A method to increase intramuscular fat content in pigs

By introducing a C>T single-base mutation at position 3071 of intron 3 of the porcine IGF2 gene and using the CBE3 system for gene editing, the problems of low intramuscular fat content and poor meat quality in traditional breeding methods were solved, resulting in a significant increase in intramuscular fat content and improved meat quality in pork.

CN117363650BActive Publication Date: 2025-11-14SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310982060.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-04
Publication Date
2025-11-14
Estimated Expiration
2043-08-04

AI Technical Summary

Technical Problem

Traditional pig breeding methods struggle to simultaneously increase intramuscular fat content and maintain meat quality, and existing gene editing technologies are inefficient or can lead to the loss of other genes, failing to meet consumer demand for high-quality meat.

Method used

A C>T single-base mutation was introduced at position 3071 of intron 3 of the porcine IGF2 gene. Gene editing was performed using the CBE3 system. By designing gRNAs that precisely mutate the ZBED6 binding motif in intron 3 of the porcine IGF2 gene, other gene deletions were avoided.

Benefits of technology

It has achieved a significant increase in intramuscular fat content in pork while maintaining excellent meat quality, thereby improving pork yield and meat quality, and preserving the genomic purity and superior traits of local pig breeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117363650B_ABST
    Figure CN117363650B_ABST
Patent Text Reader

Abstract

This invention discloses a method for increasing intramuscular fat content in pigs, wherein the method includes introducing a C>T single-base mutation at position 3071 of intron 3 of the pig IGF2 gene. This invention also provides a gRNA, the nucleotide sequence of which is shown in SEQ ID NO: 1. This invention further provides the use of the said gRNA to increase intramuscular fat content in pigs. This invention utilizes CBE3 single-base editing technology to edit the pig IGF2 gene, and through gene editing for the improvement and breeding of local Chinese pig breeds, it can specifically increase intramuscular fat content and improve meat quality, giving pigs the dual advantages of high meat yield and excellent meat quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to a method for increasing the intramuscular fat content of local pigs. Background Technology

[0002] In the field of pig genetics and breeding, traditional intramuscular fat selection methods are commonly used. These methods typically involve individual intramuscular fat measurement, BLUP estimation of breeding values, and comprehensive ranking for selecting individuals. However, traditional breeding primarily considers comprehensive trait selection and does not focus solely on intramuscular fat. Intramuscular fat data can only be obtained through slaughter testing, and the intramuscular fat content of live pigs cannot usually be accurately estimated using current technology. Furthermore, the genetic traits of high intramuscular fat content are sacrificed in the process of increasing meat yield in local Chinese pig breeds through crossbreeding with Western breeds. Traditional high intramuscular fat selection requires extensive growth and slaughter performance testing, which is time-consuming, expensive, and results in a relatively slow increase in intramuscular fat content.

[0003] In recent years, CRISPR-Cas9 has been widely used for site-specific mutations in livestock genomes to improve important economic traits. However, it remains inefficient for precise base substitutions (typically ~0.1%-5%) and often induces additional deletions and indels. Therefore, precise single-base substitutions offer a strategy for precise genetic improvement in pigs. Recently developed base editors, including cytidine base editors (CBEs), can directly generate precise point mutations in genomic DNA without causing DNA double-strand breaks and homologous directed repair, resulting in minimal indel formation. Over the past few decades, selective breeding and gene editing have achieved breeding goals such as increasing lean meat weight and reducing backfat thickness, but this has also led to a decrease in intramuscular fat, which does not meet consumer demand for high-quality meat. In pig farming, simultaneously improving meat yield and meat quality is extremely difficult.

[0004] Therefore, there is a need for a genetic breeding method that can specifically increase the intramuscular fat content of pork while maintaining good meat quality. Summary of the Invention

[0005] The purpose of this invention is to address the above-mentioned technical problems by providing a method that can specifically increase the intramuscular fat content of pork while maintaining good meat quality.

[0006] To achieve the above-mentioned objectives, the present invention provides a method for increasing intramuscular fat content in pigs, wherein the method includes introducing a C>T single-base mutation at position 3071 of intron 3 of the IGF2 gene in pigs.

[0007] Preferably, the method utilizes gRNA targeting the ZBED6 binding motif in intron 3 of the porcine IGF2 gene for gene editing.

[0008] Preferably, the nucleotide sequence of the ZBED6 binding motif is shown in SEQ ID NO: 2.

[0009] Preferably, the method uses the CBE3 system for gene editing.

[0010] Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO: 1.

[0011] Preferably, the pig is, but is not limited to, the Guangdong and Guangxi spotted pig.

