right figure) identification of the monovalent, divalent and trivalent antibodies after purification of the present invention, 1-3 in the figure correspond to monovalent, divalent and trivalent nanobodies, respectively, and M represents marker;

[0026] Figure 7 This is a schematic diagram of the ELISA method of the present invention to verify the antigen binding ability of the recombinant antibody, from left to right and from top to bottom are the results of the purified monovalent, divalent and trivalent nanobody binding proteins;

[0027] Figure 8 Schematic diagram of the Western Blot method of the present invention for verifying the binding specificity of monovalent, bivalent and trivalent antibodies to antigens, which correspond to the results of monovalent, bivalent and trivalent antibodies from left to right, respectively. In each figure, 1 and 2 represent two parallel experiments, respectively, and M represents a marker. DETAILED DESCRIPTION

[0028] The present invention provides a nanobody targeting Nipah virus G protein, the amino acid sequence of the nanobody is shown in SEQ ID NO.1.

[0029] The nano antibody targeting Nipah virus G protein provided by the present invention can be expressed in large quantities using a prokaryotic expression system, has good solubility, low cost and good biological activity, and lays the foundation for subsequent research on the pathogenic mechanism of NiV, diagnostic detection, vaccines and neutralizing antibodies. In order to successfully obtain the nano antibody described in the present invention, the present invention constructs a natural non-immunized nano antibody phage display library, avoiding the cumbersome, time-consuming and costly process of immunizing animals, and the library has no antigen preference and can be directly used for the screening of multiple target antigens. Compared with other libraries, the phage library has low difficulty in building a library, a short expression cycle, and it is easy to obtain the corresponding specific nano antibody through multiple rounds of panning. The method for constructing a natural non-immunized nano antibody phage display library of the present invention includes alpaca blood collection and extraction of total RNA, amplification of alpaca VHH genes, construction of recombinant phagemid vectors and electro-conversion of connection products, phage library rescue and titer determination, multiple rounds of screening for Nipah virus G protein, and identification and analysis of recombinant phage positive clones, a total of six steps.

[0030] The present invention also provides a multimeric nanobody targeting Nipah virus G protein, wherein the multimeric nanobody is obtained by polymerizing at least two of the above nanobodies using a GS Linker sequence.

[0031] In the present invention, the amino acid sequence of the GS Linker sequence is preferably GGGGSGGGGSGGGGS (SEQID NO.2). In the present invention, after two of the above nanobodies are polymerized using one GS Linker sequence, a divalent nanobody is obtained, and the amino acid sequence is preferably as shown in SEQ ID NO.3; after three of the above nanobodies are polymerized using two GS Linker sequences, a trivalent nanobody is obtained, and the amino acid sequence is preferably as shown in SEQ ID NO.4. In the present invention, after the above nanobodies are polymerized using the GS Linker sequence, the activity of the nanobody can be further improved, such as having a higher affinity for the target protein after polymerization, and being able to prolong the half-life.

[0032] The present invention also provides a gene encoding the nanobody shown in SEQ ID NO.1, and the nucleotide sequence of the gene is preferably as shown in SEQ ID NO.5. The present invention also provides a gene encoding the polymerized nanobody shown in SEQ ID NO.3, and the nucleotide sequence of the gene is preferably as shown in SEQ ID NO.6. The present invention also provides a gene encoding the polymerized nanobody shown in SEQ ID NO.4, and the nucleotide sequence of the gene is preferably as shown in SEQ ID NO.7.

[0033] The present invention also provides an expression vector containing the above gene. In the present invention, the expression vector preferably includes PDX-init phagemid, pET-22b or pSB-init. The present invention has no special restrictions on the specific sources of the PDX-init phagemid, pET-22b and pSB-init, and any conventional commercially available product in the art can be used.

[0034] The present invention also provides a host cell containing the above expression vector. In the present invention, the host cell preferably includes TG1 competent cells and MC1061 competent cells. The present invention has no special limitation on the specific sources of the TG1 competent cells and MC1061 competent cells, and any conventional commercially available products in the art can be used.

