Bacillus LH-HF0021 and microbial inoculant and use thereof
By developing Bacillus LH-HF0021 and its microbial agents, the problem of efficient detoxification of benzene series compounds and polycyclic aromatic hydrocarbons in styrene wastewater was solved, achieving efficient total nitrogen degradation and COD removal, thus improving the wastewater treatment effect.
Patent Information
- Application Number
- CN202311061017.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-22
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-08-22
AI Technical Summary
Existing technologies lack functional bacterial strains that can efficiently detoxify benzene series compounds and polycyclic aromatic hydrocarbons in styrene wastewater and bioenhance the removal of CODcr and degradation of total nitrogen in activated sludge. Furthermore, research and application of related bacterial agents are limited.
A strain of bacillus, LH-HF0021 (Diaphorobacter nitroreducens), is provided. This strain has a wide range of carbon source utilization capabilities and can proliferate in various benzene series compounds and polycyclic aromatic hydrocarbons such as benzene, toluene, ethylbenzene, and xylene. It also exhibits a high efficiency in removing total nitrogen from styrene wastewater. The strain can be prepared as a microbial agent for wastewater treatment.
The degradation rate of toxic substances such as benzene series compounds and polycyclic aromatic hydrocarbons in styrene wastewater was ≥99.36%, and the removal rate of CODCr and total nitrogen was ≥91.4%, which significantly improved the wastewater treatment effect.
Smart Images

Figure CN117305153B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology and environmental protection, and particularly relates to bacillus LH-HF0021 and a microbial inoculum thereof and application of the bacillus LH-HF0021 and the microbial inoculum thereof in styrene wastewater rich in benzene series and polycyclic aromatic hydrocarbons. BACKGROUND
[0002] Benzene series has the characteristics of wide pollution sources, long action time, high pollution concentration and long release period, and has been listed as a priority controlled pollutant by the United States Environmental Protection Agency (USEPA), and also has been listed in the environmental priority pollutant "blacklist" in China. Benzene series has strong carcinogenic effect, and can directly endanger the respiratory system, hematopoietic system, nervous system, reproductive system and other systems and organs of human body. Polycyclic aromatic hydrocarbons are a typical persistent organic pollutant, and have the characteristics of "three effects (carcinogenic, teratogenic and mutagenic)", high biological enrichment and difficult degradation. Common ways to repair benzene series or polycyclic aromatic hydrocarbon pollution include physical repair, chemical repair and biological repair. Biological repair is green and environmentally friendly, and has no secondary pollution and mild reaction conditions. The main body of microbial repair in biological repair is high-efficiency benzene series or polycyclic aromatic hydrocarbon degrading bacteria. At present, many bacteria, fungi and algae such as Pseudomonas, Rhodococcus, Flavobacterium, Mycobacterium, Nocardia and Micrococcus have the ability to degrade benzene series or polycyclic aromatic hydrocarbons.
[0003] In water pollution of petroleum and chemical industrial enterprises or their production facilities, benzene series, polycyclic aromatic hydrocarbons, COD Cr , total nitrogen and other pollutants are often combined, so there is a great demand for functional bacteria which can not only tolerate benzene series and polycyclic aromatic hydrocarbons, but also reduce total nitrogen and COD Cr . However, in actual research, many functional bacteria can only degrade several benzene series or polycyclic aromatic hydrocarbons, so it is necessary to develop functional strains which have a wider tolerance range and can not only eliminate the toxicity of benzene series and polycyclic aromatic hydrocarbons, but also remove COD Cr and total nitrogen in the system.
[0004] Styrene is a colorless yellow oil liquid, flammable, toxic, difficult to dissolve in water, can be dissolved in alcohol and ether, and is widely used in the production of plastics, synthetic rubber, resin and other productions, and is an important compound. A large amount of styrene will enter the atmosphere and water during the production, use, transportation and storage of styrene, causing air and water pollution, and being harmful to human health. There are few reports on biological treatment of styrene wastewater, and there are few bacterial liquids which can remove toxic pollutants such as benzene series, polycyclic aromatic hydrocarbons, COD Cr and total nitrogen in styrene. It is less to develop functional bacterial inoculum and further study its application parameters. SUMMARY
[0005] The present application solves one technical problem in the prior art, and provides a functional bacterium LH-HF0021 capable of efficiently removing benzene series and polycyclic aromatic hydrocarbons, degrading total nitrogen, and promoting activated sludge COD Cr removal and total nitrogen degradation.
[0006] Another technical problem solved by the present application is to provide a microbial inoculant prepared from the above-mentioned bacterium LH-HF0021.
[0007] Still another technical problem solved by the present application is to provide the use of the above-mentioned bacterium LH-HF0021 and the microbial inoculant prepared therefrom.
[0008] To achieve the above-mentioned purposes, the present application is implemented by the following technical solutions:
[0009] A bacterium LH-HF0021, which is classified as Diaphorobacter nitroreducens, has a preservation number of CGMCC No.27556. The preservation unit of the bacterium LH-HF0021 is the General Microbiological Center of the China Microbial Culture Collection Committee (CGMCC), located at No.3, Beichen West Road, Haidian District, Beijing, China, and the Institute of Microbiology, Chinese Academy of Sciences; the preservation date is June 5, 2023; and the preservation number of Diaphorobacter nitroreducens LH-HF0021 is CGMCC No.27556. The nucleotide sequence of the bacterium LH-HF0021 according to the present application is shown in SEQ ID No.1.
[0010] The characteristics of the strain of the present application are as follows:
[0011] 1. The colony of the strain LH-HF0021 grown on LB medium for 24 hours is ivory white, round, smooth and moist on the surface, with a neat edge, a diameter of 0.5-1 mm, and a G- bacterium body under a microscope, which appears rod-shaped (0.8 μm x 1.3 μm) with flagella under a transmission electron microscope at 6000 times.
[0012] 2. The bacterium LH-HF0021 according to the present application is aerobic and has no flagella, is positive for indole reaction and nitrate reduction test, and is positive for hydrogen peroxide enzyme, oxidase and ornithine decarboxylase. It can oxidize glucose to produce acid and utilize various carbohydrates such as myo-inositol, ethanol, sodium acetate, mucic acid and lemon water. It has tolerance to erythromycin at 15 μg / tablet, and has no tolerance to kanamycin, ampicillin and other 7 kinds of antibiotics.
[0013] 3. The growth salinity (calculated as NaCl) of the bacterium LH-HF0021 ranges from 0 to 6%, and the optimal NaCl concentration is 2%, which has a relatively wide salinity tolerance.
[0014] 4、The bacillus LH-HF0021 has the ability to proliferate with benzene, toluene, ethylbenzene, xylene, p-m-xylene, o-xylene, styrene, naphthalene, anthracene, phenanthrene, pyrene, diphenyl, phenol, sodium benzoate, salicylic acid, o-dihydroxybenzene, terephthalic acid, etc. as the only carbon source, and has a wide substrate range.