[0012] On the other hand, the present invention also provides a gRNA, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0013] On the other hand, the present invention also provides the use of the gRNA for increasing intramuscular fat content in pigs.

[0014] This invention utilizes CBE3 single-base editing technology to edit the porcine IGF2 gene, precisely performing a C→T point mutation at position 3071 of intron 3 of the IGF2 gene in the Liangguang Xiaohua pig. One advantage is that only a C>T single-base mutation is introduced, without introducing other exogenous genes or deleting effective fragments, thus avoiding the biosafety risks of transgenic technology. Furthermore, another advantage is that gene editing can be used to improve local Chinese pig breeds, maintaining the "purity" of their genome. This allows for the maximal preservation of their superior meat quality and palatability while overcoming their low meat yield disadvantage. Simultaneously, it specifically increases intramuscular fat content, improving meat quality, resulting in edited pigs that possess both high meat yield and excellent meat quality. This has significant breeding implications for improving and utilizing local pig breed resources. Attached Figure Description

[0015] Figure 1 This is a schematic diagram illustrating the introduction of the IGF2-intron3-C3071T mutation by the CBE3 editing system.

[0016] Figure 2 This is a map of the pX458-BE3-gRNA co-expression vector.

[0017] Figure 3 The DNA sequence maps of wild type (WT) and IGF2-intron3-C3071T edited type (ED) are shown.

[0018] Figure 4The expression of related genes after the IGF2-intron3-C3071T mutation is shown. (A) IGF2 mRNA expression level in PEF cells; (B) protein expression level; (C) expression of myogenesis-related factors in PEF cells.

[0019] Figure 5 It shows the F1 generation IGF2 C / T Molecular identification results of pigs. (A) mRNA and (B) protein expression levels of IGF2 in the longissimus dorsi muscle at 270 and 370 days of age; (C) statistical analysis of WB grayscale scan results. In the figure, WT represents wild type and ED represents edited type.

[0020] Figure 6 It shows the F1 generation IGF2 C / T Results of meat quality testing in pigs. (A) Comparison of marbling patterns in the longissimus dorsi muscle at 270 days of age; (B) Marbling scores of the longissimus dorsi muscle at 270 and 370 days of age, M represents boars and F represents sows; (C) Comparison of tissue sections of the longissimus dorsi muscle at 270 days of age (left) and 370 days of age (right), the bar chart represents intramuscular fat content statistics, n=3-4. In the figures, WT represents wild type and ED represents edited type. Detailed Implementation

[0021] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0022] 1. IGF2 gene target site selection

[0023] Using the open-source tool CHOPCHOP (http: / / chopchop.cbu.uib.no / ), an sgRNA was designed targeting the ZBED6 binding motif (5'-GCTCG-3'(SEQ ID NO: 2)) in intron 3 of the porcine IGF2 gene, enabling the motif 5'-GCT to bind. C The second cytosine of G-3' is located within the optimal editing window of CBE3 (16-20 nt upstream of the original interspacer motif PAM).

[0024] A sgRNA targeting the porcine IGF2 gene was designed to relieve the transcriptional repression of IGF2 by ZBED6. The specific sequence of this sgRNA is as follows: Figure 1 As shown in Table 1.

[0025] Table 1. Sequence information of sgRNA targeting the IGF2 gene

[0026] serial number name sequence PAM AT% SEQ ID NO: 1 IGF2-sgRNA <![CDATA[CCTAGGCTCGCAGCGCGGGAGCGCGT GGG GGCGGGC]]> GGG 17%

[0027] Note: The binding motif for IGF2-ZBED6 is “GCTCG”, and the optimal editing window for CBE3 is 16-20 nt upstream of the PAM (protospacer-adjacent motif) sequence.

[0028] 2. Construction of the porcine IGF2 gene pX458-BE3-gRNA targeting vector

[0029] The coding sequence of the fusion protein BE3, which contains the deaminase Apobec-1, Cas9 (D10A) Nickase, and uracil glycosylase inhibitor (UGI) from pCMV-BE3, was digested with enzymes and cloned into pX458 (Addgene, plasmid #48138) to replace the 3×FLAG-Cas9 coding sequence, generating the pX458-BE3 vector containing the EGFP reporter gene. The synthesized sgRNA targeting the porcine IGF2-intron3-3071 site was cloned into the plasmid pX458-BE3-gRNA via BBSI restriction, forming the plasmid pX458-BE3-gRNA. The plasmid pX458-BE3-gRNA was then transformed into DH5α competent cells, and single bacterial clones were selected. Sanger sequencing was used to confirm the successful construction of the sgRNA expression vector. The map of the pX458-BE3-gRNA co-expression vector is shown below. Figure 1 As shown.