[0035] The present invention also provides the use of any one of the following in the preparation of a Nipah virus detection product, an anti-Nipah virus drug or an anti-Nipah virus vaccine: (1) the above-mentioned nanoantibody; (2) the above-mentioned polymerized nanoantibody; (3) the above-mentioned gene; (4) the above-mentioned expression vector; (5) the above-mentioned host cell.

[0036] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0037] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0038] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0039] Example 1

[0040] Establishment of a natural camel-derived nanoantibody library

[0041] (1) Blood collection from alpacas and extraction of total RNA

[0042] Take 400mL of fresh blood sample in an anticoagulant tube, dilute the whole blood with an equal volume of PBS, tilt the diluted blood and slowly add it to the surface of an equal volume of separation solution. After centrifugation at room temperature, obvious stratification will appear. Centrifuge at 500g for 30min, carefully draw the second layer of ring-shaped milky white lymphocytes into a 50mL sterile centrifuge tube, and add 40mL of washing solution. Centrifuge at 250g for 10min, discard the supernatant, add 1× red blood cell lysis solution according to the amount of red blood cells in the white blood cells, lyse on ice for 5min until white, add 40mL of washing solution, and resuspend the cells. Centrifuge at 250g for 10min. Discard the supernatant, repeat the above steps, discard the supernatant, and resuspend the cells for later use. After isolating alpaca peripheral blood lymphocytes, total RNA was extracted using the Trizol method. According to the instructions of the reverse transcription kit of abm, the total RNA of alpaca blood was reversely transcribed into cDNA.

[0043] (2) Amplification of alpaca VHH genes

[0044] The first round of PCR amplification was performed using cDNA as a template, wherein CALL001 and CALL002 were used as upstream and downstream primers for nested PCR amplification to amplify a fragment of about 700 bp, which was purified using a DNA gel recovery kit and used as a template for the second round of PCR.

[0045] CALL001:GTCCTGGCTGCTCTTCTACAAGG(SEQ ID NO.8)

[0046] CALL002:GGTACGTGCTGTTGAACTGTTCC(SEQ ID NO.9)

[0047] 50μl system: KOD One PCR MasterMix 25μl, cDNA 1μl, CALL001 and CALL002 upstream and downstream primers 1μl each, ddH2O 22μl.

[0048] PCR reaction conditions: 98°C for 3 min; 98°C for 10 sec; 55°C for 5 sec; 68°C for 10 sec; 30 cycles; 68°C for 5 min.

[0049] The second round of PCR was performed using VHH-FOR and VHH-REV upstream and downstream primers to obtain the VHH gene with BspQI restriction sites at both ends, and a band of about 400 bp consistent with the theoretical expected size was amplified. The results are as follows Figure 1 The fragment was purified using a gel extraction kit.

[0050] VHH-FOR:ATATGCTCTTCAAGTGAGTCTGGGGGAGR(SEQ ID NO.10)

[0051] VHH-REV:ATATGCTCTTCCTGCTGAGGAGACGGTGACCTGGG(SEQ ID NO.11)

[0052] 50μl system: KOD One PCR Master Mix 25μl, first PCR product 2μl, VHH-FOR and VHH-REV upstream and downstream primers 1μl each, ddH2O 21μl.

[0053] PCR reaction conditions: 98°C for 3 min; 98°C for 10 sec; 60°C for 5 sec; 68°C for 10 sec; 35 cycles; 68°C for 5 min.

[0054] (3) Construction of recombinant phagemid vector and electroporation of ligation products

[0055] The PDX-init phagemid vector (purchased from Addgene) and the VHH target gene fragment were digested with type II restriction endonuclease BspQI (NEB) and connected at a molar ratio of 1:3. The two fragments were connected using T4 ligase (thermo) and electroporated into TG1 competent cells. 20 clones were randomly selected for PCR identification and the accuracy of sequence insertion into the vector was calculated. The results are shown in the figure. Figure 2 As shown in the figure, the amplified band is consistent with the expected band size, which shows that the alpaca VHH gene has been successfully connected to the PDX-init phagemid vector, and subsequent experiments can be carried out. After the rescue of the helper phage, a natural camel-derived phage display library was constructed.

