A primer set, a modified primer set for detecting porcine pathogenic coronavirus and their applications

Abstract

The present invention provides a primer set, a modified primer set for detecting porcine pathogenic coronaviruses and their applications, belonging to the technical field of inspection and quarantine. The primers designed for PEDV and PDCoV respectively by the present invention have the advantages of high accuracy, moderate sensitivity and good specificity, and can be used in combination with microfluidic and colloidal gold methods. By using microfluidic technology, the present invention completes the amplification of the target fragment in a chip, and finally realizes the visualization result through colloidal gold technology, featuring convenience, simplicity, high sensitivity and good repeatability. The reaction of the present invention is completed in one step from RNA to the end of amplification in the reaction cavity of the microfluidic chip, eliminating the two-step reaction from reverse transcription to amplification, reducing the contamination caused by opening the lid and avoiding false positive results. In addition, the two primer sets of the present invention can simultaneously perform PCR reactions in the same chip, enabling the detection of two porcine pathogenic coronaviruses, namely PEDV and PDCoV, in the same sample.

Description

Technical Field

[0001] The present invention belongs to the technical field of inspection and quarantine, and particularly relates to a primer set for detecting porcine pathogenic coronaviruses, a modified primer set, and their applications. Background Art

[0002] Viral diarrhea in neonatal piglets is an important infectious disease that causes piglet deaths, can lead to severe diarrhea in pigs at all stages, and the mortality rate of piglets within 7 days of age reaches over 90%. Coronaviruses that cause viral diarrhea in neonatal piglets include porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (porcine type D coronavirus, PDCoV), and transmissible gastroenteritis virus of swine (TGEV). In recent years, through the use of vaccines, the prevalence rate of TGEV has decreased significantly, while the infection rates of PEDV and PDCoV have increased significantly, becoming the main pathogens causing neonatal piglet deaths, and the diarrhea symptoms are extremely similar. Although they are all members of the genus Coronavirus, with the widespread use of new therapeutic agents, self-made vaccines and other products, achieving differential diagnosis of the two viruses is an important means for precise epidemic control. Therefore, being able to quickly distinguish the two viruses helps to reduce the infection window period of healthy pigs, save economic losses, and lay a foundation for efficient breeding.

[0003] Porcine epidemic diarrhea (PED) is an acute infectious disease of pigs characterized by vomiting, dehydration, and watery diarrhea caused by PEDV, and it is one of the major diseases endangering the pig industry. PEDV is an enveloped single-stranded positive-sense RNA virus. Similarly, PDCoV is also an RNA virus of the Coronaviridae family, with a genome size of 25.3 - 25.4 kb, being a single-stranded positive-sense enveloped virus, and the virus particles are typically coronoid. PDCoV spreads by the fecal-oral route and contact with contaminants in infected pigs, and is most susceptible to neonatal piglets. Piglets show symptoms such as loss of appetite, watery diarrhea, vomiting, etc., and severely ill piglets may die.

[0004] PEDV and PDCoV are the main prevalent pathogens causing neonatal piglet deaths in China in recent years. The traditional detection mode requires a large amount of time through processes such as sample collection, transportation, and detection, increasing the risk of continuous spread of pig farm diseases, and laboratory detection has high requirements for facilities and the operation techniques of laboratory personnel. Therefore, there is an urgent need in this field to establish a precise detection method based on new virus targets that can distinguish PEDV and PDCoV on-site. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a primer set for instant detection of porcine pathogenic coronaviruses (PEDV and PDCoV), which can be combined with microfluidic colloidal gold detection technology, and has the advantages of being able to instantaneously detect on-site, being convenient, simple, having moderate sensitivity, good specificity, and high accuracy.