[0030] 3. PEF cell culture and transfection

[0031] PEF cells (porcine embryonic fibroblasts) were isolated from 35-day-old fetuses of small spotted pigs from Guangdong and Guangxi provinces. They were grown in DMEM medium (Gibco, C1199550OBT) containing 20% ​​(w / v) fetal bovine serum and double antibiotics (100 U / mL penicillin and 100 mg / mL streptomycin). The medium was changed every 1-2 days. When the PEF cells reached approximately 80% confluence, they were washed twice with PBS, digested in a trypsin incubator for 3 minutes, and then the digestion was terminated by adding the prepared DMEM serum medium. The digested cells were collected into 15 mL centrifuge tubes, centrifuged, and the supernatant was discarded. The cells were washed again with PBS, centrifuged a second time, and the supernatant was discarded.

[0032] 1.0×10 6 Cells at a density of cells / mL were resuspended in 100 μL Buffer R (Invitrogen, 2R17052) containing 10 μg pX458-BE3-g RNA plasmid and used with Neon. TMPEF cells were transfected using an electroporation system. Transfection conditions were: 1650V, 10s pulse width, and 3 pulses per well. Transfected cells were seeded into 6-well plates, each containing 2 mL of pre-warmed DMEM medium. Forty-eight hours after transfection, cells were collected using 0.25% (w / v) trypsin / EDTA, and EGFP-positive single cells were flow-cytoscoped using an Aria II cell sorter. EGFP-positive cells were used for further culture or to isolate genomic DNA for sequencing and typing.

[0033] The editing efficiency of PEF cells was identified. PCR products transfected with pX458-BE3-gRNA in PEF cells were cloned and sequenced using TA sequencing. The sequencing results showed that the frequency of the IGF2-intron3-C3071T mutation was 8.89%. Figure 3 The DNA sequence maps of wild type (WT) and IGF2-intron3-C3071T edited type (ED) are shown.

[0034] 4. Somatic cell nuclear transfer and embryo transfer

[0035] Pig ovaries were collected from local slaughterhouses and transported to the laboratory within 2 hours under constant temperature (30°C to 37°C) conditions in 0.9% (w / v) NaCl. Cumulus cells of in vitro mature oocytes were removed and enucleated. PEF cells containing the desired mutation were injected as donor cells into the perivitelline space to form recombinant embryos. The recombinant embryos were fused and activated using a BTX Electro Cell Manipulator 2001 under a single DC pulse of 120 kV / cm for 30 milliseconds. The reconstructed embryos were placed in embryo culture medium (PZM-5 medium (Porcine Zygote Medium-5, PZM-5): 108mM NaCl, 10mM KCl, 0.35mM KH2PO4, 0.40mM MgSO4·7H2O, 25mM NaHCO3, 2mM L-glutamine, 4.99mM taurine, 50μg / mL gentamicin, 0.20mM sodium pyruvate, 0.06g / 100mL calcium lactate, 2% BME amino acid solution, 1% MEM non-essential amino acid solution, 0.3% BSA (bovine serum albumin) (w / v), covered with mineral oil and pre-equilibrated at 38.5℃ for 8h), incubated overnight at 37℃, and then transferred to the oviducts of surrogate sows in estrus and pregnancy. Ultrasound examination was performed 28 days after transfer. The cloned piglets were born when the surrogate sows reached full term.

[0036] A total of 1,648 recombinant embryos were transferred into 10 surrogate sows, of which 3 became pregnant, and all surrogate sows reached full term. A total of 22 piglets were born, with 15 live births. 11 healthy piglets survived 24 hours later. Specific data are shown in Table 2.

[0037] Table 2. Embryo Transfer and Farrowing Information

[0038] experiment Number of embryos transferred pregnant sows Conception rate Number of piglets born Number of live piglets Number of healthy offspring 1 700 5 2(40%) 16 11 8 2 948 5 1(20%) 6 4 3 total 1648 10 3(30%) 22 15 11

[0039] 5. Determination of meat quality characteristics

[0040] All wild-type and edited pigs were ensured to have consistent growth and feeding conditions. Euthanasia was performed at 270 and 370 days of age, with a 24-hour fast before slaughter to assess meat production performance. Meat quality traits included: meat color score, marbling score, pH value (2h), shear force, and water loss rate. This example uses only the marbling score as the assessment criterion for intramuscular fat. The scoring criteria are referenced... Official Color&Marbling Quality Standards.