[0015] The bacillus LH-HF0021 can be cultured by the following method: under stress, 35.0 ppm of benzene, 35.5 ppm of ethylbenzene, 32.1 ppm of styrene, 9.8 ppm of naphthalene, 30℃, 180 r / min of shaking culture for 30 h, more than 90% of total nitrogen removal can be achieved at 14 h, and more than 97% of total nitrogen removal can be achieved at 22 h, and the bacillus LH-HF0021 has strong denitrification ability under the toxic stress of benzene series and polycyclic aromatic hydrocarbons.
[0016] The application also discloses a bacillus LH-HF0021 microbial inoculant, and the preparation comprises the following steps:
[0017] (1) Strain activation: the denitrifying bacillus LH-HF0021 is activated on a sterilized 10% LB culture medium, inoculated on a 2L tomato-shaped bottle slope, and cultured at 30℃ for 16 h, so that the tomato-shaped bottle slope is covered with bacterial slough, and a first-stage bacterial slough seed is obtained;
[0018] (2) Seed tank culture: the first-stage bacterial slough seed on the tomato-shaped bottle is inoculated into a sterilized seed tank containing a seed culture medium by using a sterilized and cooled inoculation shovel, and cultured at 30℃ for 18-20 h, so that a large number of exponential phase active bacteria are formed, and a second-stage seed culture solution is obtained;
[0019] The seed culture medium comprises the following components in g / L: fish peptone 12.5-13.0, sucrose 5.5-6.0, triammonium citrate 2.5-3.0, potassium dihydrogen phosphate 2.0-2.5, sodium acetate 0.5-0.75, calcium carbonate 0.3-0.5, ammonium chloride 0.3-0.5 and Tween-80 0.2-0.3; the initial pH is adjusted to 7.8-8.0; and the liquid filling amount is 60%-62%.
[0020] Real consumption conditions: constant temperature 116℃ for 25 min; culture conditions: constant temperature 30℃±1℃, tank pressure 0.05Mpa, rotation speed 180-185 rpm / min; and ventilation amount 13-15 m 3 / h;
[0021] (4) Production tank culture: the second-stage seed culture solution in the seed tank is transferred to a production tank for fermentation culture, and cultured at 30℃ for 46 h; when the bacterial content of the fermentation liquid is stable, the tank is stopped, and the denitrifying bacillus LH-HF0021 fermentation liquid is obtained; and the bacterial content generally reaches 130×10 8CFU / ml-140×10 8 CFU / ml;
[0022] The fermentation medium component g / L includes: phenol 5.5-6.0, ammonium sulfate 2.5-3.0, dipotassium hydrogen phosphate 2.5-3.0, magnesium chloride 1.5-2.0, copper sulfate 0.5-1.0, antifoam agent 0.4-0.5, pH 7.8-8.0; 58%-60% liquid loading amount;
[0023] Real consumption conditions: constant temperature 116 DEG C for 30 min; culture conditions: constant temperature 30 DEG C ± 1 DEG C, tank pressure 0.05 Mpa, rotation speed 0-13 h 175 rpm, 14-46 h 195 rpm; ventilation volume 0-13 h 135-140 m 3 / h, 14-46 h 155-160 m 3 / h;
[0024] (4) freeze-drying: the denitrifying parabacteroides LH-HF0021 fermentation broth is moved to a GQ105 tubular centrifuge, centrifuged at 10000 rpm for 1 min, and more than 85% of the fermentation broth is removed by precision filtration centrifugation, and the bacterial slurry is collected, freeze-drying protective agent is added, and mixed and prepared; freeze-drying, freezing temperature is -35--33 DEG C, freeze-drying time is 4.5-5d, obtain the freeze-dried bacterial powder of denitrifying parabacteroides LH-HF0021, the bacterial amount is 1800×10 8 -2000×10 8 CFU / g; the components of the freeze-drying protective agent are skim milk 5%, potassium tripolyphosphate 3%, VC 2%, sodium glutamate 1.5%, and the content is the mass ratio of the bacterial slurry;
[0025] (5) product compounding: the concentrated freeze-dried bacterial powder of denitrifying parabacteroides LH-HF0021 is prepared with a solid carrier in a mass ratio of 1-1.2: 890-895, and a microbial agent with 2-2.6×10 8 CFU / g is prepared, wherein the solid carrier is sodium calcium silicate aluminate.
[0026] The application also discloses the use of the bacillus LH-HF0021 and the microbial agent thereof.
[0027] Preferably, in application, the bacillus LH-HF0021 is prepared into a dilute bacterial solution with a bacterial content of 2.0-2.6×10 6 CFU / ml, and inoculated into a styrene wastewater system in a proportion of 0.3-0.5%.
[0028] Preferably, in the application, the experimental group added with the bacillus LH-HF0021 functional bacterial agent shown in the application has a degradation rate of toxic substances such as benzene series and polycyclic aromatic hydrocarbons of ≥99.36% under the comprehensive stress of ≥300ppm of benzene series and polycyclic aromatic hydrocarbon toxic substances, and the removal rates of COD Cr , total nitrogen and nitrite nitrogen are all ≥91.4%, and the increase of the control group of pure active sludge is all ≥37.98%, which has a strong detoxification and biological strengthening effect.
[0029] Compared with the prior art, the application has the following advantages and technical effects:
[0030] 1. The bacillus LH-HF0021 has the ability to proliferate by taking benzene, toluene, ethylbenzene, xylene, p-m-xylene, o-xylene, styrene, naphthalene, anthracene, phenanthrene, pyrene, diphenyl, phenol, sodium benzoate, salicylic acid, o-diphenol and terephthalic acid as the only carbon source, and has a wide substrate range.
[0031] 2. The growth salinity (calculated by NaCl) of the bacillus LH-HF0021 ranges from 0 to 6%, and the optimal NaCl concentration is 2%, which has a relatively wide salinity tolerance.
[0032] 3. The bacillus LH-HF0021 can simultaneously degrade various toxic pollutants such as benzene, ethylbenzene, xylene, styrene and naphthalene, and also has a strong ability to reduce total nitrogen and nitrite nitrogen through denitrification, and can be used for removing multiple indicators such as benzene series, polycyclic aromatic hydrocarbons, COD Cr , total nitrogen and nitrite nitrogen in wastewater.
[0033] 4. The bacillus LH-HF0021 is separated from groundwater in a pollution area rich in benzene series, and has a strong in-situ adaptation effect in the water environment.
[0034] 5. The preparation method of the bacillus LH-HF0021 starter is simple, reasonable and fast to operate, and can significantly improve the COD Cr removal, total nitrogen and other effects of the biochemical system without changing the structure, has a strong benzene series and polycyclic aromatic hydrocarbon detoxification capacity and COD Cr removal effect, and has a good industrialization implementation prospect. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 is a benzene degradation curve of the bacillus LH-HF0021;
[0036] Figure 2 is a plate colony diagram of the bacillus LH-HF0021;
[0037] Figure 3Transmission electron microscopy image of bacillus LH-HF0021;
[0038] Figure 4 Neighbor-joining phylogenetic tree of bacillus LH-HF0021;
[0039] Figure 5 This is a diagram showing the substrate specificity of the bacillus LH-HF0021.
[0040] Figure 6 The HPLC chromatogram shows the degradation of naphthalene by bacillus LH-HF0021.