[0006] To achieve the above-mentioned invention purposes, the present invention provides the following technical solutions:

[0007] The present invention provides a primer set for detecting porcine pathogenic coronavirus. When the porcine pathogenic coronavirus is porcine epidemic diarrhea virus, the primer set includes Group 1 primers, and the nucleotide sequences of the primer pairs in Group 1 primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; when the porcine pathogenic coronavirus is porcine deltacoronavirus, the primer set includes Group 2 primers, and the nucleotide sequences of the primer pairs in Group 2 primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0008] The present invention also provides a modified primer set for detecting porcine pathogenic coronavirus, and the above primer set is labeled with a fluorescent group and a hapten.

[0009] Preferably, the fluorescent group includes 6-FAM, and the hapten includes digoxin.

[0010] The present invention also provides an application of the above primer set or the above modified primer set in the preparation of a porcine pathogenic coronavirus detection product.

[0011] The present invention also provides a porcine pathogenic coronavirus detection kit, and the kit includes the above primer set.

[0012] The present invention also provides a porcine pathogenic coronavirus microfluidic PCR-gold immunochromatographic assay kit, and the kit includes the above modified primer set, a microfluidic chip and a gold immunochromatographic assay strip; an anti-fluorescent group antibody is fixed at the sample loading area of the gold immunochromatographic assay strip, an antibody against the anti-fluorescent group antibody is at the quality control line, and the detection line is designed as a hapten binding line.

[0013] The present invention also provides a non-diagnostic porcine pathogenic coronavirus microfluidic PCR-gold immunochromatographic assay method, including the following steps: adding a reaction system containing the RNA of the sample to be detected and the above modified primer set into the sample loading hole of the microfluidic chip, reacting with a microfluidic PCR instrument, after the reaction is completed, detecting with a gold immunochromatographic assay strip. If both the detection line and the quality control line show positive color, only the quality control line shows negative color. If the quality control line does not show color, the result is regarded as invalid and needs to be retested.

[0014] Preferably, the reaction program of the microfluidic PCR instrument is: 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 60°C for 20 s, 35 cycles.

[0015] Preferably, the reaction system is 20 μL in volume, including 1 μL of enzyme mixture, 14 μL of Buffer mixture and 5 μL of template.

[0016] Advantages of the present invention:

[0017] For the present invention, primers are designed for PEDV and PDCoV respectively. The designed primers have the advantages of high accuracy, moderate sensitivity and good specificity, and can be used in combination with microfluidic and colloidal gold methods. By using microfluidic technology, the amplification of target fragments is completed in a chip, and finally, through colloidal gold technology, a visual result is achieved, which has the characteristics of convenience, simplicity, high sensitivity and good repeatability. The reaction of the present invention is completed in one step from RNA to amplification in the reaction cavity of the microfluidic chip, eliminating the two-step reaction from reverse transcription to amplification, reducing the contamination caused by opening the lid, and avoiding false positive results. In addition, the two groups of primers of the present invention can simultaneously perform PCR reactions in the same chip, and can detect two porcine pathogenic coronaviruses, PEDV and PDCoV, in the same sample. For DNA templates, the detection limit of group 1 primers can reach 97.62 copies / μL, and the detection limit of group 2 primers can reach 80.4 copies / μL. For RNA templates, the detection limit of group 1 modified primers can reach 280 copies / μL, and the detection limit of group 2 modified primers can reach 265 copies / μL.

[0018] The kit provided by the present invention can perform immediate detection on samples obtained on-site, analyze them immediately at the sampling site, and obtain results on-site, reducing the complex processing procedures for samples, quickly obtaining test results, and greatly shortening the time to obtain results, providing an effective tool for the prevention, transmission and treatment of PEDV and PDCoV. The present invention adopts microfluidic colloidal gold detection technology, which can complete the whole process from nucleic acid extraction to PCR amplification and then to detection results on-site, greatly compressing the diagnostic time. In addition, the diagnostic results of microfluidics combined with colloidal gold technology are extremely accurate, and basically realize the automatic detection process, and can also play the role of compressing the detection cost and improving the efficiency.

