Drought resistance gene of soybean and protein and application thereof

Abstract

The application provides a method for improving drought resistance of soybean, which comprises transforming a GmPrx16 gene or a vector or a host cell containing the GmPrx16 gene into a soybean plant cell or tissue and cultivating to obtain a soybean plant with improved drought resistance. Meanwhile, the application discloses use of the GmPrx16 gene or the vector or the host cell containing the GmPrx16 gene in cultivating drought-resistant soybean. The application has great theoretical and application values for soybean breeding and related application research.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a soybean drought resistance gene, a protein encoded by the gene and application thereof. BACKGROUND

[0002] With the intensification of the greenhouse effect, the global environment is deteriorating, the drought area is increasing, and the effective farmland area is gradually decreasing, which has seriously restricted the development of global agriculture. Soybean is an important economic oil crop in China, but drought stress has a great impact on the growth and development of soybean (Dong et al., 2019; Du et al., 2020a; Du et al., 2020b). Therefore, the research on the mechanism of soybean drought resistance and the breeding of drought-resistant varieties are of great significance to food security in China and even the world.

[0003] Peroxidase is an enzyme widely present in organisms, which uses iron porphyrin as a cofactor to catalyze the oxidation of hydrogen peroxide, phenolic compounds, amine compounds and hydrocarbons, thereby eliminating active oxygen and reducing the damage to cells caused by stress (Yoshida, 2003). There are four main peroxidases in plants: glutathione peroxidase (GPX), catalases (CAT), ascorbate peroxidases (APXs) and classic plant peroxidases (class-III peroxidase, Prx) (Cosio and Dunand, 2009; Hiraga et al., 2001; Shigeto and Tsutsumi, 2016). There are 124 class III peroxidases in soybean, of which 23 members change in expression under drought stress (Aleem et al., 2022), and members GsPRX9 and GsPOD40 are reported to improve the salt and drought resistance of soybean, respectively. Therefore, exploring the members of the soybean peroxidase family is of great significance to the study of the regulation mechanism of soybean drought resistance and plays a very important role in improving the drought resistance of soybean. SUMMARY

[0004] The purpose of the application is to provide an application of a gene encoding peroxidase in drought resistance of soybean.

[0005] The application analyzes the genetic regulation site of the standard drought resistance index of soybean at the whole genome level by association analysis, and through the integration of haplotype, gene expression profile and homologous gene function annotation, a gene related to the drought resistance of soybean Glyma.16G164400 (also referred to as GmPrx16 or GmPrx16 HapI , GmPrx16 HapII ) is cloned by using molecular biology and comparative genomics, and the function of the gene in regulating the drought resistance of soybean is found for the first time, which provides a theoretical basis and gene resources for subsequent molecular assisted breeding and molecular design breeding.

[0006] In specific embodiments of the application, the cDNA sequence of the GmPrx16 HapI gene is shown as SEQ ID NO:1, and the cDNA sequence of the GmPrx16 HapII gene is shown as SEQ ID NO:2. In specific embodiments of the application, the genomic DNA (gDNA) sequence of the GmPrx16 gene is shown as SEQ ID NO:3 and SEQ ID NO:4.

[0007] In the application, a plant expression vector containing the target gene can be constructed by using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene encoding an enzyme or a luminescent compound that can produce a color change, a resistant antibiotic marker or a resistant chemical reagent marker gene, etc. In consideration of the safety of transgenic plants, no selective marker gene can be added, and the plants can be directly screened under stress. The plant expression vector can also contain an enhancer to increase the expression of the inserted nucleotide fragment.

[0008] To achieve the above-mentioned purpose, the application further provides a method for obtaining a transgenic soybean, which is introducing the aforementioned nucleic acid or a vector or a host cell containing the aforementioned gene into the soybean, so as to obtain a transgenic soybean with improved drought resistance compared with the soybean.

[0009] The method for introducing the soybean can be transformed into a plant cell or tissue by using a Ti plasmid, a Ri plasmid, a plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc. The transformed soybean cell or tissue is cultivated into a plant.

[0010] To achieve the above-mentioned purpose, the application further provides an application of the protein or the nucleic acid or the vector or the host cell containing the aforementioned gene in the genetic engineering of soybean.

[0011] The soybean genetic engineering is preferably a soybean genetic engineering aiming at improving drought resistance of soybean.

[0012] The soybean drought resistance related gene and the encoded protein thereof provided by the application are the first discovery of the applicant in terms of the function in regulating drought resistance of soybean, and the phenotype analysis of the transgenic plants and wild type plants verifies that the expression of the soybean drought resistance related protein of the application can improve the drought resistance of the transgenic soybean. The application has great theoretical and application value for the breeding of soybean drought resistance and the related application research.

[0013] In summary, the application provides the following embodiments:

[0014] 1. A drought resistance protein, wherein the amino acid sequence of the protein is shown as SEQ ID NO: 5 or 6.

[0015] 2. A polynucleotide sequence encoding the drought resistance protein of claim 1.

[0016] 3. The polynucleotide sequence of item 2, which is GmPrx16 HapI gene or GmPrx16 HapII gene, wherein the cDNA sequence of the GmPrx16 HapI gene is shown as SEQ ID NO: 1, and the cDNA sequence of the GmPrx16 HapII gene is shown as SEQ ID NO: 2.

[0017] 4. The polynucleotide sequence of item 3, wherein the gDNA sequence of the GmPrx16 HapI gene is shown as SEQ ID NO: 3, and the gDNA sequence of the GmPrx16 HapII gene is shown as SEQ ID NO: 4.