[0041] Figure 7 Optimization of naphthalene degradation conditions for bacillus LH-HF0021;
[0042] Figure 8 Results of resistance of bacillus LH-HF0021 to 8 antibiotics;
[0043] Figure 9 Qualitative determination of nitro reduction in bacillus LH-HF0021;
[0044] Figure 10 The degradation curves of total nitrogen in bacillus LH-HF0021 under no and toxic stress are shown. Detailed Implementation
[0045] The technical solution of the present invention will be further described in detail with reference to the following specific examples.
[0046] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.
[0047] The required culture medium or test reagent formulations in the examples are as follows:
[0048] Inorganic salt medium (MSM): K2HPO4·3H2O 1g, KH2PO4 1g, (NH4)2SO4 0.5g, MgSO4·7H2O 0.36g, KNO3 0.5g, CaCl2 0.001g, 1mL trace element stock solution, 1000mL distilled water, solid medium with 1.5% agar.
[0049] Acclimation medium: KH2PO4 338.8mg, Na2HPO4·12H2O 890.7mg, (NH4)2SO4 234mg, Na2CO3 100mg, MgSO4·7H2O 59.3mg, CaCl2·2H2O 5.16mg, FeSO4·7H2O 0.37mg, 1mL trace element stock solution, 1000mL distilled water, and 1.5% agar added to solid culture medium.
[0050] Trace element stock solution: FeCl2·4H2O 1500mg, Na2MoO4·2H2O 24mg, ZnCl2 70mg, MnCl2·4H2O 6mg, CoCl2·6H2O 190mg, MnSO4·7H2O 100mg, CuCl2·2H2O 2mg, NiCl2·6H2O 24mg, distilled water 1000mL.
[0051] LB medium: 10g peptone, 5g yeast extract, 10g NaCl, 1000mL distilled water, solid medium with 1.5% agar.
[0052] Denitrification characteristic test medium: 20g peptone, 3g beef extract, 5g NaCl, 1g potassium nitrate, pH adjusted to 7.4 with sodium carbonate or hydrochloric acid solution. + 0.2, 1000 mL of distilled water, dispensed into test tubes;
[0053] Denitrification characteristic test solution A: 0.5g p-aminobenzenesulfonic acid, dissolved in 150mL 10% acetic acid solution;
[0054] Denitrification characteristic test solution B: 0.1g of naphthylamine was added to 20mL of water and 150mL of 10% acetic acid solution;
[0055] All of the above culture media must be sterilized at 116℃ for 30 minutes before use.
[0056] Example 1: Screening, identification, gene modification, and preservation of bacillus LH-HF0021
[0057] 1. Isolation and screening of bacillus LH-HF0021
[0058] (1) Sample and index determination: The purity of benzene, ethylbenzene, styrene, and naphthalene is ≥99%. Detection instrument: The instrument for detecting benzene series compounds is a headspace gas chromatograph GC-2010Plus (Shimadzu, Japan), detector: FID, chromatographic column: Agilent J&W HP-PLOT / Q+PT (30m×0.53mm×40μm). The determination of polycyclic aromatic hydrocarbons is based on standard HJ 478-2009 Water Quality - Determination of Polycyclic Aromatic Hydrocarbons - Liquid-liquid extraction and solid-phase extraction high-performance liquid chromatography, etc.
[0059] (2) Strain screening: 200 mL of groundwater from a benzene contaminated site in Suzhou was centrifuged at 10,000 rpm for 15 min, and the supernatant was discarded. 10 ml of MSM medium was added, vortexed and resuspended, and then transferred to a 250 mL conical flask containing 90 mL of MSM medium. Three of the flasks were sterilized by high-pressure steam as negative controls, and the other three were used as positive control groups. Then, benzene stock solution was added to each flask (final concentration of 30 mg / L). The enrichment culture was carried out at 30°C and 180 rpm. 1 mL of bacterial solution was taken every day for gas chromatography detection to determine the degradation of benzene. When the benzene degradation rate reached 75%, the culture was diluted to 10% by volume and inoculated into MSM medium. The enrichment culture was continued under the same conditions, and naphthalene stock solution was added. When the added naphthalene was completely degraded, the culture was diluted to 10% by volume and subcultured, and the concentration of naphthalene was increased to 90 mg / L with each generation until a strain that could efficiently degrade high-concentration benzene was obtained.
[0060] The last generation of benzene-degrading bacteria was gradient diluted in test tubes to obtain dilutions of 10-1, 10-2, 10-3, 10-4, 10-5, and 10-6. 100 μL of each dilution was taken and spread on 10% LB plates containing 100 mg / L benzene. Three parallel samples were prepared for each dilution. The plates were wrapped with sealing film for two weeks and incubated in an inverted position at 30°C.
[0061] Purification: Single colonies with different morphologies were selected from the culture dishes and inoculated into 2 mL of 10% LB medium containing about 100 mg / L benzene for overnight culture. The culture was further purified by plate streaking, and the process was repeated three times to obtain pure strains with single morphology.
[0062] Single colonies were selected from the plates and cultured in 10% LB medium containing 100 mg / L benzene to the exponential phase. The resulting bacterial solution was inoculated into MSM containing benzene and cultured at 30°C and 180 rpm to verify whether each single colony had benzene-degrading function.
[0063] A benzene-degrading aerobic bacterial strain LH-HF0021 was isolated from groundwater from a benzene-contaminated site in Suzhou. The strain could completely degrade 1000 μM (~92 mg / L) of benzene in 36 hours, and the biomass OD600 of the strain LH-HF0021 increased from 0.05 to 0.32 Figure 1 , indicating that the strain LH-HF0021 could grow using benzene as the sole carbon and energy source.
[0064] 2. Morphology and transmission electron microscopy of Bacillus LH-HF0021
[0065] The colonies of the strain LH-HF0021 grown on LB medium for 24h are ivory white, round, smooth and wet surface, regular edge, 0.5-1mm in diameter; the bacteria are G Figure 2 . - .
[0066] The strain LH-HF0021 is streaked on 10% LB solid agar medium containing 100mg / L benzene for 36h, then the colonies are picked, diluted into suspension with ultrapure water, dropped on dry glass slides, and then the copper mesh with supporting membrane is floated on the liquid beads of the suspension to pick up the sample; then, the excess suspension on the copper mesh is absorbed with filter paper, and the copper mesh is floated on the dye droplet for 1-2min, and finally the dye is absorbed with filter paper, and then the sample can be observed with transmission electron microscope. The results of transmission electron microscope of LH-HF0021 at 6000 times are shown in Figure 3 , which are rod-shaped, 0.8μm×1.3μm, with flagella.
[0067] 3. Determination of 16S rRNA sequence of bacillus LH-HF0021
[0068] The DNA of the strain LH-HF0021 is used as template, and the sequence is determined after amplification using 16S rDNA universal primer. The sequence is shown in SEQ ID No.1. The 16S universal gene primer is: 27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT. The obtained 16S rDNA sequencing results of the strain LH-HF0021 are input into NCBI database for BLAST comparison, and relevant model strains are obtained. After preliminary processing of the target sequence and model strain sequence using ClustalX1.81, MEGA4.0 is used to construct a phylogenetic tree according to the Neighbor-joining method. The results are shown in Figure 4 , and the 16S rRNA gene of the strain LH-HF0021 is highly similar to that of Diaphorobacter nitroreducens strain NA10B, so the strain LH-HF0021 is determined as Diaphorobacter nitroreducens LH-HF0021.