[0019] The present invention utilizes microfluidic technology to integrate processes such as detection onto a chip of a few square centimeters, achieving miniaturization, automation, integration and portability. It has the advantages of less sample consumption, fast detection speed, simple operation, multi-functional integration, small volume and easy portability, greatly expanding the application space of on-site immediate diagnosis. Description of the Drawings

[0020] Figure 1 It is the principle of colloidal gold color development. Among them, A is the schematic diagram of the test strip, B is the schematic diagram of the gene reaction, and C is the schematic diagram of the color development after loading the sample on the test strip;

[0021] Figure 2This is a flowchart of the use of the colloidal gold test paper cartridge. From left to right, it represents the four steps of peeling off the sealing strip of the liquid outlet on the back of the cartridge, installing the chip into the slot on the back of the cartridge, prying open the four support pillars on the front of the cartridge, and slowly pressing the push rod to the bottom.

[0022] Figure 3 The chip placement method for adding samples;

[0023] Figure 4 It is a microfluidic PCR instrument;

[0024] Figure 5 is the interpretation of the test results, where 1 means positive, 2 means negative, 3 means invalid, and 4 means invalid;

[0025] Figure 6 This is the sequencing result of the PEDV common PCR positive reference;

[0026] Figure 7 This is the sequencing result of the PDCoV common PCR positive reference;

[0027] Figure 8 The results are for MacConkey plates. The left picture shows the results for PEDV-M (recombinant E. coli containing the PEDV M gene), and the right picture shows the results for PDCoV-M (recombinant E. coli containing the PDCoV M gene);

[0028] Figure 9 The results of eosin-methylene blue plate, the left picture is the result of PEDV-M, and the right picture is the result of PDCoV-M;

[0029] Figure 10 The results of Gram staining microscopy observations, the left picture is the PEDV-M result, and the right picture is the PDCoV-M result;

[0030] Figure 11 are the amplification results of different PEDV primer sets, where M is a marker; 1-4 correspond to primer sets PEDV-M1 (103 bp), PEDV-O2 (246 bp), PEDV-O1 (212 bp) and primer pair PEDV-M2 (202 bp) of Example 2, respectively;

[0031] Figure 12 1-4 are PDCoV positive samples (prepared in Example 1), corresponding to primer pairs PDCoV-cc, PDCoV-N, PDCoV-CM1 (Example 3), PDCoV-CM4, and 5 is a negative control;

[0032] Figure 13Verification results of the specificity of the primer pair described in Example 2, where M is the marker, PEDV is the positive control, N is the negative control, and the rest are different types of viruses;

[0033] Figure 14 Verification results of the specificity of the primer pair described in Example 3, where M is the marker, PDCoV is the positive control, N is the negative control, and the rest are different types of viruses;

[0034] Figure 15 Verification results of the specificity of the modified primer pair described in Example 6, where E is the positive control, A is the African swine fever nucleic acid sample, R is the porcine rotavirus nucleic acid sample, D is the PDCoV nucleic acid sample, O is the foot-and-mouth disease OZK93 strain nucleic acid sample, T is the TGEV nucleic acid sample, and N is the negative control;

[0035] Figure 16 Results of agarose gel electrophoresis after microfluidic PCR. In the figure, 1 is the positive control, and the groups represented by the remaining letter codes are the same as Figure 15 ;

[0036] Figure 17 Verification results of the specificity of the modified primer pair described in Example 7, where the unlabeled one on the far left is the positive control, E is the PEDV nucleic acid sample, A is the African swine fever nucleic acid sample, R is the porcine rotavirus nucleic acid sample, O is the foot-and-mouth disease OZK93 strain nucleic acid sample, T is the TGEV nucleic acid sample, and N is the negative control;

[0037] Figure 18 Results of agarose gel electrophoresis after microfluidic PCR. In the figure, D is the positive control, and the groups represented by the remaining letter codes are the same as Figure 17 ;