[0018] 5. A vector, wherein the vector comprises the polynucleotide sequence of any one of items 2-4, and the vector is a plant expression vector, preferably a binary Agrobacterium vector.

[0019] 6. A host cell comprising the polynucleotide sequence of any one of items 2-4 or the vector of item 5, wherein the host cell is selected from an Escherichia coli cell, an Agrobacterium tumefaciens cell or a plant cell.

[0020] 7. Use of the drought resistance protein of item 1 or the polynucleotide sequence of any one of items 2-4 in breeding plants with improved drought resistance, preferably legume plants, more preferably soybean.

[0021] 8. A method for breeding a transgenic plant with improved drought tolerance, comprising introducing the drought tolerance protein of item 1, the polynucleotide sequence of any one of items 2-4, or the vector of item 5 or the host cell of item 6 into a plant cell or tissue of interest to obtain a transgenic plant, wherein the transgenic plant has improved drought tolerance compared to the plant of interest, and the plant is a legume, preferably soybean. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Cloning of GmPrx16 gene is shown. Among them, a: whole genome association analysis of standard drought index traits of soybean. b: QQ plot of standard drought index traits. c: display of linkage disequilibrium (p < 1 x 10 -5.2 ) of SNPs in the candidate interval of standard drought index traits. d: expression analysis of all genes in the candidate interval after dehydration treatment.

[0023] Figure 2 Haplotype analysis of GmPrx16 gene is shown. Among them, a: two major haplotype structures of GmPrx16 (wherein HapI is the dominant haplotype of GmPrx16 gene). b: t-test detection of standard drought index of two haplotype varieties in natural population. c: comparison of peroxidase activity of two haplotypes of GmPrx16. d: expression of GmPrx16 in leaf of Dongnong 50, Zhonghuang 13 and Williams 82 after dehydration treatment. e: expression of GmPrx16 in different leaves of DN50 after water deprivation treatment, wherein L0 represents true leaf, L1-L4 represent first, second, third and fourth whorl of trifoliate leaves, and Apical tip represents the top of soybean plant.

[0024] Figure 3 A schematic diagram of the transformation vector pTF101.1-35S:GmPrx16-HapI of GmPrx16 gene overexpression is shown.

[0025] Figure 4 A schematic diagram of the transformation vector pFGC5941-GmPrx16 of GmPrx16 gene RNAi is shown.

[0026] Figure 5The phenotype comparison of wild type DN50 (Dongnong 50) and transgenic plants overexpressing transgene (GmPrx16-OE1 / 2) obtained by transfecting pTF101.1-35S:GmPrx16-HapI plasmid and RNAi transgenic plants (GmPrx16-RNAi-1 / 2) obtained by transfecting pFGC5941-GmPrx16 plasmid is shown. Among them, a: the phenotype comparison of DN50 wild type and GmPrx16-OE1 / 2 and GmPrx16-RNAi-1 / 2 plants under normal growth conditions. b: the phenotype comparison of DN50 wild type GmPrx16-OE1 / 2 and GmPrx16-RNAi-1 / 2 plants after water deprivation treatment. c-d: the survival rate statistics of DN50 wild type, GmPrx16-OE1 / 2 and GmPrx16-RNAi-1 / 2 transgenic plants after 14 days of water deprivation treatment and then rehydration. DETAILED DESCRIPTION

[0027] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to specific embodiments and drawings.

[0028] The following examples are intended to better illustrate the present application but not to limit the present application. In the following examples, the experimental methods are conventional methods or selected according to the product instructions unless otherwise specified. In the following examples, the test materials used are conventional biochemical reagents available on the market unless otherwise specified. In the following examples, the quantitative tests are set up with three repeated experiments, and the results are averaged.

[0029] In the following examples, the transformation receptor is Dongnong 50 (DN50), wherein DN50 is a Heilongjiang Province approved variety (Hei approved beans 2007022). The pTF101.1 vector, pFGC5941 vector and Agrobacterium strains EHA101, EHA105 are purchased from China Plasmid Vector Strain Cell Gene Preservation Center (Biovector Science Lab, Inc).

[0030] The consumables such as enzyme digestion recovery kit are purchased from New England Biolabs and Tian Gen Biochemical Technology (Beijing) Co., Ltd.

[0031] Example 1, discovery of GmPrx16 protein and its encoding gene

[0032] The inventors performed genome-wide association study (GWAS) using drought index of 584 soybean germplasm. Principal component analysis (PCA) and kinship were calculated using SNPs with Minor allele frequency (MAF) ≥ 0.03. Among them, the first two components of principal component analysis were selected to control the population structure, and the Balding-Nichols (BN) matrix generated by EMMAX was used to reflect the kinship. Genome-wide association analysis was performed using software EMMAX (Kang et al., 2010). We detected one significant signal associated with the standard drought index on chromosome 16 and 8, respectively (see Figure 1 a,b). The inventors analyzed the segment located on chromosome 16, combined with transcriptome data, haplotype analysis and homologous gene function annotation, and found a soybean drought resistance related protein in the segment (see Figure 1 c,d). It is named GmPrx16 protein (abbreviated as GmPrx16), and the amino acid sequence is shown as SEQ ID NO. 5 and SEQ ID NO. 6. The gene encoding GmPrx16 protein is named GmPrx16 (or GmPrx16 HapI and GmPrx16 HapII gene, and the cDNA sequence is shown as SEQ ID NO. 1 and SEQ ID NO. 2.