[0069] 4. Preservation of the strain LH-HF0021
[0070] The screened strain LH-HF0021 is preserved, and the preservation unit of the bacillus LH-HF0021 is: China General Microbiological Culture Collection Center (CGMCC), address: No. 1, Beichen West Road, No. 3, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; the preservation date is June 5, 2023; the preservation number of Diaphorobacter nitroreducens LH-HF0021 is: CGMCC No. 27556.
[0071] Example 2: Substrate broad-spectrum test of the strain of bacillus LH-HF0021
[0072] The bacillus LH-HF0021 logarithmic growth phase bacterial liquid is inoculated into 30 mL inorganic salt medium containing benzene, toluene, ethylbenzene, dimethylbenzene, p-methylbenzene, o-dimethylbenzene, styrene, naphthalene, anthracene, phenanthrene, pyrene, diphenyl, phenol, sodium benzoate, salicylic acid, o-diphenol, terephthalic acid (all at a concentration of 20 ppm) at an inoculation amount of 10%, and cultured at 30°C with shaking at 180 r / min for 48 h. The OD600 value of each sample was measured, and three parallel groups were set. Through the exploration of the growth substrate diversity of bacillus LH-HF0021, the results are shown in Table 2, indicating that the growth substrate has broad spectrum, especially the utilization ability of benzene, styrene and naphthalene is stronger. Figure 5
[0073] Example 3: Naphthalene degradation characteristics and degradation condition optimization of the strain of bacillus LH-HF0021
[0074] A single colony was picked from the plate and inoculated into 100 mL 10% LB culture medium, which was cultured at 30°C and 180 rpm to the exponential phase, centrifuged at 6000 rpm for 5 min, the bacterial cells were collected, washed twice with 15 ml sterile MSM medium, and finally resuspended with 5 mL MSM medium to obtain the seed liquid.
[0075] The seed liquid was inoculated into 20 mL MSM medium, and the initial OD600 of the seed liquid was adjusted to 1, the inoculation amount was 1%, 3%, 5%, 8% and 10% respectively, 10 ml inorganic salt medium was added and the final concentration of naphthalene was 100 mg / L, and the shaking speed was 180 rpm. After 5 h, the naphthalene final concentration (liquid chromatography) was detected, and the naphthalene degradation rate of the strain LH-HF0021 was as follows Figure 6 As shown in Table 3, when the inoculation amount is 8%, the naphthalene degradation rate of the strain LH-HF0021 is the highest, and the degradation rate is 89.54%.
[0076] The seed liquid was inoculated into 20 mL MSM medium, the initial OD600 of the seed liquid was adjusted to 1, the pH values of the medium were adjusted to 5, 6, 7, 8 and 9 respectively, the shaking table temperatures were set to 16℃, 25℃, 30℃, 35℃ and 37℃ respectively, 10 ml inorganic salt medium was inoculated and the final concentration of naphthalene was added to 100 mg / L, and the shaking speed was 180 rpm. After 14 h, the final concentration of naphthalene was detected (liquid chromatography), and the naphthalene degradation condition optimization of the strain Bacillus L H-HF0021 was obtained as follows Figure 7 As shown in A and B of FIG. 1, the results show that the degradation rate of the strain L H-HF0021 to naphthalene is the highest when the pH of the medium is 8, and the degradation rate is 95.40%, and it is determined that the degradation effect is the best at 30℃.
[0077] On the basis of the basic culture conditions (1% inoculation amount, 100 ml / 250 ml liquid loading amount, fermentation temperature of 30℃, pH 8.0, and rotation speed of 180 rpm), the type of carbon source was changed (including citric acid, lactose, sucrose, glucose and maltose, the concentration was 1%), the remaining component conditions were fixed, the OD600 of the seed liquid was adjusted to 1.025, the inoculation amount was 1% (v / v), and three repeats were made at each level, and the strain growth was determined after 48 h of culture. The most suitable carbon source type in the growth process of the strain L H-HF0021 was obtained. After the best carbon source was determined, on the basis of the basic culture conditions (1% inoculation amount, 100 ml / 250 ml liquid loading amount, fermentation temperature of 30℃, pH 8.0, and rotation speed of 180 rpm), the most suitable carbon source was used as the only carbon source and the concentration was changed (the concentration was set to 1%, 3%, 5%, 6.5% and 8%), the remaining component conditions were fixed, the OD600 of the seed liquid was adjusted to 1.103, the inoculation amount was 1% (v / v), and three repeats were made at each level, and the strain growth was determined after 48 h. The growth of the strain L H-HF0021 under different carbon source concentrations was obtained.
[0078] The results are shown in C and D of FIG. 2. Figure 7 As shown in C and D of FIG. 2, the strain L H-HF0021 grows best when maltose is used as the only carbon source, and the most suitable maltose concentration is 8%.
[0079] On the basis of the basic culture conditions (1% inoculation amount, 100 ml / 250 ml loading amount, fermentation temperature 30°C, pH 8.0, rotation speed 180 rpm), the nitrogen source type (including yeast powder, urea, peptone, ammonium chloride and ammonium sulfate, a total of 5 kinds, concentration 1%) was changed on the basis of the inorganic salt medium, the rest of the component conditions were fixed, the seed liquid OD600 was adjusted to 1.103, the inoculation amount was 1% (v / v), 3 repeats were made at each level, the strain growth was determined after 48 h of culture. The most suitable nitrogen source type in the growth process of the strain LH-HF0021 was obtained, the most suitable nitrogen source was used as the only nitrogen source, the nitrogen source concentration (concentration set to 1%, 3%, 5%, 8% and 10%) was changed, the rest of the component conditions were fixed, the seed liquid OD600 was adjusted to 1.0, the inoculation amount was 1% (v / v), 3 repeats were made at each level, the strain growth was determined after 48 h.
[0080] The results are shown in E and F of Figure 7 The results are shown in E and F of
[0081] Example 3: Physiological and biochemical characteristics and antibiotic resistance of bacillus LH-HF0021
[0082] 1. Physiological and biochemical characteristics of bacillus LH-HF0021
[0083] After the bacillus LH-HF0021 was cultured in the modified nutrient agar medium, the physiological and biochemical characteristics of the strain were determined according to the physiological and biochemical detection methods in the "Berger Bacterium Identification Manual" and the "Common Bacterium System Identification Manual", and the results are shown in Table 1:
[0084] Table 1. Physiological and biochemical characteristics of bacillus LH-HF0021
[0085]
[0086] Note: "+" indicates that the biochemical reaction or gram staining is positive; "-" indicates that the biochemical reaction or gram staining is negative.