[0038] Figure 19 Sensitivity detection results of the primer pair described in Example 2, where M is the marker, and 1-9 are 9.762×10 8 、9.762×10 7 、9.762×10 6 、9.762×10 5 、9.762×10 4 、9.762×10 3 、9.762×10 2 、9.762×10 1 、9.762×10 0 copies / μL, and 10 is the negative control;

[0039] Figure 20 Sensitivity detection results of the primer pair described in Example 3, where M is the marker, and 1-8 are 8.04×10 9copies / μL, 8.04×10 7 copies / μL, 8.04×10 6 copies / μL, 8.04×10 5 copies / μL, 8.04×10 4 copies / μL, 8.04×10 3 copies / μL, 8.04×10 2 copies / μL, 80.4 copies / μL; N is the negative control;

[0040] Figure 21 It is the sensitivity detection result of the modified primer pair described in Example 6. From left to right, the detected copy numbers are 2800 copies / μL, 280 copies / μL, 28 copies / μL, and the negative control;

[0041] Figure 22 It is the agarose gel electrophoresis result after microfluidic PCR of the modified primer pair described in Example 6. Among them, 1-3 correspond to 2800 copies / μL, 280 copies / μL, 28 copies / μL respectively, N is the negative control, and M is the marker;

[0042] Figure 23 It is the sensitivity detection result of the modified primer pair described in Example 7. From left to right, the detected copy numbers are 26500 copies / μL, 2650 copies / μL, 265 copies / μL, 26.5 copies / μL;

[0043] Figure 24 It is the agarose gel electrophoresis result after microfluidic PCR of the modified primer pair described in Example 7. Among them, 1-4 correspond to 26500 copies / μL, 2650 copies / μL, 265 copies / μL, 26.5 copies / μL respectively, and M is the marker;

[0044] Figure 25 It is the detection result of simultaneously detecting porcine epidemic diarrhea virus and porcine deltacoronavirus. Among them, 1 is the negative control; 2 is the nucleic acid of PEDV virus; 3 is the negative control; 4 is the nucleic acid of PDCoV virus.

[0045] The Marker involved in the above figures is 2000bp. Detailed implementation method

[0046] The present invention provides a primer set for detecting porcine pathogenic coronavirus. When the porcine pathogenic coronavirus is porcine epidemic diarrhea virus, the primer set includes Group 1 primers, and the nucleotide sequences of the primer pairs in Group 1 primers are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively; when the porcine pathogenic coronavirus is porcine deltacoronavirus, the primer set includes Group 2 primers, and the nucleotide sequences of the primer pairs in Group 2 primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0047] In the present invention, the Group 1 primers are a primer pair designed based on the gene sequence of porcine epidemic diarrhea virus. The nucleotide sequence of the forward primer is TATGGTGTCAAGATGGCTATTCTATGG (SEQ ID NO.1), and the nucleotide sequence of the reverse primer is AAAGACCACCAAGAATGTGTCCT (SEQ ID NO.2). The Group 2 primers are a primer pair designed based on the gene sequence of porcine deltacoronavirus. The nucleotide sequence of the forward primer is ACCAGTCGTTAAGCATGGCA (SEQ ID NO.3), and the nucleotide sequence of the reverse primer is TGGTGTGAAGTCCAGCGTTT (SEQ ID NO.4).

[0048] The present invention also provides a modified primer set for detecting porcine pathogenic coronavirus, and the above primer set is labeled with a fluorescent group and a hapten.

[0049] In the present invention, the fluorescent group preferably includes 6-FAM, and the hapten preferably includes digoxin. In the present invention, when labeling the above Group 1 primers with a fluorescent group and a hapten, it is preferred to label the forward primer with digoxin, specifically: 5’-dig-TATGGTGTCAAGATGGCTATTCTATGG, and label the reverse primer with 6-FAM, specifically: 5’6-FAM-AAAGACCACCAAGAATGTGTCCT. When labeling the above Group 2 primers with a fluorescent group and a hapten, it is preferred to label the forward primer with 6-FAM, specifically: 5’6-FAM-ACCAGTCGTTAAGCATGGCA, and label the reverse primer with digoxin, specifically: 5’-dig-TGGTGTGAAGTCCAGCGTTT. The present invention has no special limitation on the specific sources of 6-FAM and digoxin, and conventional commercially available products in the art can be used.