[0033] Example 2 Functional verification of GmPrx16 protein

[0034] GmPrx16 encodes a peroxidase located in the candidate interval of chromosome 16 ( Figure 1 c) Haplotype analysis shows that the 16th nucleotide in the first exon of GmPrx16 is mutated from C to G ( Figure 2 a), which causes the 6th coding amino acid to change from proline to alanine, and the drought index of different haplotypes corresponding to the materials has significant difference ( Figure 2 b). In order to clarify the role of GmPrx16 in soybean drought resistance, the expression pattern of the gene was first analyzed. Three commonly used materials in the laboratory, Dongnong 50, Zhonghuang 13 and Williams 82, were selected, and the dehydration experiment of in vitro plant was carried out when the second round of three-leaf triad was fully expanded. The first round of three-leaf triad was sampled at 0 hours (h), 1h, 2h and 3h, and the expression of GmPrx16 at different dehydration treatment time points was detected. The experimental results show that dehydration treatment induces the expression of GmPrx16 in leaves, and the expression of GmPrx16 increases with the extension of dehydration time ( Figure 2d). The Dongnong 50 was subjected to water deprivation treatment, and samples were taken from different tissues at 7 days (d) and 12 d of the water deprivation treatment. Under drought stress treatment, the expression of GmPrx16 in leaves and tips was induced, and the degree of induction of the gene increased with the extension of the water deprivation treatment time Figure 2 e). In order to detect whether the change of SNP will affect the enzyme activity of the protein, the inventors used the guaiacol method to detect the peroxidase activity of the two haplotypes of GmPrx16 proteins, and the results showed that the nucleotide variation caused GmPrx16 HapI and GmPrx16 HapII peroxidase activity changed, and the peroxidase activity of GmPrx16 HapI was significantly higher than that of GmPrx16 HapII ( Figure 2 c).

[0035] The method for determining peroxidase activity by the guaiacol method is as follows:

[0036] 1. Prepare the reaction solution: 25mM PBS buffer with pH 7.0, and add EDTA stock solution to make the final concentration 2mM;

[0037] 2. Use a spectrophotometer to determine the peroxidase activity, add 1350μL of the reaction buffer to a 2.0mL centrifuge tube, add 50μL of 1.5% guaiacol reaction solution, 50μL of 300mM H2O2 reaction solution, and 10μL of protein extract, mix quickly, and use a spectrophotometer to determine the 470nM absorbance value per unit time, and take 0.01 change in A470 per 30s as 1 unit of peroxidase activity.

[0038] The present application further provides the nucleotide polymorphism of the SNP site of GmPrx16 gene in the soybean genome, as shown in Figure 2 a, which can be used for detecting the background of soybean varieties. For example, by hybridization, the haplotype I (Hap I) of GmPrx16 (i.e. the dominant haplotype of GmPrx16 gene) is introduced into the haplotype II (Hap II) soybean variety, which can improve the drought resistance of the haplotype II soybean variety.

[0039] Example 3: Transgenic phenotype statistics of GmPrx16

[0040] I. Construction of recombinant plasmid

[0041] GmPrx16 HapIThe cDNA nucleic acid sequence of the gene (shown as SEQ ID NO: 1) is subjected to PCR amplification, and then is subjected to enzyme digestion and connection to a PTF101.1 vector to obtain a recombinant plasmid pTF101.1-35s:GmPrx16-HapI. The specific operation is as follows:

[0042] 1. The leaves of soybean variety JD21 are separated from the plants, RNA is extracted using a Beijing Huayueyang Plant RNA Extraction Kit, and reverse transcription is performed using a One-Step cDNA Synthesis Kit of Qiagen to obtain the cDNA of JD21. The specific operation steps are referred to the instruction manual.

[0043] 2. The cDNA obtained in step 1 is used as a template, and a primer pair composed of SEQ ID NO. 7 and SEQ ID NO. 8 is used for PCR amplification to obtain a PCR amplification product (SEQ ID NO. 1).

[0044] 3. The pTF101.1-35s:GmPrx16-HapI vector is constructed by a homologous recombination method, and the map thereof is shown in Figure 3 , and the specific operation steps are shown in - Uni Seamless Cloning and Assembly Kit (Qiagen) kit. The PTF101.1 vector is purchased from the China Plasmid Bank.

[0045] 5. The recombinant plasmid pTF101.1-35s:GmPrx16-HapI is introduced into the Agrobacterium strain EHA101 (purchased from the China Plasmid Bank) to obtain a recombinant Agrobacterium. The specific operation steps are as follows:

[0046] (1) About 150 ng of the plasmid is added to the Agrobacterium strain EHA101 competent cells, and is placed in ice for 30 minutes;

[0047] (2) The electrode cup is placed in a clean bench and blown until there is no alcohol, and then is placed in ice for cooling;

[0048] (3) The EHA101 competent cells mixed with the plasmid are added to the electrode cup, and are subjected to electric shock by using an electric shock instrument;

[0049] (4) 700 μL of antibiotic-free LB medium is added to the EHA101 competent cells after electric shock, and is placed in a 30°C shaker for 1 h of activation, and then is coated on a Kan (kanamycin), Spe (spectinomycin) and Rif (rifampicin) resistant medium, and is cultured for 2-3 days. The correct bacterial colonies are identified by colony PCR, and are reactivated to obtain the recombinant Agrobacterium to be transformed.

[0050] 6. Take the cDNA obtained in step 1 as a template, use the primer sequences in SEQ ID NO: 9 and SEQ ID NO: 10 to amplify the target fragment, and use the enzyme digestion and ligation method to construct the GmPrx16 RNAi vector, i.e. pFGC5941-GmPrx16, the map of which is shown in Figure 4 The recombinant plasmid is introduced into the Agrobacterium strain EHA105 to obtain recombinant Agrobacterium, and the operation is shown in step 5. The culture medium contains Kan (kanamycin) and Rif (rifampicin) resistance.