[0041] 6. Measurement of intramuscular fat content

[0042] Distribute medium-speed quantitative filter paper packets onto clean enamel trays and dry them in an oven at 120℃ for at least 2 hours. Then, place the filter paper packets in a desiccator to cool for 30 minutes. Accurately weigh each dried filter paper packet using a precision balance (range: 0.0001g) and record the weight as W1. Take 50g of longissimus dorsi muscle sample, mince it using a meat grinder, and weigh approximately 2g into the dried filter paper packets. Perform 3-4 replicates for each sample. Weigh each meat-containing filter paper packet using a precision balance and record the weight as W2. Distribute the meat-containing filter paper packets onto clean enamel trays and dry them in an oven at 65℃ for at least 15 hours. After drying, place the meat-containing filter paper packets into a desiccator to cool for 30 minutes. After cooling in a desiccant for 30 minutes, the weight of each meat-containing filter paper packet was weighed several times and the average weight was recorded as W3. The weighed meat-containing filter paper packets were placed in Soxhlet extraction tubes, and the Soxhlet reflux apparatus was placed on a water bath at 55°C. Anhydrous ether was added to the extraction tubes to completely submerge the meat-containing filter paper packets. Approximately 1 / 3 of the extraction flask was filled with anhydrous ether. Extraction was performed for at least 15 hours. After extraction, the meat-containing filter paper packets were removed and spread out on clean enamel trays. The anhydrous ether was evaporated in a fume hood for approximately 30 minutes, and then the packets were dried in a 105°C oven for at least 2 hours. The weight after drying was recorded as W4. In this experiment, crude fat content was used to represent intramuscular fat content, calculated using the following formula:

[0043] Fresh intramuscular fat content = (W3-W4) / (W2-W1) × 100%

[0044] 7. Histological analysis

[0045] Frozen sections were prepared by dehydrating the longissimus dorsi muscle, fixed for 48 hours, with 15% and 30% (w / v) sucrose solutions for one day each, and embedding them with OTC (Optimal Cutting Temperature Compound) frozen section embedding medium (Sakura, 4583). The tissue blocks were then cut into 10 mm thick sections using a cryostat and stained with Oil Red O. Staining was performed with Oil Red O (Sigma-Aldrich, Oil Red O:deionized water volume ratio = 3:2) in the dark at room temperature for one hour. After staining, the slides were rapidly washed with 40% (v / v) alcohol. Finally, each sample was digitally scanned, and three fields of view were observed to provide histological evidence of intramuscular fat content.

[0046] 8. RNA extraction and qPCR

[0047] Total RNA was extracted from PEF cells or longissimus dorsi muscle tissue. The reagents required included TRIzol, chloroform, isopropanol, and 75% (v / v) ethanol prepared with DEPC-treated water. After RNA extraction, the RNA was reverse transcribed into cDNA using a reverse transcription kit (Vazyme, R323) for subsequent qPCR experiments.

[0048] 9. Protein extraction and Western blot

[0049] Total protein was extracted from PEF cells or longissimus dorsi muscle tissue. Cells and tissues were lysed using RIPA lysis buffer containing the protease inhibitor PMSF (Beyotime, ST056) at a final concentration of 1 nm. Protein samples were separated by SDS-PAGE and transferred to a PVDF membrane. The expression of relevant proteins was detected using a Western blot imaging system.

[0050] For the successfully edited cells, we first verified whether PEF cells with the edited IGF2 gene could unbind from the repressor ZBED6 and upregulate its expression. Figure 4 The expression of related genes after the IGF2-intron3-C3071T mutation is shown. (A) IGF2 mRNA expression level in PEF cells; (B) protein expression level; (C) expression of myogenesis-related factors in PEF cells. qPCR results showed that after the IGF2-intron3-C3071T mutation, the IGF2 mRNA level was significantly upregulated by 300-fold. Figure 4 A), protein expression levels were also significantly increased. Figure 4(B) IGF2 plays a certain regulatory role in the proliferation and differentiation of myoblasts. The expression of some related markers was detected, and the mRNA levels of myotube formation factors MyoD, Myogenin, Desmin, and the proliferation-related cyclin Cyclin D1 were significantly upregulated compared to wild-type cells, indicating that the upregulated expression of IGF2 can promote myoblast differentiation and cell proliferation. Figure 4 C).

[0051] F0 homozygous boars (IGF2) T / T ) and wild-type sows (IGF2) C / C Hybridization was performed to produce IGF2 progeny with the IGF2-intron3-C3071T mutation. C / T And using F1 heterozygous individuals (IGF2) C / T Further experiments were conducted. The following abbreviations were used to represent the two genotypes: Wild-type (WT) = IGF2 C / C Pig; Edit heterozygote (ED) = IGF2 C / T pig.