[0056] (4) Phage library rescue and titer determination

[0057] 1 ml of the VHH bacterial library was inoculated into 60 ml of 2×YT medium containing 100 ug / ml ampicillin and 2% glucose, and cultured at 37°C with shaking until OD600 was about 0.4-0.6; helper phage M13K07 was added at MOI=20:1, and the cells were allowed to infect at 37°C for 30 min, and then cultured with shaking for 30 min; the infection solution was centrifuged at 4800 r / min at room temperature for 10 min, the supernatant was discarded, and the bacterial pellet was resuspended in 200 ml of 2×YT medium, and 100 ug / ml ampicillin and 50 ug / ml kanamycin were added, and then cultured at 37°C and 220 r / min with shaking for 16-20 h; the next day, the TG1 bacterial solution packaged overnight was collected into a centrifuge tube and centrifuged at 12000 r / min Centrifuge at 4℃ for 10min; transfer the supernatant to a 50ml centrifuge tube, add 1 / 4 volume of 20% PEG / NaCl, shake and mix, put on ice for 4h, centrifuge at 4℃, 4800r / min for 30min, discard the supernatant, resuspend the phage precipitate with 0.5ml PBS in each tube; transfer all to a new EP tube, add 1 / 4 volume of pre-cooled 20% PEG / NaCl solution, mix upside down, and let stand on ice for 2h; centrifuge at 12000r / min at 4℃ for 10min, discard the supernatant, resuspend with appropriate amount of PBS according to the amount of phage precipitate, incubate on a shaker at 4℃ overnight to fully dissolve the phage particles; take 1μl of the phage solution in the previous step, dilute it 10 times with 2×YT medium, and take a dilution of 10 -7 , 10 -8 , 10 -9 , 10 -10 Take 10 μl of the sample and add 90 μl of TG1 cells in the logarithmic growth phase, mix well, and infect at 37°C for 15 min; spread the TG1 cells infected with different dilutions of phage evenly on LB / AMP-GLU plates and culture at 37°C overnight; count the colonies on the plates and calculate the titer of the phage display library. The results are as follows: Figure 3 As shown, the titer of the phage display library of the present invention is 5×10 13 cfu / ml.

[0058] (5) Multiple rounds of screening for Nipah virus (NiV) G protein

[0059] The Nipah virus G protein (NiV G) was diluted to a final concentration of 10 μg / ml with carbonate coating buffer (pH 9.6). A 96-well ELISA plate was taken and 3 adjacent wells were selected. 100 μl was added to each well and coated overnight at 4°C. Then one well was directly added with PBS as a no-antigen control. The coating solution was discarded, and the coated plate was washed 3 times with sterile 1×PBS flushing solution, and 200 μl of 10% FBS (or 5% skim milk) was added to each well. After blocking at 37°C for 2h, it was washed three times with 1μPBST for standby use. The recombinant phage incubation was taken and the prepared recombinant phage solution was diluted to 1×10 11 cfu / ml, add ELISA plate, 100μl / well, and place on a horizontal shaker at 60r / min at room temperature for 40min, then stand at room temperature for 1.5h; discard the phage sample, wash with PBST 3 times, then wash with PBS 3 times, add 100μl 0.1M Gly-HCl to each well, stand at room temperature for 5min, aspirate the eluate and quickly neutralize with an equal volume of 1M Tris-HCl (pH 9.0), then aspirate the eluate into a sterilized 1.5ml EP tube, and neutralize with 1M Tris-HCl (pH9.0) buffer; take 1μl of neutralized phage solution, and evenly spread TG1 cells infected with different dilutions of phage on LB / AMP-GLU plates, and culture at 37℃ for 12h; count the colonies on the plate and calculate the recombinant phage titer; this is the first round of antibody library obtained. The second and third rounds of enrichment operations are the same as the first round. The antibody library is stored in a 4℃ refrigerator. After five rounds of screening, in order to further verify the binding of the enriched recombinant phage to G protein, the enriched recombinant phage was verified again by phage ELISA. The results are as follows: Figure 4 After five rounds of screening, the OD values ​​showed that more of the enriched phages bound to NiV G protein.

