Application of OpCBR1 transcription factor in improving the growth of Ophiorrhiza pumila hairy roots and increasing the production of camptothecin

By overexpressing the OpCBR1 transcription factor in *Hedyotis diffusa*, the problem of insufficient camptothecin production was solved, resulting in accelerated hairy root growth and increased camptothecin yield, providing a new medicinal plant resource to meet market demand.

CN117327726BActive Publication Date: 2026-05-29ZHEJIANG CHINESE MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311058300.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-22
Publication Date
2026-05-29
Estimated Expiration
2043-08-22

Smart Images

  • Figure CN117327726B_ABST
    Figure CN117327726B_ABST
Patent Text Reader

Abstract

The application provides application of OpCBR1 transcription factor in improving growth of short small snake grass hairy roots and increasing camptothecin yield, and the application comprises the following steps: constructing a plant expression vector containing an OpCBR1 gene, and genetically transforming short small snake grass stem section explants to obtain short small snake grass hairy roots over-expressing the OpCBR1 gene; using a weighing method and a high performance liquid chromatography method to analyze the biomass and the camptothecin yield of the transgenic hairy roots, and the results show that over-expression of the OpCBR1 gene can improve the biomass of the short small snake grass hairy roots, thereby improving the camptothecin yield; through dynamic observation, it is found that the biomass of the hairy roots of the transgenic strain of OpCBR1 is significantly improved on the 16th day, and reaches the maximum on the 32nd day, and the yield also reaches the maximum, which indicates that over-expression of the OpCBR1 gene can obviously shorten the culture period. The application provides a new high-quality drug source with broad-spectrum anticancer effect for producing camptothecin, and has important theoretical significance and potential application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the application of an OpCBR1 transcription factor in improving the hairy root growth of *Hedyotis diffusa* and increasing camptothecin production. Background Technology

[0002] *Ophiorrhiza pumila*, belonging to the genus *Ophiorrhiza* in the family Rubiaceae, is a perennial dicotyledonous herb and one of the medicinal plants that produce camptothecin. Camptothecin is an important natural product with broad-spectrum anticancer activity, and its derivatives are often used clinically to treat colon cancer, rectal cancer, and ovarian cancer. However, the single cultivation method and scarce germplasm resources severely restrict the supply of camptothecin-based anticancer drugs, failing to meet the ever-increasing market demand. Therefore, increasing the yield of camptothecin has become a research hotspot in recent years. Metabolic engineering techniques to increase the yield of secondary metabolites in plants are an effective method. In recent years, transcription factors have become a research hotspot, widely reported to participate in the regulation of plant secondary metabolism.

[0003] The ERF family is one of the largest transcription factor families in plants. Its unique DNA-binding domain consists of three β-strands and an α-helix, comprising approximately 60 to 70 amino acids. This domain participates in DNA binding and recognizes specific cis-regulatory elements, including the GCC-box element (5'-AGCCGCC-3'). The ERF family is further divided into two main subfamilies: the ERF subfamily and the DREB subfamily. ERF family transcription factors play crucial regulatory roles in many biological and physiological processes in plants, including morphogenesis, various stress response mechanisms, hormone signal transduction, and metabolite regulation.

[0004] Given the potent antitumor activity of camptothecin and the ever-increasing market demand, there is an urgent need to find alternative sources and increase the yield of camptothecin in existing sources to ensure a sufficient supply. Meanwhile, *Hedyotis diffusa*, with its short growth cycle, ease of genetic transformation, and mature tissue culture system, is a good in vitro source for camptothecin production. Furthermore, the ERF family plays a role in plant growth and the regulation of metabolites. Summary of the Invention

[0005] This invention provides the coding sequence of the OpCBR1 transcription factor of *Hedyotis diffusa* and its application. OpCBR1 of *Hedyotis diffusa* can promote the growth of hairy roots of *Hedyotis diffusa* and increase camptothecin production.