[0087] Bacillus LH-HF0021 can grow and reproduce at a temperature range of 20-50°C, but its optimum growth temperature is 30°C; it can grow and reproduce at a pH range of 4.0-9.0, but its optimum growth pH is 8; it can normally grow at a NaCl range of 0%-6%, and the optimum growth salinity of NaCl is 2%, indicating that the strain has strong salinity (calculated as NaCl) tolerance. Other physiological and biochemical characteristics of Bacillus LH-HF0021 are: aerobic, non-flagellated, positive for indole reaction, positive for nitrate reduction test, positive for peroxidase, oxidase and ornithine decarboxylase, can oxidize glucose to produce acid, and can utilize myo-inositol, ethanol, sodium acetate, mucic acid, citric acid and other various carbohydrates.
[0088] 2. Antibiotic resistance of Bacillus LH-HF0021
[0089] The sensitivity test of the degradation strain to antibacterial drugs was carried out according to the instruction manual of the antibiotic sensitivity paper. Each paper contains 10-30 μg / paper of antibiotic, involving kanamycin (K), erythromycin (E), streptomycin (S), ampicillin (AM), tetracycline (TE), chloramphenicol (C), penicillin (P) and gentamicin (GM). The results are shown in Table 2 and Figure 8 :
[0090] Table 2 Antibiotic resistance results of Bacillus LH-HF0021
[0091]
[0092] Note: (+ represents that the strain has tolerance to the corresponding antibiotic; - represents that the strain does not have tolerance to the corresponding antibiotic)
[0093] The results show that Bacillus LH-HF0021 has tolerance to 15 μg / paper of erythromycin, and does not have tolerance to other seven kinds of antibiotics such as kanamycin and ampicillin.
[0094] Example 4: Nitro reduction characteristics of Bacillus LH-HF0021
[0095] (1) Determination of nitro reduction characteristics of Bacillus LH-HF0021 by standard qualitative method
[0096] According to the standard method of biological agents for water treatment - denitrifying bacteria in HG / T 5926-2021, the strain is inoculated into the denitrification characteristic test medium, cultured at 36°C for 2d, and 1 drop of liquid A and liquid B is added, and the denitrification characteristics of the strain Bacillus LH-HF0021 and other strains are investigated. If the solution turns red or orange, it is positive for nitrate, and the results are shown in Figure 9 and Table 3.
[0097] Table 3 Nitro-reduction qualitative results of bacillus LH-HF0021 and other strains
[0098]
[0099] Figure 10 Table 2 shows the nitro-reduction qualitative results of bacillus LH-HF0021 and other strains.
[0100] Compared with other strains, the color of the red reaction of the denitrifying flavobacterium LH-HF0021 is darker, and it has stronger denitrification characteristics.
[0101] (2) Total nitrogen degradation curve of bacillus LH-HF0021 under the stress of toxic substances such as benzene, ethylbenzene, styrene, naphthalene, etc.
[0102] The formula of the denitrification experiment medium is: glucose 1.0 g / L, potassium nitrate 0.5 g / L, sodium nitrite 0.152 g / L, potassium phosphate dibasic 0.05 g / L, magnesium sulfate heptahydrate 0.1 g / L, ferrous sulfate heptahydrate 0.2 g / L.
[0103] In the denitrification experiment medium, the control group is only the denitrification test medium without toxic substance stress, and the experimental group is additionally added with 35.0 ppm of benzene, 35.5 ppm of ethylbenzene, 32.1 ppm of styrene, and 99.8 ppm of naphthalene to simulate the toxic substance stress environment of waste water. After 30 h of culture at 30℃ and 180 r / min of shaking, the degradation effects of total nitrogen under stress and non-stress are observed, and the results are shown in Table 3. Figure 10
[0104] Figure 10 The results show that with the extension of culture time, the total nitrogen of the control group and the experimental group shows a downward trend, and more than 90% of degradation can be achieved at 14 h, and more than 97% of degradation can be achieved at 22 h. However, under the stress of toxic substances such as benzene, ethylbenzene, styrene, and naphthalene, the total nitrogen degradation trend of the experimental group is similar to that of the control group, indicating that the stress of toxic substances such as benzene series and polycyclic aromatic hydrocarbons does not affect the denitrification performance of bacillus LH-HF0021.
[0105] Example 5: Preparation of bacillus LH-HF0021 microbial inoculant
[0106] The preparation process of the bacillus LH-HF0021 powder includes the following steps:
[0107] (1) Strain activation: activate the denitrifying bacillus LH-HF0021 on the sterilized 10% LB medium, inoculate on a 2L tomato-shaped bottle slope, and culture at 30℃ for 16 h. After that, the tomato-shaped bottle slope is covered with bacterial slime, and the first-stage bacterial slime seed is obtained.
[0108] (2) Seed tank culture: using sterilized and cooled inoculation shovel, the first level of bacterial seed on the eggplant bottle is inoculated into the sterilized seed tank containing seed culture medium, and is cultured at 30℃ for 18-20h to form a large number of active bacteria in the exponential phase, which is used as the secondary seed culture solution. The components of the seed culture medium include (g / L): fish peptone 12.5-13.0, sucrose 5.5-6.0, triammonium citrate 2.5-3.0, potassium dihydrogen phosphate 2.0-2.5, sodium acetate 0.5-0.75, calcium carbonate 0.3-0.5, ammonium chloride 0.3-0.5, Tween-80 0.2-0.3; the initial pH is adjusted to 7.8-8.0. The volume of the seed tank is 2m 3 , and the liquid loading amount is 60%-62%. The actual killing conditions are: constant temperature 116℃ for 25min; the culture conditions are: constant temperature 30℃±1℃, tank pressure 0.05Mpa, rotation speed 180-185rpm / min; and the ventilation amount is 13-15m 3 / h.
[0109] (3) Production tank culture: the secondary seed culture solution in the seed tank is transferred to the production tank for fermentation culture, and is cultured at 30℃ for 46h, and the tank is stopped when the bacterial amount of the fermentation broth is stable, so as to obtain the denitrifying Pseudomonas LH-HF0021 fermentation broth, and the bacterial content generally reaches 130×10 8 CFU / ml-140×10 8 CFU / ml when the tank is discharged. The components of the fermentation culture medium include (g / L): phenol 5.5-6.0, ammonium sulfate 2.5-3.0, dipotassium hydrogen phosphate 2.5-3.0, magnesium chloride 1.5-2.0, copper sulfate 0.5-1.0, defoaming agent 0.4-0.5, pH 7.8-8.0. The volume of the production tank is 20m 3 , and the liquid loading amount is 58%-60%. The actual killing conditions are: constant temperature 116℃ for 30min; the culture conditions are: constant temperature 30℃±1℃, tank pressure 0.05Mpa, rotation speed 175rpm for 0-13h, 195rpm for 14-46h; and the ventilation amount is 135-140m 3 / h for 0-13h, 155-160m 3 / h for 14-46h.