[0051] II. Cotyledon node transformation method to transform soybean

[0052] The recombinant Agrobacterium obtained in steps 5 and 6 is transformed into the receptor plant DN50 by the cotyledon node transformation method (for specific operation method, see Zhang et al., 2022), and the T0 generation seeds are harvested. The specific operation steps are as follows:

[0053] 1. Seed sterilization and germination

[0054] Select DN50 soybean seeds with round and full grains, smooth surface and no disease spots in a 120mm culture dish. Place the culture dish in a desiccator, add 100mL of 10% sodium hypochlorite solution to a 250mL beaker, then slowly add 4mL of concentrated hydrochloric acid along the beaker, immediately cover the lid of the desiccator, and sterilize the soybean seeds with chlorine for 18h. After sterilization, open the lid in the clean bench and blow off the residual chlorine. Place the sterilized soybean seeds with the hilum facing down on the germination medium (purchased from Coolaber company, PM1062) in the clean bench, 30-35 seeds per dish. Then wrap it with a fresh-keeping bag, cut a breathable hole, and put it in a dark incubator, with a germination condition of 22℃ for 16h or more.

[0055] 2. Agrobacterium infection and co-culture of explants

[0056] Take the germinated seeds, cut off a part of the cotyledon, then cut the seed into two symmetrical parts along the hypocotyl, gently scrape off a pair of true leaves at the cotyledon node under a microscope, and finally gently prick a few times with a scalpel at the cotyledon node to obtain the explants for transformation. Take the EHA101 and EHA105 recombinant Agrobacterium obtained in steps 5 and 6 stored in glycerol at -80℃, thaw them on ice, then use a sterile gun head to dip a small amount of bacterial solution to draw a line on the YEP solid medium containing Kan (kanamycin) and Rif (rifampicin), and incubate at 28℃ for 2 days. Then use a spreader to spread on a new YEP solid medium containing Kan and Rif, and incubate overnight. Finally, resuspend the overnight cultured Agrobacterium in liquid co-culture medium to OD 600The value is 0.6. The explants prepared for transformation are put into the resuspended Agrobacterium liquid, and are placed in a 22°C dark incubator for overnight infection. Then, the surface excess liquid is absorbed with sterile filter paper, and the cotyledon nodes are laid on the solid co-culture medium with sterile filter paper, and are infected at 22°C in the dark for 5 days.

[0057] The components of the liquid co-culture medium are as follows:

[0058]

[0059] 3. Obtaining of transgenic seedlings

[0060] The cotyledon nodes after 5 days of co-culture are obliquely inserted into bud induction medium I (SI-I), and are cultured at 25°C with 16h light and 8h dark, the light intensity being 5000-6000 Lux, for 7 days. After the lower hypocotyls are cut, the nodes are transferred into bud induction medium II (SI-II) containing 8mg / mL PPT (glufosinate ammonium), and are cultured for 14-20 days. The multiple buds are cut from the lower hypocotyls and are moved into bud elongation medium (SEM) containing 4mg / mL PPT, and are cultured at 25°C with 16h light and 8h dark, the light intensity being 5000-6000 Lux. Subculture is performed every 10 days until the buds are elongated to about 5cm. The buds elongated to about 5cm are cut and are directly inserted into rooting medium, and are cultured at 25°C with 16h light and 8h dark, the light intensity being 5000-6000 Lux, until the roots are elongated to 3-4cm, and are ready for transplanting.

[0061] The composition of the bud induction medium I is B-5 salt (Beijing Ximeijie Technology Co., Ltd.), B5 vitamin (Beijing Ximeijie Technology Co., Ltd.), 30 g / L sucrose, 0.6 g / L MES (Sigma), 1.6 mg / L 6-BA (6-benzylaminopurine, ShangHai Genechem Co., Ltd., A600743-0025), 50 mg / L Cef (cefotaxime sodium, Shanghai Alladdin Biochemical Technology Co., Ltd.), 150 mg / L Tim (timentin, Beijing Ximeijie Technology Co., Ltd.), 4 g / L phosphinothricin, 0.2% (w / v) phytagel (Sigma), pH 5.7; the composition of the bud induction medium II is B-5 salt, B5 vitamin, 30 g / L sucrose, 0.6 g / L MES, 1.6 mg / L 6-BA, 50 mg / L Cef, 150 mg / L Tim, 8 g / L phosphinothricin, 0.2% (w / v) phytagel, pH 5.7; the composition of the bud elongation medium is MS salt, B5 vitamin, 30 g / L sucrose, 0.6 g / L MES, 0.5 mg / L gibberellin GA3 (ShangHai Genechem Co., Ltd.), 1 mg / L ZR (Beijing Ximeijie Technology Co., Ltd.), 50 mg / L L-Glu (Sigma), 50 mg / L Asp (Sigma), 0.1 mg / L IAA (Sigma), 50 mg / L Cef, 100 mg / L Tim, 4 g / L phosphinothricin, 0.2% (w / v) phytagel, pH 5.8; the composition of the rooting medium is MS salt, B5 vitamin, 20 g / L sucrose, 0.6 g / L MES, 50 mg / L L-Glu, 50 mg / L Asp, 1.5 mg / L IBA (Sigma), 25 mg / L Tim, 0.2% (w / v) phytagel, pH 5.8.