[0006] This invention can be achieved through the following technical solutions:

[0007] This invention clones the OpCBR1 transcription factor from *Hedyotis diffusa*, the nucleotide sequence of which is shown in SEQ ID NO.1, and its gene coding frame sequence is 582 bp; the amino acid sequence of which is shown in SEQ ID NO.2. An overexpression vector was constructed, and transgenic hairy roots were obtained by genetic transformation of *Hedyotis diffusa* stem segments; the yield of camptothecin in the transgenic hairy roots was determined by high performance liquid chromatography.

[0008] This invention also provides the application of the above-mentioned OpCBR1 transcription factor of *Hedyotis diffusa* in improving the hairy root growth and increasing camptothecin production of *Hedyotis diffusa*, by overexpressing the OpCBR1 transcription factor in *Hedyotis diffusa*.

[0009] Furthermore, the overexpression of the OpCBR1 transcription factor in *Hedyotis diffusa* specifically involves:

[0010] A plant overexpression vector containing the OpCBR1 transcription factor was transformed into Agrobacterium rhizogenes to obtain Agrobacterium rhizogenes strains with the plant overexpression vector.

[0011] The constructed Agrobacterium rhizogenes strain was used to transform explants of *Hedyotis diffusa*, and resistant hairy roots were obtained after antibiotic screening. The hairy root lines that tested positive by PCR were transgenic *Hedyotis diffusa* hairy roots that overexpress the OpCBR1 transcription factor in *Hedyotis diffusa*.

[0012] Furthermore, the plant overexpression vector containing the OpCBR1 transcription factor comprises the nucleotide sequence shown in SEQ ID NO.1. The plant overexpression vector can be prepared using conventional methods in the art, such as by constructing the nucleotide sequence of the OpCBR1 transcription factor into an expression vector, including plasmids, etc.

[0013] This invention also provides a method for improving the hairy root growth of *Sophora japonica* and increasing camptothecin production using the OpCBR1 transcription factor, comprising the following steps:

[0014] Step 1: The OpCBR1 transcription factor is operatively linked to the expression regulatory sequence to form a plant overexpression vector containing the OpCBR1 gene; the nucleotide sequence of the OpCBR1 transcription factor is shown in SEQ ID NO.1.

[0015] Step 2: Transform the plant overexpression vector containing the OpCBR1 gene into Agrobacterium rhizogenes to obtain Agrobacterium rhizogenes strains with the plant overexpression vector.

[0016] Step 3: Transform the *Agrobacterium truncatum* explants using the *Agrobacterium truncatum* strain constructed in Step 2. After antibiotic screening, resistant hairy roots are obtained. The hairy root lines that test positive by PCR are the transgenic *Agrobacterium truncatum* hairy roots. The transgenic *Agrobacterium truncatum* hairy roots have a faster growth rate and a higher camptothecin yield.

[0017] In step 2, the transfer is performed using the freeze-thaw method, and the Agrobacterium rhizogenes strain is C58C1.

[0018] In one embodiment of the present invention, in step 2, the OpCBR1 gene is constructed into pHB-X-YFP to obtain a plant overexpression vector containing the OpCBR1 gene. The plant expression vector used is a modified pHB-X-YFP vector containing a p35S promoter and a HYG terminator, a multiple cloning site, a replication origin and a kanamycin resistance site.

[0019] In one embodiment of the present invention, the PCR detection method in step 3 is as follows: design specific primers for the hair root gene rolB and perform PCR amplification; design specific primers for the CaMV35S promoter and upstream and downstream of the inserted gene OpCBR1 and perform PCR amplification; detect by agarose gel electrophoresis, and the appearance of the target band indicates a positive clone.