[0110] (4) Freeze-drying: the denitrifying Pseudomonas LH-HF0021 fermentation broth is moved into a GQ105 tubular centrifuge, centrifuged at 10000rpm for 1min, and more than 85% of the fermentation broth is removed by precision filtration centrifugation to collect the bacterial slurry, add a freeze-drying protective agent, and mix and prepare; the freeze-drying is carried out by using an FD12-QX benchtop freeze-drying machine, the freezing temperature is-35--33℃, the freeze-drying time is 4.5-5d, and the denitrifying Pseudomonas LH-HF0021 freeze-dried bacterial powder is obtained, and the bacterial amount is 1800×10 8 -2000×10 8CFU / g. The components of the freeze-drying protectant are skim milk 5%, potassium tripolyphosphate 3%, VC 2%, and sodium glutamate 1.5%, all in terms of mass ratio of the bacterial slurry.
[0111] (5) Product compounding: the concentrated freeze-dried bacterial powder of the denitrifying bacillus LH-HF0021 is compounded with a solid carrier at a mass ratio of 1-1.2: 890-895, and is prepared into 2-2.6 x 10 8 CFU / g of microbial inoculant, wherein the solid carrier is sodium calcium silicate aluminate.
[0112] Example 6: Effect of bacillus LH-HF0021 inoculant on removal of COD and total nitrogen in styrene wastewater under gradient toxicant stress
[0113] The bacillus LH-HF0021 microbial inoculant described in Example 5 is applied to the styrene wastewater under gradient toxicant stress, and 29.9-100.2 ppm of benzene, 30.3-100.2 ppm of ethylbenzene, 30.1-100.2 ppm of styrene, and 9.8-10.3 ppm of naphthalene are compounded into three kinds of comprehensive gradient concentrations of toxicants ≥100, 200, or 300 to form a gradient toxicant stress environment of the styrene wastewater; the wastewater also contains 400 ppm of initial CODCr and 50 ppm of initial total nitrogen as the experimental research object, and 250 ml of airtight blue mouth bottles are used as the experimental system. The activated sludge in the aerobic O tank of this kind of wastewater is used as the experimental sludge, and the sludge concentration is 3830 ppm. After being washed twice with distilled water, the experimental wastewater is resuspended by an equal amount, and is ready for use. The control series only adds the activated sludge, and the amount of sludge is 5 ml per group; the experimental series additionally adds 100 times diluted solution of the carrier or LH-HF0021 inoculant at a 0.3% inoculation ratio on the basis of adding an equal amount of activated sludge, and the diluted bacterial solution has a bacterial content of 2.0-2.6 x 10 6 CFU / ml, and the reaction conditions are 180 rpm / min, 30°C, initial pH = 8, and reaction for 24 h. The terminal concentration of benzene series is determined by HJ 1067-2019, the COD content of the system is determined by the method for determination of chemical oxygen demand of water (HJ 828-2017), and the total nitrogen is determined by the method for determination of total nitrogen of water (HJ 636-2012). The effects of activated sludge, activated sludge + carrier, and activated sludge + LH-HF0021 inoculant groups on removal of toxic benzene series, polycyclic aromatic hydrocarbons, COD Cr , and total nitrogen in the system are investigated, and the results are shown in Tables 4 and 5.
[0114] Table 4. The influence of the bacillus LH-HF0021 microbial inoculant of the present application on the content of toxic substances in styrene wastewater under gradient toxic substance stress
[0115]
[0116]
[0117] Table 5. The influence of the bacillus LH-HF0021 microbial inoculant of the present application on the degradation of toxic substances benzene series and polycyclic aromatic hydrocarbons and the removal of COD and total nitrogen in styrene wastewater under gradient toxic substance stress
[0118]
[0119] The results show that the control group using only activated sludge has a COD Cr and total nitrogen removal rate of less than 70%, a benzene series degradation rate of less than 76%, and a polycyclic aromatic hydrocarbon degradation rate of less than 43%, indicating that the activated sludge is poisoned by toxic substances such as benzene, ethylbenzene, styrene, and naphthalene, and the ability to biologically remove COD Cr and total nitrogen is weakened, and as the combined concentration of toxic substances increases, the degradation rate data gradually deteriorate, resulting in high effluent indicators that cannot meet the requirements of the water pollution special discharge limit value in the Inorganic Chemical Industry Pollutant Discharge Standard GB 31573-2015. Compared with the control group using only activated sludge, the addition of the carrier slightly improves the degradation rates of benzene series and polycyclic aromatic hydrocarbons by 4.76-5.60% and 11.45-13.07%, respectively, and the removal rates of COD Cr and total nitrogen also increase by a certain margin, by 5.51-6.57% and 7.34-8.76%, respectively; it is speculated that the large specific surface area of the carrier promotes the attachment of activated sludge and the exertion of biochemical properties. In the experimental group with the addition of the bacillus LH-HF0021 functional inoculant of the present application, under the combined stress of ≥300 ppm of benzene series and polycyclic aromatic hydrocarbon toxic substances, the degradation rates of benzene series and polycyclic aromatic hydrocarbon toxic substances are all ≥99.36%, the removal rates of COD Cr and total nitrogen are all ≥91.24%, and the inoculant has strong detoxification and bioaugmentation effects. Compared with the carrier group, the benzene series degradation rate is increased by 18.99-22.31%, the polycyclic aromatic hydrocarbon degradation rate is increased by 45.62-52.17%, the COD Cr removal rate is increased by 20.74-33.67%, and the total nitrogen rate is increased by 29.89-47.84%, and as the combined concentration of toxic substances increases, the increase gradually increases, ultimately achieving a benzene, ethylbenzene, styrene, naphthalene, COD Crand total nitrogen and other indicators meet the direct discharge standard, which shows that the bacillus LH-HF0021 microbial inoculant can promote the degradation of benzene, ethylbenzene, styrene, naphthalene and other toxic substances in the styrene wastewater under the comprehensive stress of gradient toxic substances, reduce the toxic stress of the active sludge, and further promote the biochemical efficiency, and further improve the COD Cr and total nitrogen removal rate.
[0120] Example 7: Effect of application inoculation ratio of bacillus LH-HF0021 microbial inoculant on COD Cr and total nitrogen removal
[0121] The bacillus LH-HF0021 microbial inoculant in Example 5 was applied to the styrene wastewater of a chemical enterprise in Lianyungang, Jiangsu Province under the stress of gradient toxic substances, which contained 35.3 ppm of benzene, 9.6 ppm of ethylbenzene, 15.3 ppm of dimethylbenzene, 82.4 ppm of styrene, 5.3 ppm of naphthalene, 500.15 ppm of initial CODCr and 65.25 ppm of initial total nitrogen, as the experimental research object, and 250 ml closed blue mouth bottle as the experimental system. The active sludge of the wastewater aerobic O pool was used as the experimental sludge, and the sludge concentration was 3320 ppm. After being washed twice with distilled water, the experimental wastewater was resuspended in an equal amount, and was ready for use. The control group only added active sludge, and the sludge amount was 5 ml / group; the experimental group was additionally inoculated with the bacillus LH-HF0021 prepared into a dilute bacteria solution with a bacteria content of 2.0-2.6 x 10 6 CFU / ml at a gradient inoculation ratio of 0.1-0.8%; the reaction conditions were 180 rpm / min, 30°C, initial pH=8, and reaction for 24 h; the terminal concentration of benzene series was determined by HJ1067-2019, the COD content of the system was determined by water quality chemical oxygen demand determination dichromate method (HJ 828-2017), and the total nitrogen was determined by water quality total nitrogen determination alkaline potassium persulfate digestion ultraviolet spectrophotometry (HJ 636-2012). The effect of application inoculation ratio of LH-HF0021 microbial inoculant on the degradation of toxic benzene series and polycyclic aromatic hydrocarbons and the removal of COD Cr , total nitrogen and other indicators in the styrene wastewater was investigated, and the results are shown in Tables 76 and 8.