[0062] 4. Hardening-off, transplanting and screening

[0063] The culture seedlings to be transplanted are removed from the sealing film, a small amount of sterile water is added, and the culture is carried out at 25°C with 8 hours of light and 16 hours of darkness, the light intensity being 5000-6000 Lux. After two days of culture, the seedlings are transplanted, the vermiculite and the peat soil are mixed in equal amounts, and then placed in a tray with water. The culture seedlings are pulled out from the rooting medium, washed to remove the residual medium, and then transplanted into the nutrient soil which has been fully saturated with water. The soybean leaves are smeared with 0.1% Basta herbicide, and after 3 days, the transgenic positive plants are screened by the absence of yellowing reaction.

[0064] The subsequent T1 generation and later generation transgenic lines are sprayed with 0.1% Basta herbicide for screening, and two transgenic plants (i.e., GmPrx16-OE1 and GmPrx16-OE2) successfully transfected with the recombinant plasmid pTF101.1-35S:GmPrx16 are obtained, and the expression of the GmPrx16 gene in the transgenic plants is significantly improved; at the same time, transgenic plants (i.e., RNAi transgenic plants, GmPrx16-RNAi-1 and GmPrx16-RNAi-2) successfully transfected with the recombinant plasmid pFGC5941-GmPrx16 are obtained, and the expression of the GmPrx16 gene in the RNAi transgenic plants is significantly inhibited Figure 5 c).

[0065] III. Identification of drought resistance phenotype of GmPrx16 transgenic lines

[0066] This example verifies that the recombinant plasmid pTF101.1-35S:GmPrx16-HapI is successfully transfected in DN50, and the drought resistance of the obtained overexpression transgenic plants is significantly improved. After the recombinant plasmid pFGC5941-GmPrx16 is successfully transfected in DN50, the RNAi transgenic plants obtained exhibit drought sensitivity Figure 5 ).

[0067] Specifically, the transgenic lines are obtained according to the above-mentioned steps, and the T2 generation transgenic plant phenotype is identified by using the method of water interruption treatment, and the specific operation steps are as follows:

[0068] 1. The nutrient soil is filtered through a 1.5 mm mesh screen, and is uniformly mixed with vermiculite at a volume ratio of 1:2;

[0069] 2. The materials are planted in 8 cm x 8 cm small boxes, and the same mass of soil (120 g) is placed in each box, and 18 small boxes are placed in one 5.4 cm x 2.8 cm x 6.5 cm seedling tray, of which 9 small boxes are planted with transgenic plants and 9 small boxes are planted with DN50, and 4 replicates of each transgenic line are planted, i.e., 4 seedling trays;

[0070] 3. Sowing, and after the true leaves are unfolded, the transgenic materials are sprayed with Basta for positive plant screening;

[0071] 4. After the first round of three-leaf fully unfolded, the positive transgenic plants are selected, watered to saturation, and then the water is interrupted to start the drought treatment;

[0072] 5. Photographing after 12 days of drought treatment, rewatering after 14 days of drought treatment, and counting the survival rate of the transgenic lines and DN50 in each seedling tray after 3 days of rewatering.

[0073] Wherein, there is no obvious difference between the wild type DN50 and GmPrx16 transgenic plants under normal growth conditions Figure 5 a), but wilting caused by water stress occurs in the RNAi transgenic plants compared with the wild type DN50 after 12 days of water stress treatment, and the overexpression plants show obvious drought resistance Figure 5 b) after 14 days of water stress treatment. After 14 days of water stress treatment, the wild type DN50 and transgenic lines are rewatered, and the survival rate of the wild type DN50 and transgenic lines is counted after 3 days of rewatering. The results show that the survival rate of the overexpression transgenic lines is significantly higher than that of the wild type DN50, while the survival rate of the RNAi transgenic plants is significantly lower than that of the wild type DN50 Figure 5 d, e).

[0074] The above results show that GmPrx16 gene is a key gene for regulating drought resistance in soybean, and overexpression of GmPrx16 gene in soybean plants can improve the drought resistance of soybean.

[0075] The above-described specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above-described specific embodiments are only for the specific embodiments of the present application and are not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

[0076] References

[0077] Aleem, M., Riaz, A., Raza, Q., Aleem, M., Aslam, M., Kong, K., Atif, R. M., Kashif, M., Bhat, J. A., Zhao, T. 2022 Genome-wide characterization and functional analysis of class III peroxidase gene family in soybean reveal regulatory roles of GsPOD40 in drought tolerance. Genomics. 114: 45-60.

[0078] Cosio, C., and Dunand, C. (2009). Specific functions of individual class III peroxidase genes. J. Exp. Bot. 60: 391-408.

[0079] Dong, S., Yang, Y., Dong, Y., Wang, L., Wang, W., Ma, Z., Yan, C., Ma, C., and Liu, L. (2019). A study on soybean responses to drought stress and rehydration. Saudi J. Biol. Sci. 26, 2006-2017.

[0080] Du, Y., Zhao, Q., Chen, L., Yao, X., Zhang, H., Wu, J., and Xie, F. (2020a). Effect of drought stress during soybean R2-R6 growth stages on sucrose metabolism in leaf and seed. Int. J. Mol. Sci. 21, 618.

[0081] Du, Y., Zhao, Q., Chen, L., Yao, X., Zhang, H., Wu, J., and Xie, F. (2020b). Effect of drought stress on sugar metabolism in leaves and roots of soybean seedlings. Plant Physiol. Biochem. 146, 1-12.

[0082] Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y., and Matsui, H. (2001). A large family of class III plant peroxidases. Plant Cell Physiol. 42:462-468.

[0083] Jin, T., Sun, Y. Y., Zhao, R. R., Shan, Z., Gai, J. Y., Li, Y. (2019) Overexpression of peroxidase gene GsPRX9 confers salt tolerance in soybean. Int. J. Mol. Sci. 20:3745.