[0020] In one embodiment of the present invention, step 2, obtaining resistant hairy roots through antibiotic screening, specifically involves:

[0021] Transformed *Hedyotis diffusa* explants were placed on the surface of B5 medium and cultured in the dark at 28°C for 2 days. They were then transferred to primary sterile solid medium and cultured in the dark at 25°C, with the medium changed every two weeks, until hairy roots emerged from the callus tissue. The explants were then transferred to secondary sterile solid medium and cultured in the dark at 25°C until the hairy roots reached 3-4 cm in length and began to branch. At this point, single clones with well-grown and branched hairy roots were cut from the callus tissue and transferred to tertiary sterile solid medium for dark culture at 25°C. After a period of culture, clones showing good growth and no bacterial overflow were selected from the tertiary sterile solid medium. Newly grown hairy roots with a tip length of about 2 cm were cut from these clones and transferred to B5 solid medium for further dark culture at 25°C to obtain resistant hairy roots. The primary sterile solid medium consisted of B5 + Cb 300 mg / L, and the secondary sterile solid medium consisted of B5 + Cb. 200 mg / L, and the tertiary sterile solid culture medium is B5+Cb 100 mg / L.

[0022] In one embodiment of the present invention, high-performance liquid chromatography (HPLC) is used to determine the camptothecin content in the hairy roots of transgenic snakeroot. The HPLC method is as follows: 20 μL of crude camptothecin extract is taken from each transgenic line and injected into the HPLC instrument. The chromatographic conditions used are: a C-18 reversed-phase silica column is used; the mobile phase is acetonitrile:water = 35:65 (V:V); the column temperature is set to 30℃; the flow rate is 1 mL / min; and the detection wavelength is 254 nm.

[0023] This invention discloses a metabolic engineering method for enhancing the growth of hairy roots and increasing camptothecin yield in *Hedyotis diffusa* using the OpCBR1 transcription factor. The invention cloned an OpCBR1 transcription factor from the medicinal plant *Hedyotis diffusa* and constructed its subcellular localization vector. Through the construction of plant overexpression and inhibition expression vectors, *Hedyotis diffusa* stem explants were genetically transformed to obtain transgenic hairy roots. Biomass was observed and measured at different time points. The biomass of hairy roots in the OpCBR1 transgenic lines significantly increased on day 16, reaching its maximum on day 32, and the yield also reached its maximum. HPLC analysis showed that the line with the highest camptothecin yield was 0.51 mg / vial, 2.04 times that of the control group. The results indicate that overexpression of the OpCBR1 gene significantly shortens the culture period, and overexpression of the OpCBR1 transcription factor increases the biomass of hairy roots and increases camptothecin yield. This provides a novel and high-quality drug source for the production of camptothecin, which has broad-spectrum anticancer efficacy, and has significant theoretical and potential application value. Attached Figure Description

[0024] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0025] Figure 1 In this embodiment of the invention, real-time quantitative PCR was used to detect the expression level of OpCBR1 in the hairy roots of *Hedyotis diffusa* overexpressing the OpCBR1 gene, showing that the expression level of the OpCBR1 gene was increased.

[0026] Figure 2 In this embodiment of the invention, the dry weight (DW) and fresh weight (FW) of the hairy roots of *Hedyotis diffusa* overexpressing the OpCBR1 gene were measured on day 32, showing that the biomass was significantly higher than that of the control group.

[0027] Figure 3 In this embodiment of the invention, HPLC was used to detect the yield of camptothecin CPT in the hairy roots of *Hedyotis diffusa* overexpressing the OpCBR1 gene on day 32, showing that the yield of camptothecin was increased.

[0028] Figure 4In this embodiment of the invention, the dry weight level of hairy roots of *Hedyotis diffusa* overexpressing the OpCBR1 gene was dynamically measured, showing that the biomass increased over time.

[0029] Figure 5 In this embodiment of the invention, the yield of camptothecin in the hairy roots of *Hedyotis diffusa* overexpressing the OpCBR1 gene was dynamically detected by HPLC, showing that overexpression of the OpCBR1 gene can significantly shorten the cultivation cycle. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the claims of this application. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in molecular cloning (Sambrook et al.), or according to the conditions recommended in the instructions accompanying the reagents or kits provided by the manufacturer.

[0031] Example 1: Cloning of the OpCBR1 gene from *Sophora japonica*

[0032] 1. Extraction of total RNA from *Hedyotis diffusa*

[0033] Take a small amount of young leaves of *Hedyotis diffusa*, flash-freeze them in liquid nitrogen, then quickly grind them in a mortar and pestle. Add the powder to a 1.5 mL Eppendorf (EP) centrifuge tube containing lysis buffer, shake thoroughly, and extract total RNA according to the instructions of the TIANGEN kit. Detect RNA quality using agarose gel electrophoresis, and then determine the RNA content using a spectrophotometer.