[0122] Table 6. Effect of application inoculation ratio of bacillus LH-HF0021 microbial inoculant on the content of toxic substances in the styrene wastewater
[0123]
[0124]
[0125] Table 7. The application of the bacillus LH-HF0021 microbial inoculum described in the present application to the degradation of toxic substances benzene series, polycyclic aromatic hydrocarbons and COD in styrene wastewater Cr , and the influence on total nitrogen removal
[0126]
[0127] The results show that the control group with only activated sludge has a COD Cr and total nitrogen removal rate of 53.09% and 63.91%, respectively, a benzene series degradation rate of 51.11%, and a polycyclic aromatic hydrocarbon degradation rate of 46.60%. This indicates that the activated sludge has been poisoned by toxic substances such as benzene, ethylbenzene, xylene, styrene, and naphthalene, and its ability to biologically remove COD Cr and total nitrogen has weakened, resulting in high effluent indicators that do not meet the requirements of the water pollution special discharge limit value in the Inorganic Chemical Industry Pollutant Discharge Standard GB 31573-2015. Compared with the control group with only activated sludge, the experimental group with the addition of the bacillus LH-HF0021 functional inoculum described in the present application significantly improves the COD Cr and total nitrogen removal rate, with degradation rates of ≥83.52% and 87.54%, respectively, both achieving standard discharge with total nitrogen below 30. The results show that the application effect of the bacillus LH-HF0021 functional inoculum gradually increases with the application inoculum dose increasing from 0.1% to 0.8%, especially when the application inoculum dose reaches 0.3%-0.5%, the COD Cr of the experimental group is ≤36.78 ppm, achieving standard discharge. This indicates that the dilution of the bacillus LH-HF0021 microbial inoculum described in the present application, at an application inoculum dose of 0.3-0.5%, can promote the effective degradation of toxic substances such as benzene, ethylbenzene, xylene, styrene, and naphthalene in styrene wastewater, reduce their toxic stress on activated sludge, promote the removal of COD
[0128] Example 8: Bioaugmentation effect of bacillus LH-HF0021 inoculum on styrene wastewater from a chemical enterprise in Lianyungang
[0129] The bacillus LH-HF0021 microbial inoculum described in the present application in Example 5 was applied to the experimental object under gradient toxic substance stress: styrene wastewater from a chemical enterprise in Lianyungang, which mainly contains ethylbenzene 7.9 ppm, xylene 2.5 ppm, styrene 79.0 ppm, and naphthalene 3.9 ppm, with an initial COD Cr of 224 ppm, an initial total nitrogen of 25.35 ppm, and an initial nitrite of 18.22 ppm, as the research object of this experiment.
[0130] The experimental setup consists of three 8LSBR bioreactors and an aeration system, and operates intermittently with water samples taken daily.
[0131] The control group used only activated sludge;
[0132] In addition to adding an equal amount of activated sludge, the experimental groups were further inoculated with LH-HF0021 of the present invention at a gradient inoculation ratio of 0.3% to achieve a bacterial count of 2.0–2.6 × 10⁻⁶. 6 CFU / ml diluted bacterial solution;
[0133] The sludge concentration in the pilot-scale apparatus was adjusted to approximately 5000 mg / L, the HRT was set to 24 h, and the pH was 7.8. The final concentration of benzene series compounds was determined using HJ 1067-2019, and the COD of the system was determined using the dichromate method for determining chemical oxygen demand in water (HJ 828—2017). Cr The content of total nitrogen in water was determined using the alkaline potassium persulfate digestion ultraviolet spectrophotometric method (HJ 636—2012), and nitrite nitrogen was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method with a Lianhua multi-parameter rapid water quality analyzer. The sludge settling ratio was determined as follows: 1000 ml of the mixed liquid from the end of the aeration tank was placed in a colorless yellow graduated cylinder and allowed to stand for 30 minutes. The volume of settled activated sludge relative to the total volume of the mixed liquid was the activated sludge settling ratio.
[0134] The bioaugmentation effect of Bacillus subtilis LH-HF0021 on styrene wastewater from a chemical plant in Lianyungang was investigated. The results are shown in Tables 8 and 9. This indicates that the agent promoted the degradation of benzene series compounds and polycyclic aromatic hydrocarbons by over 99%, with increases of 53.43% and 47.16% respectively compared to the activated sludge control group; it also promoted COD reduction. Cr Compared to the activated sludge control group, the removal rates of nitrite nitrogen and total nitrogen were increased by 39.72%, 37.98%, and 41.97%, respectively. This eliminated the toxicity of the bacteria to the activated sludge, maintained its settling properties, reduced sludge disintegration, and thus promoted the normal biochemical benefits of the activated sludge. Simultaneously, the bacteria's own nitrate reduction capabilities were utilized, promoting the reduction of total nitrogen, nitrite nitrogen, and COD in the system. Cr The fact that these indicators meet emission standards demonstrates that the microbial agent has strong detoxification and COD removal capabilities. Cr Denitrification reduces the biofortification effects of nitrite nitrogen and total nitrogen.
[0135] Table 8. Effect of Bacillus LH-HF0021 bacterial agent on reducing the content of toxic substances in styrene wastewater from a chemical plant in Lianyungang.
[0136]
[0137] Table 9. The effect of bacillus LH-HF0021 inoculant on the degradation rate of benzene series, polycyclic aromatic hydrocarbons, and the removal rate of COD, total nitrogen, and nitrite nitrogen in styrene wastewater of a chemical enterprise in Lianyungang Cr
[0138]
[0139] In summary, bacillus LH-HF0021 was isolated from the groundwater of a benzene contaminated site in Suzhou. Under the stress of toxic substances such as benzene, ethylbenzene, styrene, and naphthalene, the total nitrogen degradation trend was similar to that of the control group, indicating that the stress of toxic substances such as benzene series and polycyclic aromatic hydrocarbons did not affect the denitrification performance of bacillus LH-HF0021. The strain was recombined into a microbial inoculant after liquid fermentation and freeze-drying. Under the stress of gradient concentration of benzene series and polycyclic aromatic hydrocarbons, compared with the pure carrier, it had strong degradation ability of benzene series and polycyclic aromatic hydrocarbons, and strong total nitrogen, nitrite nitrogen degradation and COD removal capacity. The dilution liquid of the bacillus LH-HF0021 microbial inoculant can promote the effective degradation of toxic substances such as benzene, ethylbenzene, xylene, styrene, and naphthalene in styrene wastewater at an application inoculum of 0.3-0.5%, reduce the toxic stress on activated sludge, promote the removal of CODCr, total nitrogen, and nitrite nitrogen, and then promote the effluent to meet the discharge standards. In the toxic styrene wastewater rich in benzene series and naphthalene, it promoted the degradation of more than 99% of benzene series and polycyclic aromatic hydrocarbons, with an improvement of 53.43% and 47.16% compared with the activated sludge control group; it promoted the removal of total nitrogen, nitrite nitrogen, and CODCr, with an improvement of 41.97%, 37.98%, and 39.72% compared with the activated sludge control group; it eliminated the toxicity to activated sludge, maintained the sludge settling performance, reduced the sludge disintegration, and thus promoted the normal biochemical benefits of activated sludge.