[0084] Kang, H., Sul, J., Service, S., Zaitlen, N., Kong, S., Freimer, N., Sabatti, C., and Eskin, E. (2010). Variance component model to account for sample structure in genome-wide association studies. Nat. Genet. 42, 348-354.

[0085] Shigeto, J., and Tsutsumi, Y. (2016). Diverse functions and reactions of class III peroxidases. New Phytol. 209: 1395-1402.

[0086] Yoshida, K., Kaothien, P., Matsui, T., Kawaoka, A., Shinmyo, A. (2003). Molecular biology and application of plant peroxidase genes. Applied Microbiol. Biot. 60: 665-70.

[0087] Zhang, M., Liu, S., Wang, Z., Yuan, Y., Zhang, Z., Liang, Q., Yang, X., Duan, Z., Liu, Y., Kong, F., et al. (2022). Progress in soybean functional genomics over the past decade. Plant Biotechnol. J. 20: 256-282.

[0088] SEQUENCE LISTING

[0089] SEQ ID NO: 1 GmPrx16-HapI 1038 bp cDNA Glycine max (soybean)

[0090] ATGGCTAGGGTTAGTGCTTTGTTTCACTCTTTGCTCTTGATTTCTTCCCTTGTATTGGCTTCTCAAATCCATGTTTCCTCTGGGAAACTAGTCCCTGGACTATCATGGAATTACTATTTGTTGACATGTCCCAAGCTTGAGAGGATTATAAGGAAGCATCTTGAGGATGTCTTCGAGAAGGACAGTGGAGTAGCTCCTGGCATACTTCGACTCTTCTTCCATGACTGCTTTCCTAATGGATGCGATGCGTCTATATTGTTGAATGGAGACGGTGACGAGAAGCAACACCGTGCTAACTTTGGTTTAAGGCAAGAGGCCATTGACGCCATTGAAAACCTTCGGGTTCTCATTTACAAGCAGTGTCTACCAGTTGTCTCATGCTCAGACATCCTTGTTATCGCAGCACGTGAAGCTGTTCGCCAATTAGGAGGCCCTGATTTTGACGTGCCACTGGGAAGAAAAGACGGCCTAGGACCAAACGCCACCGCGCCGGACAACCTACCGGCACCATTCTTCCGAACCGACGATCTTCTGAGAGGATTCGGAAATAGAGGTTTCGATGCCACCGATGTGGTCGCTCTCTCCGGCGCACACACCTACGGTCGTGCCCACTGTCCCTCCCTAGTGAACAGAACCATCGAAACGGACCCACCAATCGACCCAAACTTCAACAACAATTTGATAGCTACGTGTCCCAATGCCGAGTCCCCCAACACCGTTAATTTGGACGTGAGAACCCCCGTGAAGTTCGACAACATGTATTACATCAACCTCTTGAACCGCCAAGGAGTGTTCACTTCTGACCAGGACATCGCGGGCAGCCCCAAAACCAAGGAAATCGTGAACCAGTTCGCTTCAGACCAGAAACTGTTTTTTAAGAAATTTTCCGATGCTTTTGTGAAGGTGAGCCAGCTAGATGTGATAACGGATCGTATTGGGAAAGGGGAGATTCGTGATAAGTGCTTTGTTGCAAATAAGAGAAGATCTTCTATGGCGTCTGTGGTGGAAGAAGTAGTGGAATTGGCTCAGGAGATATAA

[0091] SEQ ID NO: 2 GmPrx16-HapII 1038 bp cDNA Glycine max (soybean)

[0092]

[0093] SEQ ID NO: 3 GmPrx16-Hapl 2968bp gDNA Glycine max (soybean)

[0094]