[0034] 2. Cloning of the OpCBR1 gene from *Sophora japonica*

[0035] Using the extracted total RNA as a template, cDNA was synthesized after reverse transcription. Gene-specific primers were designed based on the OpCBR1 gene sequence, as shown in Table 1. The OpCBR1 gene was amplified from the total cDNA by PCR and then sequenced.

[0036] Table 1 PCR primers

[0037] Primer name Primer sequence (5'-3') OpERF20-FP (SEQ ID NO.3) ATGATCTCAATCTCTGATCT OpERF20-RP (SEQ ID NO.4) TCAAGTACTTTTCCTCTTTT

[0038] Through the above steps, the full-length coding sequence (SEQ ID NO.1) of the transcription factor in *Hedyotis diffusa* was obtained and its protein coding sequence (SEQ ID NO.2) was deduced, wherein the start codon is ATG and the stop codon is TGA.

[0039] Example 2: Construction of a plant overexpression vector containing the OpCBR1 gene

[0040] The OpCBR1 gene was constructed in the plant expression vector pHB-X-YFP. To facilitate the construction of the expression vector, the BamHI restriction site was introduced into the forward primer and the SpeI restriction site was introduced into the reverse primer. The primers are shown in Table 2.

[0041] Table 2. PCR primers for constructing the pHB-OpCBR1-YFP vector

[0042] Primer name Primer sequence (5'-3') OpCBR1-BamHI-FP (SEQ ID NO.5) CCAGTCTCTCTCCAAGCTTGGATCCATGATCTCAATCTC OpCBR1-SpeI-RP (SEQ ID NO.6) CGCCCTTGCTCACCATACTAGTAGTACTTTTCCTCT

[0043] This implementation example operatively links the transcription factor OpCBR1, which is involved in regulating camptothecin synthesis, to the expression regulatory sequence, and constructs a plant overexpression vector pHB-OpCBR1-YFP containing the OpCBR1 gene. This expression vector can be used to increase the camptothecin content in *Hedyotis diffusa* through metabolic engineering strategies.

[0044] Example 3: Genetic transformation of *Hedyotis diffusa* 'Syngonium 'Shortroot' using *Agrobacterium rhizogenes*-mediated OpCBR1 overexpression vector to obtain transgenic hairy roots.

[0045] 1. Obtaining engineered Agrobacterium rhizogenes strains with overexpression of the OpCBR1 gene

[0046] The plant expression vector containing the OpCBR1 gene in Example 2 was transformed into Agrobacterium rhizogenes (such as C58C1, which is a commercially available biological material) using the freeze-thaw method, and then verified by PCR.

[0047] 2. Agrobacterium rhizogenes-mediated genetic transformation of the OpCBR1 gene into *Hedyotis diffusa* 'Short Snakeroot'

[0048] 2.1 Pre-culture of explants

[0049] Stem segments were cut from healthy, short, sterile snake root seedlings and placed on B5 medium for pre-culture, followed by dark culture at 25°C for 2 days.

[0050] 2.2 Co-culture of Agrobacterium and explants

[0051] The short snakeroot stem explants were transferred into a B5 medium suspension (OD value around 0.3) containing the activated Agrobacterium rhizogenes overexpression vector of the OpCBR1 gene and soaked for 10 minutes. The explants were gently shaken to ensure full contact with the bacterial solution. After infection, the short snakeroot stem segments were removed, placed on sterile absorbent paper to absorb the bacterial solution, and then placed on the surface of B5 medium and incubated in the dark at 28°C for 2 days.