[0060] (6) Identification and analysis of recombinant phage positive clones

[0061] 95 single colonies were randomly selected from the solid plate after the fifth round of panning to prepare phage monoclonal supernatant, mixed with PBSM at a volume ratio of 4:1, and incubated at 37°C for 1h as the primary antibody; and NIV G protein was diluted to 10μg / mL with ELISA coating solution the day before, 100μL per well, coated overnight at 4°C, and a negative control was set up at the same time. The next day, the cells were washed 3 times with PBST, 200μL 5% PBSM was added to each well and blocked at 37°C for 2h, 100μL primary antibody was added after washing, incubated at 37°C for 1h, washed again 3 times, and then 0.2μg / ml HRP-labeled mouse anti-M13KO7 antibody diluted with PBSTM was added, 100μL / well, and incubated at 37°C for 1h; after the incubation, the unbound antibody was washed away. Add TMB colorimetric solution and incubate at room temperature for 20 minutes; add 50 μL ELISA stop solution, read the absorbance value at 450 nm on the microplate reader and perform data analysis. When the A value of the sample well is more than twice the value of the negative control well, it is considered a positive clone. Figure 5 Then the positive bacterial solution was taken for sequencing. The amino acid sequence of the nanobody was obtained as shown in SEQ ID NO.1.

[0062] Example 2

[0063] Prokaryotic expression and purification of polymerized nanobodies

[0064] (1) Construction of recombinant expression vector

[0065] After five rounds of screening, a nanobody against NiV G protein was obtained, which was sequence optimized and synthesized by Bioengineering Co., Ltd. (the amino acid sequence is shown in SEQ ID NO.1, monovalent nanobody), and the monovalent nanobody sequence was constructed on the pET-22b vector, which was used as a template for new plasmid construction and constructed on the pSB-init expression vector. The divalent nanobody sequence was designed with upstream and downstream primers with GS Linker sequence (amino acid sequence is shown in SEQ ID NO.2), and the pET-22b plasmid with Nb gene was used as a template to PCR out the target fragments with GS Linker, and then connected into a divalent sequence by overlapping PCR method (amino acid sequence is shown in SEQ ID NO.3), and constructed on the pSB-init expression vector. The trivalent nanobody with an amino acid sequence as shown in SEQ ID NO.4 was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The trivalent nanobody sequence was constructed into a pET-22b vector, which was used as a template for PCR amplification of the target gene, a new plasmid was constructed, and it was constructed into a pSB-init vector by enzyme digestion and ligation. The ligation product was transformed into MC1061 competent cell, and the positive clones were identified and sequenced for subsequent expression.

[0066] Monovalent primer design:

[0067] Nb-FOR: ATATGCTCTTCAAGTCAGGTTCAGCTGCAGGAATC (SEQ ID NO.12)

[0068] Nb-REV:ATATGCTCTTCCTGCAGAGCTAACGGTAACCTGGG(SEQ ID NO.13)

[0069] Bivalent primer design:

[0070] Nb2-linker-FOR:

[0071] GTAGCGGTGGTGGTGGTTCTGGTGGTGGCGGTAGCCAGGTTCAGCTGCAGGAATC (SEQ ID NO.14)

[0072] Nb2-linker-REV:

[0073] CCACCAGAACCACCACCACCGCTACCACCGCCACCAGAGCTAACGGTAACCTGGG(SEQ ID NO.15)

[0074] Trivalent primer design:

[0075] G-Nb3-FOR: ATATGCTCTTCAAGTCAGGTTCAGCTGCAGGAAAGC (SEQ ID NO.16)

[0076] G-Nb3-REV: ATATGCTCTTCCTGCGCTGCTAACGGTAACCTGGGTA (SEQ ID NO.17)

[0077] The specific experimental steps for constructing the monovalent pSB-init vector are as follows:

[0078] ① The monovalent nanobody sequence was constructed into the pET-22b vector, named G-Nb-pET-22b plasmid, and the monovalent nanobody (Nb) gene was PCR amplified using the G-Nb-pET-22b plasmid as a template, and the fragment was purified using a gel recovery kit. The PCR reaction system was as follows:

[0079] 50μl system: KOD One PCR Master Mix 25μl, NIV G-Nb-pET-22b (template) 0.5μl, Nb-For and Nb-Rev upstream and downstream primers 1μl each, ddH2O 22.5μl.