[0140] The above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, for those skilled in the art, the technical solutions described in the foregoing examples can be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.
Claims
1. A bacillus LH-HF0021, characterized in that, Its classification name is Diaphorobacter nitroreducens, and its accession number is CGMCC No. 27556.
2. The culture method of the bacillus LH-HF0021 according to claim 1, characterized by, The bacillus LH-HF0021 was cultured at 30°C and 180 r / min for 30 h under stress of 35.0 ppm benzene, 35.5 ppm ethylbenzene, 32.1 ppm styrene, and 9.8 ppm naphthalene.
3. The fermentation culture method of Bacillus LH-HF0021 according to claim 1, characterized by, The above: (1) Pick a single colony from the plate and inoculate it into 100 mL of 10% LB medium. Culture it at 30℃ and 180 rpm until the exponential phase. Centrifuge at 6000 rpm for 5 min, collect the cells, wash the cells twice with 15 mL of sterile MSM medium, and resuspend them with 5 mL of MSM medium to obtain the seed culture. (2) Inoculate the seed culture into 20 mL of MSM medium, adjust the initial OD600 of the seed culture to 1, the inoculation amount to 8%, adjust the pH of the medium to 8, set the shaking temperature to 30℃, inoculate into 10 mL of inorganic salt medium and add naphthalene to a final concentration of 100 mg / L, and culture at a shaking speed of 180 rpm.
4. The Bacillus LH-HF0021 microbial inoculant of claim 1, wherein, The preparation of the LH-HF0021 bacillus microbial agent includes the following steps: (1) Activation of strain: On sterile 10% LB medium, activate bacillus LH-HF0021, inoculate it on the slant of a 2L eggplant-shaped bottle, and after culturing at 30℃ for 16h, the slant of the eggplant-shaped bottle is covered with bacterial moss, and primary bacterial moss seeds are obtained. (2) Seed culture: Using a sterilized and cooled inoculation spatula, the primary mycelial seed on the eggplant-shaped bottle is inoculated into a sterilized seed tank containing seed culture medium. The culture is carried out at 30℃ for 18-20h to form a large number of active cells in the exponential phase, which is used as the secondary seed culture medium. The seed culture medium components (g / L) include: fish peptone 12.5-13.0, sucrose 5.5-6.0, triammonium citrate 2.5-3.0, potassium dihydrogen phosphate 2.0-2.5, sodium acetate 0.5-0.75, calcium carbonate 0.3-0.5, ammonium chloride 0.3-0.5, and Tween-80 0.2-0.3; adjust the initial pH to 7.8-8.0; 60%-62% of the culture medium volume. Real consumption conditions: constant temperature 116 ℃ for 25 min; culture conditions: constant temperature 30 ℃±1 ℃, tank pressure 0.05 Mpa, rotation speed 180-185 rpm / min; ventilation volume 13-15 m 3 / h; (3) Production tank culture: the secondary seed culture solution in the seed tank is transferred to the production tank for fermentation culture, and the culture is carried out at 30°C for 46h, and the tank is stopped when the bacterial content of the fermentation solution is stable, to obtain the bacillus LH-HF0021 fermentation solution, and the bacterial content generally reaches 130x10 8 CFU / ml-140x10 8 CFU / ml when the tank is discharged. The fermentation medium components (g / L) include: phenol 5.5-6.0, ammonium sulfate 2.5-3.0, dipotassium hydrogen phosphate 2.5-3.0, magnesium chloride 1.5-2.0, copper sulfate 0.5-1.0, defoamer 0.4-0.5, pH 7.8-8.0; 58%-60% of the liquid volume; Real consumption conditions: constant temperature 116 ℃ for 30 min; culture conditions: constant temperature 30 ℃±1 ℃, tank pressure 0.05 Mpa, rotation speed 175 rpm for 0-13 h, 195 rpm for 14-46 h; ventilation volume 135-140 m 3 / h for 0-13 h, 155-160 m 3 / h for 14-46 h; (4) Freeze-drying: The bacillus LH-HF0021 fermentation broth was moved to the GQ105 tubular centrifuge, centrifuged at 10000 rpm for 1 min, and the fermentation broth was removed by fine filtration centrifugation to remove more than 85%, and the bacterial mud was collected, the freeze-drying protective agent was added, and the mixture was mixed and prepared; freeze-drying, the freezing temperature is-35--33℃, the freeze-drying time is 4.5-5d, the bacillus LH-HF0021 freeze-dried bacteria powder is obtained, the bacterial amount is 1800×10 8 -2000×10 8 CFU / g; the components of the freeze-drying protective agent are skim milk 5%, potassium tripolyphosphate 3%, VC 2%, sodium glutamate 1.5%, and the content is the mass ratio of the bacterial mud. (5) Product compounding: the concentrated freeze-dried bacteria powder of bacillus LH-HF0021 is compounded with solid phase carrier at a mass ratio of 1-1.2: 890-895, and is prepared into 2-2.6x10 8 CFU / g microbial inoculant, wherein the solid phase carrier is sodium calcium aluminosilicate hydroxide.
5. Use of the bacillus LH-HF0021 as claimed in claim 1, characterized in that: The application of the bacillus LH-HF0021 in the preparation of microbial agents to relieve the toxicity of benzene series compounds, wherein the benzene series compounds are selected from one or more of benzene, toluene, ethylbenzene, xylene, p-m-xylene, o-xylene, styrene, naphthalene, anthracene, phenanthrene, pyrene, biphenyl, phenol, sodium benzoate, salicylic acid, catechol, and terephthalic acid.
6. Use according to claim 5, characterized in that, In application, the bacillus LH-HF0021 is prepared into a diluted bacteria solution with a bacteria content of 2.0-2.6 x 10 6 CFU / ml, and then inoculated into a styrene wastewater system at a proportion of 0.3-0.5%.
7. Use of the Bacillus LH-HF0021 microbial inoculant of claim 4, characterized by: The bacillus LH-HF0021 microbial inoculant is used for relieving the toxicity of benzene series; the benzene series is selected from one or more of benzene, toluene, ethylbenzene, xylene, p-m-xylene, o-xylene, styrene, naphthalene, anthracene, phenanthrene, pyrene, diphenyl, phenol, sodium benzoate, salicylic acid, catechol, terephthalic acid.
8. Use according to claim 7, characterized in that, When used, the water dilution of the bacillus LH-HF0021 microbial inoculant is applied at an inoculation dose of 0.3%-0.5%.
Citation Information
Patent Citations
Application of Diaphorobacter bacterium in phenol removal of coking wastewater
CN103421700A
Polycyclic aromatic hydrocarbon degrading strain as well as screening method and application thereof
CN114231436A