[0052] 2.3 Induction and subculture of hairy roots

[0053] After two days of dark culture, the materials were transferred to primary sterile solid medium (B5+Cb 300 mg / L) and cultured in the dark at 25°C, with the medium changed approximately every two weeks. After about 14-20 days, small callus tissue appeared at the wound sites of the explants, followed by the emergence of pale yellow hairy roots. At this point, the stem segments with hairy roots were transferred in batches to secondary sterile solid medium (B5+Cb 200 mg / L), where the hairy roots grew rapidly. After 2-3 weeks, the hairy roots reached 3-4 cm in length and began to branch. At this stage, single colonies of well-grown, branched hairy roots were cut from the callus tissue and transferred to tertiary sterile solid medium (B5+Cb 100 mg / L), still cultured in the dark at 25°C. After a period of cultivation, clones showing good growth without bacterial oozing were selected on a tertiary sterile solid medium. Newly grown hairy roots, approximately 2 cm in diameter, were cut from these clones and transferred to B5 solid medium for further cultivation at 25°C in the dark. After about two weeks of cultivation, the clones that did not exhibit bacterial oozing were individually numbered.

[0054] 3. PCR detection of hairy roots of transgenic snake root

[0055] As shown in Table 3, forward primers (SEQ ID NO. 9) and reverse primers (SEQ ID NO. 10) were designed based on the 35S promoter region upstream of the expression cassette containing the target gene and OpERF20, respectively, for PCR detection of the target gene. Simultaneously, upstream and downstream primers (SEQ ID NO. 7-8) for the RolB gene expressed in hairy roots were used for PCR detection of the RolB gene. A total of 30 monoclonal hairy root lines were identified, of which 12 were positive lines.

[0056] Table 3. PCR primers for identifying OpCBR1 transgenic hairy root lines

[0057] Primer name Primer sequence (5'-3') RolB-F (SEQ ID NO.7) GCTCTTGCAGTGCTAGATTT RolB-R (SEQ ID NO.8) GAAGGTGCAAGCTACCTCTC OpCBR1-F243 (SEQ ID NO.9) GGGGACTGGACAAGGTATCG PHB-R (SEQ ID NO.10) TGTGGCCGTTTACGTCGC

[0058] In this embodiment, the plant expression vector was transformed into *Agrobacterium rhizogenes* to obtain an *Agrobacterium rhizogenes* strain containing an overexpression vector for the OpCBR1 gene in *Hedyotis diffusa*. This *Agrobacterium rhizogenes* strain was then used to infect *Hedyotis diffusa* stem segments, yielding transgenic *Hedyotis diffusa* hairy roots as detected by PCR. The acquisition of transgenic *Hedyotis diffusa* hairy roots provides direct material for screening for *Hedyotis diffusa* hairy roots with higher camptothecin content.

[0059] Example 4: Determination of camptothecin content in transgenic *Sophora simulans* hairy root line using HPLC

[0060] 1. Liquid culture of hairy roots

[0061] Select healthy hairy roots from Example 3, cut off the middle and tip sections, and inoculate them into 100 mL of B5 liquid culture medium. Then, expand the culture using a shaker at 25°C and 100 rpm in the dark. Harvest the hairy roots after approximately 45 days. Due to the efflux of camptothecin, both the culture medium and the hairy roots need to be collected. Part 1: Harvesting the culture medium. After removing the hairy roots from the Erlenmeyer flask, first determine the volume of the culture medium, then rotary evaporate the medium, finally bringing the volume to 2 mL, and store at 4°C for subsequent determination of camptothecin content. Part 2: Harvesting the hairy roots. Remove the hairy roots from the culture container, then blot off the surface culture medium with absorbent paper. First, cut three portions of hairy roots, each weighing approximately 0.2-0.6 g, wrap them in aluminum foil and label them, then flash-freeze them in liquid nitrogen and store at -80°C for subsequent RNA extraction. The remaining hairy roots were wrapped in absorbent paper and labeled, then placed in a 50°C constant temperature oven to dry. After the weight no longer changed, they were taken out and used for subsequent extraction and content determination of camptothecin.