[0095] TAAATCGATCTCCCATCTACTATAAAGATATAAGTGTCAAGATAATGTA

[0096] TATATAAGTAGAAAAGTAGAACACAAATTCTTACATGTAAACTAACTT

[0097] TTTTGAAGACTCATCAAATTTTTTCTTAAATTCATTATTGAGTCACATA

[0098] TCATATTATCTATGTAACAACTCTAATAATCTTCAACACCATATTGAGA

[0099] AAAGAGAAAAAAGATGCATGAAAAACGTGAAGAATGAGTTATTGAT

[0100] TGTTATTTTTTTTAAAAAAAAATAATTACAAATTAAAAATTAGAAAAT

[0101] GTAGATCAATTTTTATTAATGAAAAACAACCTTCTTGTGATTACCATC

[0102] AAATTAATGAAAAACTAATCAAAATTTCTCGAGAAAAATTTATATATC

[0103] ACATTCATTAAAAATAACATAATCAAAATCATTTATAATATATAAATTA

[0104] GAGATAATTTTCACTCAAATTATAACATTATAATGAGATTAAAAACAC

[0105] ATTTAAACATAATGCTTGATCTCTCGTTTGTTCCTTTTGGTAACTTCTT

[0106] TGTAATTTGAACAGTTAGGAGGCCCTGATTTTGACGTGCCACTGGGA

[0107] AGAAAAGACGGCCTAGGACCAAACGCCACCGCGCCGGACAACCTA

[0108] CCGGCACCATTCTTCCGAACCGACGATCTTCTGAGAGGATTCGGAAA

[0109] TAGAGGTTTCGATGCCACCGATGTGGTCGCTCTCTCCGGCGCACACA

[0110] CCTACGGTCGTGCCCACTGTCCCTCCCTAGTGAACAGAACCATCGAA

[0111] ACGGACCCACCAATCGACCCAAACTTCAACAACAATTTGATAGCTAC

[0112] GTGTCCCAATGCCGAGTCCCCCAACACCGTTAATTTGGACGTGAGAA

[0113] CCCCCGTGAAGTTCGACAACATGTATTACATCAACCTCTTGAACCGC

[0114] CAAGGAGTGTTCACTTCTGACCAGGACATCGCGGGCAGCCCCAAAA

[0115] CCAAGGAAATCGTGAACCAGTTCGCTTCAGACCAGAAACTGTTTTTT

[0116] AAGAAATTTTCCGATGCTTTTGTGAAGGTGAGCCAGCTAGATGTGAT

[0117] AACGGATCGTATTGGGAAAGGGGAGATTCGTGATAAGTGCTTTGTTG

[0118] CAAATAAGAGAAGATCTTCTATGGCGTCTGTGGTGGAAGAAGTAGTG

[0119] GAATTGGCTCAGGAGATATAATTGTATTGGGTCCTTTTGCTCAGGGTG

[0120] TTCTTTTTTGTTTTTCTGAATGGATTGTGTAATAAACGTTGATATGTGT

[0121] TTTCTTTTCTTGTTGTCTTCTCATAGATCATTGCTTTGGATTGGTTCAA

[0122] AGTTTAACCAGTATAACATAAACAAGGCAAAAGTAGTACGAGAATAA

[0123] TTTATATAAATATTGCTGCTGTGTTCCATCGAGAGCTTATTCCCTGTTA

[0124] TTATGGACAGTGGTGATAAAATTAGATTTAGTGACAAAAGTTGGTCA

[0125] CCATTTGCGAGATATAGCAACATAAAAATAGTTTTACTTAAAAAAATG

[0126] CAAAATCTAATATATTTGCTTGAATTTTTGTGTATGAAA

[0127] SEQ ID NO: 4 GmPrx16-HapII 2968bp gDNA Glycine max (soybean)

[0128]

[0129] TGTTTAATAACAGATCATCTGACCATTATAGGTGAGACTCATCACGTG

[0130] ATTTTTTTTATAAAAATTCTAGTTCCTAAAATAAATCTTATTTGTCTTCT

[0131] GAAAATAACCTTAAATACTAAAAATTATGATTTCTATTGAGAAAAATC

[0132] TAAATCGATCTCCCATCTACTATAAAGATATAAGTGTCAAGATAATGTA

[0133] TATATAAGTAGAAAAGTAGAACACAAATTCTTACATGTAAACTAACTT

[0134] TTTTGAAGACTCATCAAATTTTTTCTTAAATTCATTATTGAGTCACATA

[0135] TCATATTATCTATGTAACAACTCTAATAATCTTCAACACCATATTGAGA

[0136] AAAGAGAAAAAAGATGCATGAAAAACGTGAAGAATGAGTTATTGAT

[0137] TGTTATTTTTTTTAAAAAAAAATAATTACAAATTAAAAATTAGAAAAT

[0138] GTAGATCAATTTTTATTAATGAAAAACAACCTTCTTGTGATTACCATC

[0139] AAATTAATGAAAAACTAATCAAAATTTCTCGAGAAAAATTTATATATC

[0140] ACATTCATTAAAAATAACATAATCAAAATCATTTATAATATATAAATTA

[0141] GAGATAATTTTCACTCAAATTATAACATTATAATGAGATTAAAAACAC

[0142] ATTTAAACATAATGCTTGATCTCTCGTTTGTTCCTTTTGGTAACTTCTT

[0143] TGTAATTTGAACAGTTAGGAGGCCCTGATTTTGACGTGCCACTGGGA

[0144] AGAAAAGACGGCCTAGGACCAAACGCCACCGCGCCGGACAACCTA

[0145] CCGGCACCATTCTTCCGAACCGACGATCTTCTGAGAGGATTCGGAAA

[0146] TAGAGGTTTCGATGCCACCGATGTGGTCGCTCTCTCCGGCGCACACA

[0147] CCTACGGTCGTGCCCACTGTCCCTCCCTAGTGAACAGAACCATCGAA

[0148] ACGGACCCACCAATCGACCCAAACTTCAACAACAATTTGATAGCTAC

[0149] GTGTCCCAATGCCGAGTCCCCCAACACCGTTAATTTGGACGTGAGAA

[0150] CCCCCGTGAAGTTCGACAACATGTATTACATCAACCTCTTGAACCGC

[0151] CAAGGAGTGTTCACTTCTGACCAGGACATCGCGGGCAGCCCCAAAA

[0152] CCAAGGAAATCGTGAACCAGTTCGCTTCAGACCAGAAACTGTTTTTT

[0153] AAGAAATTTTCCGATGCTTTTGTGAAGGTGAGCCAGCTAGATGTGAT

[0154] AACGGATCGTATTGGGAAAGGGGAGATTCGTGATAAGTGCTTTGTTG

[0155] CAAATAAGAGAAGATCTTCTATGGCGTCTGTGGTGGAAGAAGTAGTG

[0156] GAATTGGCTCAGGAGATATAATTGTATTGGGTCCTTTTGCTCAGGGTG

[0157] TTCTTTTTTGTTTTTCTGAATGGATTGTGTAATAAACGTTGATATGTGT

[0158] TTTCTTTTCTTGTTGTCTTCTCATAGATCATTGCTTTGGATTGGTTCAA

[0159] AGTTTAACCAGTATAACATAAACAAGGCAAAAGTAGTACGAGAATAA

[0160] TTTATATAAATATTGCTGCTGTGTTCCATCGAGAGCTTATTCCCTGTTA

[0161] TTATGGACAGTGGTGATAAAATTAGATTTAGTGACAAAAGTTGGTCA

[0162] CCATTTGCGAGATATAGCAACATAAAAATAGTTTTACTTAAAAAAATG

[0163] CAAAATCTAATATATTTGCTTGAATTTTTGTGTATGAAA

[0164] SEQ ID NO:5 GmPrx16-Hapl 346 aa protein Glycine max (soybean)