[0050] The present invention also provides the application of the above primer set or the above modified primer set in the preparation of a porcine pathogenic coronavirus detection product. In the present invention, the product preferably includes a kit, and the porcine pathogenic coronavirus is porcine epidemic diarrhea virus and / or porcine deltacoronavirus.

[0051] The present invention also provides a detection kit for porcine pathogenic coronaviruses. Preferably, the kit includes the above primer sets. The detection kit for porcine pathogenic coronaviruses of the present invention preferably further includes a positive reference quality plasmid. When the porcine pathogenic coronavirus is porcine epidemic diarrhea virus, the positive reference quality plasmid is preferably prepared through the following steps: using the full-length PEDV virus as a template, amplifying the target fragment with PEDV-M-all-F (SEQ ID NO.5) and PEDV-M-all-R (SEQ ID NO.6); then running agarose gel electrophoresis for gel recovery; using pEasy-Blunt (CB101) from TransGen Company as a cloning vector and Trans1-T1 Phage competent cells to prepare the positive reference product. When the porcine pathogenic coronavirus is porcine deltacoronavirus, the positive reference quality plasmid is preferably prepared through the following steps: using the full-length PDCoV virus as a template, amplifying the target fragment with PDCoV-M-All-F59 (SEQ ID NO.7) and PDCoV-M-All-R617 (SEQ ID NO.8) primers; then running agarose gel electrophoresis for gel recovery; using pEasy-Blunt (CB101) from TransGen Company as a cloning vector and Trans1-T1 Phage competent cells to prepare the positive reference product.

[0052] The present invention also provides a microfluidic PCR-gold immunochromatographic assay kit for porcine pathogenic coronaviruses. The kit includes the above modified primer sets, a microfluidic chip, and a gold immunochromatographic assay strip; an anti-fluorescent group antibody is fixed at the upper sample plate of the gold immunochromatographic assay strip, an antibody against the anti-fluorescent group antibody is at the quality control line, and the detection line is designed as a hapten-binding line.

[0053] In the present invention, the microfluidic chip is purchased from Beijing Yuanjingtaike Biotech Co., Ltd. When performing microfluidic reactions, the microfluidic chip and the microfluidic PCR instrument need to be used in combination. Therefore, the microfluidic PCR instrument of the present invention is purchased from Beijing Yuanjingtaike Biotech Co., Ltd. The gold immunochromatographic assay strip of the present invention is prepared by Beijing Yuanjingtaike Biotech Co., Ltd. The principle of the gold immunochromatographic reaction is shown in Figure 1。There is an anti-fluorescent antibody at the sample area on the test strip. When loading the sample, it will flow along with the liquid containing the target DNA with a fluorescent group towards the test line; in the present invention, the modified primer is designed to carry two groups, so the amplified target gene has these two groups at the 5' end. There is a hapten (biotin / digoxin) binding line on the test strip, and the target gene containing both biotin / digoxin group and fluorescent group will bind to this binding line and show color. If the loading solution does not contain the labeled target gene, then even if there are other genes in the solution, they will not bind and show color at the biotin / digoxin binding site. However, the antibody against the fluorescent group on the sample area will bind to the control line and show color, and the result is negative. Therefore, the control line must show color. If it does not show color, it indicates that there is a problem with the test strip and a new test strip needs to be replaced for re-detection.

[0054] In the present invention, the colloidal gold test strip provided by Beijing Yuanjingtaike Biotechnology Co., Ltd. is preferably of a cartridge structure. After the microfluidic PCR reaction is completed, the microfluidic chip is preferably installed in the card slot on the back of the cartridge, and the specific process is as Figure 2 shown. In the present invention, after the microfluidic PCR reaction is completed, the reaction solution in the microfluidic chip can also be dropped onto the loading position of the colloidal gold test strip for a color reaction. Or take the reaction solution and insert the loading position of the colloidal gold test strip into the reaction solution for a color reaction.