[0062] 2. Extraction of camptothecin from hairy roots

[0063] The dried rootlets were removed and ground into powder. 0.1 g of the powder was weighed and placed into a 50 mL centrifuge tube. Approximately 20 mL of chromatographically pure methanol was added. The centrifuge tube was tightly capped and sealed with sealing film. The mixture was vortexed for 3 min to mix thoroughly. Then, it was placed in an ultrasonic water bath for 1 hour for ultrasonic extraction. The ultrasonically extracted mixture was then placed in a 50 °C oven and left to stand overnight. The next day, the mixture was centrifuged at 12,000 rpm for 10 min. The supernatant was collected and evaporated to dryness using a vacuum rotary evaporator at 70 °C. After evaporation, the supernatant was redissolved in chromatographically pure methanol and the final volume was adjusted to 2 mL. The mixture was then filtered using a 0.22 μm organic phase filter membrane. The crude camptothecin extract was obtained and stored at -20 °C for later use.

[0064] 3. qRT-PCR detection of hairy roots of transgenic *Hedyotis diffusa*

[0065] RNA was extracted from the hairy roots of transgenic *Hedyotis diffusa* and reverse transcribed into cDNA. qRT-PCR analysis of the OpCBR1 gene revealed increased expression levels, with OpCBR1-OE-26 and OpCBR1-OE-27 showing the highest fold increases (see...). Figure 1 These two strains were selected for subsequent biomass determination.

[0066] 4. Determination of fresh and dry weight of transgenic hairy root lines

[0067] Transgenic hairy roots were photographed and their phenotypes recorded after harvesting at different times. After blotting with absorbent paper, the fresh weight of the hairy roots was measured, and then freeze-dried and weighed. The results showed that the dry and fresh weights of the OE-26 and OE-27 lines were higher than those of the empty control line pHB-EV throughout the entire dynamic measurement period (see...). Figure 2 and Figure 4 This indicates that OpERF1 overexpression lines affect the growth of hairy roots and increase biomass.

[0068] 5. HPLC determination of camptothecin content in hairy roots

[0069] First, prepare the camptothecin standard to construct a standard curve. The preparation method for the camptothecin standard is as follows: Weigh 1 mg of camptothecin standard using an analytical balance and place it in a small beaker. Add 10 mL of methanol to the beaker, then sonicate the beaker in a water bath for 10-20 minutes until completely dissolved. This yields a standard solution with a final concentration of 100 μg / mL. When measuring the standard, dilute it to multiple concentration gradients to construct a standard curve.

[0070] 20 μL of each of the crude camptothecin extracts was injected into a high-performance liquid chromatograph (HPLC). The chromatographic column used was a C-18 reversed-phase silica column (Symmetry Shield™ C18, 5 μm, 250 x 4.6 mm, Waters); the chromatographic conditions were: mobile phase acetonitrile:water = 35:65; column temperature 30℃; flow rate set to 1 mL / min; detection wavelength set to 220 nm. After detection, the peak area of ​​the camptothecin component in each sample was recorded in the HPLC. The peak area was substituted into the standard curve mentioned above to calculate the camptothecin content in the sample. The results showed that, based on the content and dry / fresh weight levels measured at different days, the yield of the overexpressing transgenic line OpCBR1 could reach the level of 36 days at 32 days, significantly shortening the cultivation cycle (see...). Figure 3 and Figure 5 In this invention, compared with the control, the camptothecin production and biomass of transgenic hairy root lines overexpressing OpCBR1 were significantly increased, with the highest camptothecin production line reaching 0.51 mg / bottle, which was 2.04 times that of the control group.

[0071] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A kind OpCBR1 The application of transcription factors in improving the hairy root growth of *Hedyotis diffusa* and increasing camptothecin production is characterized by, Overexpression in *Syzygium spicata* OpCBR1 The transcription factor, the amino acid sequence of which is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The overexpression in *Hedyotis diffusa* OpCBR1 Transcription factors specifically include: will contain OpCBR1 Plant overexpression vectors of transcription factors were transformed into Agrobacterium rhizogenes ( Agrobacterium . rhizogenes A *Agrobacterium rhizogenes* strain with the plant overexpression vector was obtained. The constructed Agrobacterium rhizogenes strain was used to transform explants of *Hedyotis diffusa*, and resistant hairy roots were obtained after antibiotic screening. Hairy root lines that tested positive by PCR were then obtained, thus confirming overexpression in *Hedyotis diffusa*. OpCBR1 Transgenic short snake root of transcription factor.