[0052] To further identify meat quality traits, meat quality and molecular identification were performed on the F1 generation at 270 days and 370 days of age, respectively.

[0053] Figure 6 It shows the F1 generation IGF2 C / T Results of pork quality testing. The results showed that IGF2... C / T Pigs have a positive impact on meat quality traits, which is reflected in the distinct "snowflake meat" texture. Figure 6 A) Improved marble pattern score ( Figure 6 (B) and the increase in intramuscular fat content at 270 days and 370 days of age ( Figure 6 C). For both boars and sows, edited marbled patterns are significantly superior to wild-type patterns. Figure 6 (A and B). The results of frozen sections showed that the edited pigs at 270 days and 370 days of age had stronger fat deposition capabilities and more fat cells in their muscles (A and B). Figure 6 (C), and the intramuscular fat content in the longissimus dorsi muscle was measured simultaneously. Except for 370-day-old boars, the intramuscular fat content of the edited pigs in other groups was significantly higher than that of the wild type. Figure 6 (See the bar chart in C). This indicates that the IGF2-intron3-C3071T mutation has a positive effect on intramuscular fat deposition and may require long-term accumulation of the biological effects of IGF2 upregulation.

[0054] Figure 5 It shows the F1 generation IGF2 C / TMolecular identification results in pigs: (A) mRNA and (B) protein expression levels of IGF2 in the longissimus dorsi muscle at 270 and 370 days of age; (C) statistical analysis of WB grayscale scan results; WT represents wild-type and ED represents edited type in the figure. Molecular identification results showed that IGF2 mRNA was widely expressed at young age, but its expression decreased significantly with increasing age. Compared with wild-type pigs, both IGF2 mRNA and protein expression levels were significantly increased at both 270 and 370 days of age.

[0055] This invention constructs a pX458-BE3-gRNA vector targeting the IGF2 gene and uses CBE3 to induce a single-base mutation of IGF2-intron3-C3071T in the genome of the Guangdong-Guangxi Small Spotted Pig. The targeting activity of this mutation in PEF cells from the Guangdong-Guangxi Small Spotted Pig was then verified. Results showed that no additional indels occurred around the gRNA target site in the edited cells and edited pigs. The CBE3 system accurately induced the IGF2-intron3-C3071T mutation, significantly increasing the transcriptional level and protein expression of IGF2, while also promoting the mRNA expression of marker genes related to cell proliferation and myogenic differentiation. The precisely mutated monoclonal cells were used as donors for somatic cell nuclear transfer, and through recombinant embryos, were transferred into the oviducts of surrogate sows, ultimately producing healthy F0 generation homozygous (IGF2) cells. T / T 11 heads. F0 homozygous boars (♂IGF2) T / T ) and wild-type sows (♀IGF2) C / C F1 generation (IGF2) was obtained through hybridization. C / T Slaughter assays were performed, and IGF2 was found to be present. C / T The edited pigs exhibited a significant increase in intramuscular fat content, laying the foundation for related research such as constructing gene-edited pigs with higher intramuscular fat content. This invention utilizes CBE3 to precisely edit IGF2-intron3-C3071T, simultaneously increasing lean meat yield and intramuscular fat content, overcoming the dilemma in existing technologies that struggle to balance meat yield and quality in pig farming.

[0056] This invention is not limited to the above-described embodiments. If any modifications or variations to this invention do not depart from the spirit and scope of this invention, and if such modifications and variations fall within the scope of the claims and equivalent technologies of this invention, then this invention also intends to include such modifications and variations.

Claims

1. A method for increasing intramuscular fat content in pigs, characterized in that, The method includes pigs IGF2 A C>T single-base mutation was introduced at position 3071 of intron 3 of the gene; the pig in question is the Guangdong-Guangxi Small Spotted Pig. The method utilizes techniques for pigs IGF2 Gene editing is performed using gRNA that binds to the ZBED6 motif in intron 3 of a gene; The nucleotide sequence of the ZBED6 binding motif is shown in SEQ ID NO: 2; The method uses the CBE3 system for gene editing.

2. The method according to claim 1, characterized in that, The nucleotide sequence of the gRNA is shown in SEQ ID NO: 1.

Citation Information

Patent Citations

  • Intramuscular fat deposit FASN gene and application thereof

    CN109706159A

  • Sequence, polymorphisms, and marker test technology for disease resistance and growth (NFKB1)

    WO2006099055A2