[0165] MARVSALFHSLLLISSLVLASQIHVSSGKLVPGLSWNYYLLTCPKLERIIRKHLEDVFEKDSGVAPGILRLFFHDCFPNGCDASILLNGDGDEKQHRANFGLRQEAIDAIENLRVLIYKQCLPVVSCSDILVIAAREAVRQLGGPDFDVPLGRKDGLGPNATAPDNLPAPFFRTDDLLRGFGNRGFDATDVVALSGAHTYGRAHCPSLVNRTIETDPPIDPNFNNNLIATCPNAESPNTVNLDVRTPVKFDNMYYINLLNRQGVFTSDQDIAGSPKTKEIVNQFASDQKLFFKKFSDAFVKVSQLDVITDRIGKGEIRDKCFVANKRRSSMASVVEEVVELAQEI*

[0166] SEQ ID NO: 6 GmPrx16-HapII 346aa protein Glycine max (soybean)

[0167] MARVSPLFHSLLLISSLVLASQIHVSSGKLVPGLSWNYYLLTCPKLERIIRKHLEDVFEKDSGVAPGILRLFFHDCFPNGCDASILLNGDGDEKQHRANFGLRQEAIDAIENLRVLIYKQCLPVVSCSDILVIAAREAVRQLGGPDFDVPLGRKDGLGPNATAPDNLPAPFFRTDDLLRGFGNRGFDATDVVALSGAHTYGRAHCPSLVNRTIETDPPIDPNFNNNLIATCPNAESPNTVNLDVRTPVKFDNMYYINLLNRQGVFTSDQDIAGSPKTKEIVNQFASDQKLFFKKFSDAFVKVSQLDVITDRIGKGEIRDKCFVANKRRSSMASVVEEVVELAQEI*

[0168] SEQ ID NO: 7 GmPrx16-HapI-OE-F 51 bp DNA Artificial (artificial) synthetic primer

[0169] TTCATTTGGAGAGAACACGGGGGACTATGGCTAGGGTTAGTGCTTTGTTTC

[0170] SEQ ID NO: 8 GmPrx16-HapI-OE-R 52bp DNA Artificial (made by man) synthetic primer

[0171] TTGAACGATCGGGGAAATTCGAGCTTTATATCTCCTGAGCCAATTCCACTAC

[0172] SEQ ID NO: 9 GmPrx16-RNAi-F 42bp DNA Artificial (made by man) synthetic primer

[0173] CTAGTCTAGACCATGGGAGGATTATAAGGAAGCATCTTGAGG

[0174] SEQ ID NO: 10 GmPrx16-RNAi-R 42bp DNA Artificial (made by man) synthetic primer

[0175] GGCGCGCCGGATCCGCGTGAGACAACTGGTAGACACTGCTTGT

[0176] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a drought resistance protein in breeding soybean with improved drought resistance, the amino acid sequence of the protein being as set forth in SEQ ID NO:

5.

2. Use of a polynucleotide sequence in breeding soybean with improved drought resistance, the polynucleotide sequence encoding a drought resistance protein, the amino acid sequence of the drought resistance protein being as set forth in SEQ ID NO:

5.

3. The use of claim 2, wherein, The polynucleotide sequence is GmPrx16 HapI gene, wherein the GmPrx16 HapI The cDNA sequence of the gene is shown as SEQ ID NO:

1.

4. Use according to claim 3, wherein, The GmPrx16 HapI The gDNA sequence of the gene is shown as SEQ ID NO:

3.

5. A method of breeding a transgenic plant with improved drought resistance, comprising introducing a polynucleotide sequence encoding a drought resistance protein into a plant cell or tissue of interest to obtain a transgenic plant, the transgenic plant having improved drought resistance as compared to the plant of interest, the plant being soybean, the amino acid sequence of the protein being as set forth in SEQ ID NO:

5.

6. A method of breeding a transgenic plant with improved drought resistance, comprising introducing a vector into a plant cell or tissue of interest to obtain a transgenic plant, the transgenic plant having improved drought resistance as compared to the plant of interest, the plant being soybean, the vector comprising a polynucleotide sequence encoding a drought resistance protein, the amino acid sequence of the protein being as set forth in SEQ ID NO:

5.

7. The method of claim 6, wherein, The polynucleotide sequence is GmPrx16 HapI gene, wherein the GmPrx16 HapI The cDNA sequence of the gene is shown as SEQ ID NO:

1.

8. The method of claim 7, wherein, The GmPrx16 HapI The gDNA sequence of the gene is shown as SEQ ID NO:

3.

9. A method of breeding a transgenic plant with improved drought tolerance, comprising introducing a host cell into a plant cell or tissue of interest to obtain a transgenic plant with improved drought tolerance as compared to the plant of interest, the plant being soybean, the host cell comprising a polynucleotide sequence or a vector, the polynucleotide encoding a drought tolerance protein, wherein, the amino acid sequence of the protein being as set forth in SEQ ID NO: 5, the vector comprising the polynucleotide sequence.

10. The method of claim 9, wherein, the host cell is selected from the group consisting of an Escherichia coli cell, an Agrobacterium cell.

11. The method of any one of claims 6-10, wherein, the vector is a plant expression vector.

Images