3. The application according to claim 2, characterized in that, The containing OpCBR1 Plant overexpression vectors for transcription factors contain nucleotide sequences as shown in SEQ ID NO.

1.

4. The application according to claim 2, characterized in that, The Agrobacterium rhizogenes strain is C58C1.

5. The application according to claim 2, characterized in that, The antibiotic-resistant hairy roots obtained through screening are specifically: Transformed *Hedyotis diffusa* explants were placed on the surface of B5 medium and cultured in the dark at 28°C for 2 days. They were then transferred to primary sterile solid medium and cultured in the dark at 25°C, with the medium changed every two weeks, until hairy roots emerged from the callus tissue. The explants were then transferred to secondary sterile solid medium and cultured in the dark at 25°C until the hairy roots reached 3-4 cm in length and began to branch. At this point, single clones with well-grown and branched hairy roots were cut from the callus tissue and transferred to tertiary sterile solid medium for dark culture at 25°C. After a period of culture, clones showing good growth and no bacterial overflow were selected from the tertiary sterile solid medium. Newly grown hairy roots with pointed tips were cut from these clones and transferred to B5 solid medium for further dark culture at 25°C to obtain resistant hairy roots. The primary sterile solid medium consisted of B5 + Cb 300 mg / L, and the secondary sterile solid medium consisted of B5 + Cb 200 mg / L. mg / L, and the tertiary sterile solid culture medium is B5 + Cb 100 mg / L.

6. A method of utilizing OpCBR1 A method for using transcription factors to enhance the hairy root growth of *Hedyotis diffusa* and increase camptothecin production, characterized in that... Includes the following steps: Step 1, OpCBR1 Transcription factors can be operatively linked to expression regulatory sequences to form expression-containing sequences. OpCBR1 Plant overexpression vectors for genes; in OpCBR1 The nucleotide sequence of the transcription factor is shown in SEQ ID NO. 1; Step 2, containing OpCBR1 The plant overexpression vector of the gene was transformed into Agrobacterium rhizogenes to obtain Agrobacterium rhizogenes strains with the plant overexpression vector; Step 3: Transform the *Agrobacterium truncatum* explants using the *Agrobacterium truncatum* strain constructed in Step 2. After antibiotic screening, resistant hairy roots are obtained. The hairy root lines that test positive by PCR are the transgenic *Agrobacterium truncatum* hairy roots. The transgenic *Agrobacterium truncatum* hairy roots have a faster growth rate and a higher camptothecin yield.

7. The method according to claim 6, characterized in that, In step 2, the transfer is performed using the freeze-thaw method, and the Agrobacterium rhizogenes strain is C58C1.

8. The method according to claim 6, characterized in that, In step 3, the resistant hairy roots obtained through antibiotic screening are specifically as follows: Transformed *Hedyotis diffusa* explants were placed on the surface of B5 medium and cultured in the dark at 28 °C for 2 days. They were then transferred to primary sterile solid medium and cultured in the dark at 25 °C, with the medium changed every two weeks, until hairy roots emerged from the callus tissue. The explants were then transferred to secondary sterile solid medium and cultured in the dark at 25 °C until the hairy roots reached 3-4 cm in length and began to branch. At this point, single clones with well-grown and branched hairy roots were cut from the callus tissue and transferred to tertiary sterile solid medium for dark culture at 25 °C. After a period of culture, clones showing good growth and no bacterial overflow were selected from the tertiary sterile solid medium. Newly grown hairy roots with pointed tips were cut from these clones and transferred to B5 solid medium for further dark culture at 25 °C to obtain resistant hairy roots. The primary sterile solid medium consisted of B5 + Cb 300 mg / L, and the secondary sterile solid medium consisted of B5 + Cb 200 mg / L. mg / L, and the tertiary sterile solid culture medium is B5 + Cb 100 mg / L.