[0055] The microfluidic PCR-gold immunochromatographic assay kit for porcine pathogenic coronavirus of the present invention preferably further includes an RNA positive reference. The RNA positive reference is preferably prepared through the following steps: after amplifying the above-mentioned positive reference plasmid with the universal primer M13, gel recovery is carried out to obtain the target fragment containing the T7 promoter, then in vitro transcription is carried out on the linear fragment to obtain the RNA of the target fragment, and the RNA positive reference is obtained through purification. The nucleotide sequence of the RNA positive reference of PEDV is as shown in SEQ ID NO.9, and the nucleotide sequence of the RNA positive reference of PDCoV is as shown in SEQ ID NO.10.

[0056] The present invention also provides a microfluidic PCR-gold immunochromatographic assay method for porcine pathogenic coronavirus for non-diagnostic purposes, which preferably includes the following steps: adding a reaction system containing the RNA of the sample to be tested and a modified primer set to the sample loading hole of the microfluidic chip, reacting with a microfluidic PCR instrument, and after the reaction is completed, performing detection with a colloidal gold test strip. If both the test line and the control line show color, it is positive; if only the control line shows color, it is negative; if the control line does not show color, the result is considered invalid and needs to be re-tested.

[0057] In the present invention, when the modified primer set added to the reaction system is a modified group 1 primer set, if both the detection line and the quality control line are colored positive, it indicates that the sample to be tested contains PEDV, and when the modified primer set added to the reaction system is a modified group 2 primer set, if both the detection line and the quality control line are colored positive, it indicates that the sample to be tested contains PDCoV. The present invention does not specifically limit the specific method for obtaining the RNA of the sample to be tested, and any conventional nucleic acid extraction method in the art can be used. In the present invention, sample collection and processing preferably include the following four methods: (1) Anal swab: insert a sterile cotton swab or swab into the pig anus (based on the cotton swab or swab part being fully inserted into the anus), rotate in the same direction 3 times to ensure that feces are fully obtained. Immerse the anal swab in a sterilized EP tube containing 0.5 ml of sterile saline, vortex for 1 minute, centrifuge at 12000rpm for 2 minutes, and take the supernatant for use. (2) Fecal sample: Use a clean medicine spoon or sterile cotton swab to scrape an appropriate amount of feces (generally about 0.5g), put it into a sterilized EP tube containing 0.5ml sterile saline, vortex for 1 minute, centrifuge at 12000rpm for 2 minutes, and take the supernatant for later use. (3) Intestinal tissue: Aseptically collect tissue of about 0.5cm×0.5cm in the jejunum of the small intestine, add 0.5-1ml sterile saline to fully homogenize or grind, freeze and thaw the tissue suspension twice at below -20℃, centrifuge at 12000rpm for 2 minutes, and take the supernatant for later use. (4) Cell culture: Freeze and thaw the collected cell culture twice at below -20℃, centrifuge at 12000rpm for 2 minutes, and take the supernatant for later use. In the present invention, the reaction system is based on a volume of 20μL, and the ratio of each raw material is preferably as shown in Table 1.

[0058] Table 1 Reaction system

[0059] Reagent Name Volume Enzyme Mix 1 μL Buffer Mix 14 μL Template (Sample to be Measured) 5 μL

[0060] The specific ratio of the enzyme mixture in Table 1 is preferably shown in Table 2, and the specific ratio of the buffer mixture in Table 1 is preferably shown in Table 3.