[0080] PCR reaction conditions: 98°C for 3 min; 98°C for 10 sec; 60°C for 5 sec; 68°C for 10 sec; 35 cycles; 68°C for 3 min.

[0081] ② The monovalent nanobody gene was constructed into the pSB-init expression vector, the fragment and the vector were connected at a molar ratio of 1:3, and the reaction system was prepared as follows:

[0082] Reaction system (10 μl): 1 μl of 10×NEB 3.1 buffer, 0.9 μl of pSb_init empty vector, 0.5 μl of Nb gene fragment, 1 μl of BspQI (10 U), 6.6 μl of ddH2O. Place the reaction in a PCR instrument, incubate at 50°C for 1 hour, inactivate BspQI at 80°C for 20 minutes, cool the reaction to room temperature, and add the following components to the reaction: 1 μl of T4 DNA ligase buffer, 1 μl of T4 DNA ligase (5 U), incubate in a PCR instrument at 22°C for 20 minutes, and inactivate T4 DNA ligase at 65°C for 10 minutes.

[0083] ③ Thaw a 50μl competent MC1061 on ice, add 5μl of the above-mentioned ligation system to the competent cell, incubate on ice for 25 minutes, heat shock at 42℃ for 60s, place on ice for 3 minutes, add 500ul of antibody-free LB medium, recover at 37℃, 220rpm shaking for 1h, centrifuge at 5000rpm for 3min, resuspend the cell pellet with 100μl medium, spread on LB-agar plate supplemented with 25μg / ml chloramphenicol, culture overnight, and sequence after positive clone identification. The one with correct sequencing will be the correctly constructed expression vector.

[0084] The construction methods of bivalent and trivalent vectors refer to the construction methods of monovalent vectors.

[0085] (2) Optimization of small-scale induced expression conditions of multimeric nanobodies

[0086] The correctly sequenced monovalent, bivalent, and trivalent recombinant bacteria were inoculated into LB medium containing chloramphenicol resistance at a ratio of 1:100 for overnight culture; the next day, the overnight cultured recombinant bacteria were inoculated into TB medium at a ratio of 1:100, cultured at 37°C until OD600 was about 0.5-0.7h, and different concentrations of inducer L-arabinose (0.02, 0.1, 0.2%) were added, and then induced for 16h at different temperatures (37°C, 30°C, 22°C). Equal amounts of bacteria were collected, and the bacteria were lysed by ultrasound, and the supernatant and bacterial precipitate were collected. The expression levels of each protein under different inducer concentrations were analyzed by SDS-PAGE and Western Blot, and the optimal induction concentration was determined to be 0.02% and the optimal induction temperature was 22°C.

[0087] (3) Large-scale expression and purification of polymerized nanobodies

[0088] According to the optimization results of small-scale induced expression conditions, the expression was expanded and cultured. Monoclonal colonies were selected and placed in 5 mL of LB liquid culture medium containing chloramphenicol, and cultured overnight at 37°C and 220 rpm. The bacterial solution from the overnight culture was taken out and transferred to 200 ml of culture medium at a ratio of 1:100 for continued culture. The culture was first cultured at 37°C for 2 h, and then the temperature was set to 22°C and cultured for about 1.5 h. When the OD600 of the culture was 0.5-0.7, 5% L-arabinose inducer solution (final concentration was 0.02%) was added, and the induction culture was continued at 22°C incubator for 16 h. The overnight culture was transferred to 200 ml of culture medium at a ratio of 1:100. The cultured bacterial solution was centrifuged at 6000 rpm and 4°C for 20 min to collect the bacteria; the cell pellet was resuspended in 60 ml of periplasmic extraction buffer, and 1 μg / ml lysozyme was added and incubated at 4°C for 1 h. The protein sample was injected into the nickel column through an AKTA instrument, and the unadsorbed sample was washed away with 20 column volumes of equilibrium buffer at a flow rate of 1 ml / min to baseline equilibrium. 50 mM, 100 mM, and 500 mM imidazole were used to elute the protein. The collected proteins eluted from each concentration gradient were sampled and detected by SDS-PAGE and Western Blot. The results are shown in the following figure. Figure 6 The results showed that three soluble antibodies were successfully expressed and purified.

[0089] Example 3

[0090] Functional validation of recombinant nanobodies

[0091] (1) ELISA method to verify the binding ability of recombinant antibodies

[0092] The monovalent, divalent and trivalent purified nanobody proteins were diluted to 0, 0.2, 0.4, 0.6, 0.8, 1, 5, and 10 μg / ml as the primary antibody for detection; the NIV G protein was diluted to 10 μg / mL with ELISA coating solution the day before, 100 μL per well, and coated overnight at 4°C, and a negative control was set up at the same time. The next day, the cells were washed 3 times with PBST, 200 μL of 5% PBSM was added to each well and blocked at 37°C for 2h, 100 μL of primary antibody was added after washing, incubated at 37°C for 1h, washed again 3 times, and then 0.1 μg / ml of HRP-labeled mouse anti-His antibody diluted with PBSTM was added, 100 μL / well, and incubated at 37°C for 1h; after the incubation, the unbound antibody was washed away. Add TMB colorimetric solution and incubate at room temperature for 20 minutes; add 50 μL ELISA stop solution, read the absorbance value at 450 nm on an ELISA reader and perform data analysis. The results are as follows: Figure 7 As shown. The trimeric nanobody (trivalent, Nb3) can achieve a higher binding efficiency at a lower concentration (0.2μg / ml), while the dimeric nanobody (divalent, Nb2) can achieve the same binding efficiency at at least 5μg / mL, and Nb cannot achieve this binding efficiency at 10μg / mL. In summary, the NiV G binding capacity Nb3>Nb2>Nb.

[0093] (2) Western Blot method to verify the specificity of recombinant antibodies

[0094] Take NiV G protein as antigen, take appropriate amount of protein, add 5×SDS-PAGE loading buffer, mix evenly, boil in boiling water for 5-8min. After 12% SDS-PAGE electrophoresis, transfer to PVDF membrane by wet transfer method, incubate with purified monovalent, divalent and trivalent nanoantibodies against NiV G protein as primary antibodies at 4℃ overnight, wash 3 times with PBST; incubate with 1:2000 HRP-labeled goat anti-rabbit secondary antibody for 1h, wash 3 times with PBST; observe with ECL development and take pictures, the results are as follows Figure 8 All three can specifically bind to NiVG protein, but Nb2 and Nb3 have better binding effects.

[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nanobody targeting Nipah virus G protein, characterized in that: The amino acid sequence of the nanobody is shown in SEQ ID NO.

1.

2. A polymerized nanobody targeting Nipah virus G protein, characterized in that: The multimeric nanobody is obtained by polymerizing at least two nanobodies according to claim 1 using a GS Linker sequence.

3. The multimeric Nanobody according to claim 2, characterized in that The amino acid sequence of the GS Linker sequence is shown in SEQ ID NO.

2.

4. The multimeric Nanobody according to claim 2, characterized in that The amino acid sequence of the polymerized nanobody is shown in SEQ ID NO.3 or SEQ ID NO.

4.

5. A gene encoding the nanobody according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

5.

6. A gene encoding the multimeric nanobody according to claim 4, characterized in that: The nucleotide sequences of the genes encoding the multimeric nanobodies whose amino acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

7. An expression vector containing the gene according to claim 5 or claim 6.

8. The expression vector according to claim 7, characterized in that The expression vector includes PDX-init phagemid, pET-22b or pSB-init.

9. A host cell containing the expression vector according to claim 7 or 8.

10. Use of any of the following in the preparation of Nipah virus detection products, anti-Nipah virus drugs or anti-Nipah virus vaccines: (1) The Nanobody of claim 1; (2) The multimeric Nanobody of any one of claims 2-4; (3) The gene of claim 5 or 6; (4) The expression vector of claim 7 or 8; (5) The host cell of claim 9.

Images