[0061] Table 2 Enzyme mixture (100 times) formula

[0062] Reagent Name Specification Volume AK Taq DNA Polymerase - Glycerol Free 5 U / μL 20 - 30 μL Mutiscript Reverse TranscriptaseⅡ - Glycerol Free 200 U / μL 10 - 20 μL RNasin - Glycerol Free 40 U / μL 14 - 22 μL Heat-labile Uracil-DNA Glycosylase-1 Glycerol Free 1 U / μL 30 - 50 μL

[0063] Table 3 Buffer mixture (detection buffer) (50 times) formula

[0064] Reagent Name Specification Volume SolutionⅠ 50× 10 - 20 μL dUTP Mix 20 mM 10 - 20 μL Forward Primer 10 uM 10 - 40 μL Reverse Primer 10 uM 10 - 40 μL <![CDATA[5×AK RT Buffer(Mg 2+ Plus)]]> 5× 100 - 150 μL <![CDATA[Mg 2+ > 100 uM 10 μL DEPC Treated Water 525 μL

[0065] The present invention has no particular limitation on the specific sources of the above raw materials, and any commercially available products in the art can be used. When the reaction system containing the sample RNA to be tested and the modified primer set is added to the sample well of the microfluidic chip, the microfluidic chip is arranged as follows:Figure 3 As shown. The microfluidic PCR instrument used in the present invention is purchased from Beijing Yuanjingtaike Biotechnology Co., Ltd., as Figure 4 shown. After the reaction of the microfluidic PCR instrument, a colloidal gold test strip is used for detection, and the result judgment is as Figure 5 shown. If both the test line (T) and the quality control line (C) show color, it is positive; if only the quality control line (C) shows color, it is negative; if the quality control line (C) does not show color, the result is regarded as invalid and needs to be retested.

[0066] In the present invention, the reaction program of the microfluidic PCR instrument is preferably: 55 °C for 5 min; 95 °C for 150 s, 1 cycle; 95 °C for 5 s, 60 °C for 20 s, 35 cycles.

[0067] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0068] In the following embodiments, unless otherwise specified, they are all conventional methods.

[0069] In the following embodiments, the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels. All the Markers in the figures involved in the following embodiments are 2000 bp.

[0070] Example 1

[0071] Preparation of ordinary PCR positive reference

[0072] Using the full-length PEDV virus (NCBI, NC_003436) as a template, PEDV-M-all-F (SEQ ID NO.5) and PEDV-M-all-R (SEQ ID_NO.6) are used to amplify the target fragment. 98 °C, 3 min for a total of 1 cycle; 98 °C, 10 s, 55 °C, 5 s, 68 °C, 7 s for a total of 40 cycles; 72 °C, 5 min for a total of 1 cycle; then run agarose gel electrophoresis for gel recovery; using TransGen's Peasy-Blunt (CB101) as a cloning vector and Trans1-T1 Phage competent to prepare a positive reference. The constructed positive reference is extracted with a plasmid extraction kit (Novizan, DC201-01), and sent to Sangon for sequencing verification. The sequencing results are as Figure 6 shown. No base changes occurred.

[0073] Using the full-length PDCoV virus (NCBI, NC_039208) as a template, the target fragment was amplified with the primers PDCoV-M-All-F59 (SEQ ID NO.7) and PDCoV-M-All-R617 (SEQ ID NO.8). One cycle at 98°C for 3 min; 40 cycles at 98°C for 10 s, 55°C for 5 s, 68°C for 7 s; one cycle at 72°C for 5 min; then run agarose gel electrophoresis for gel extraction; using Peasy-Blunt (CB101) from TransGen as the cloning vector and Trans1-T1 Phage competent cells to prepare the positive reference. The constructed positive reference was extracted with a plasmid extraction kit (Novoprotein, DC201-01) and sent to Sangon for sequencing verification. The sequencing results are as Figure 7 shown, and no base changes occurred.

[0074] In addition, the following identifications were carried out:

[0075] Positive strain: strain standard

[0076] Morphology and biochemical characteristics: The strains PEDV-M and PDCoV-M are both Escherichia coli, Gram-negative straight rods, observed as small red rods under the microscope, with blunt ends, and the size is 0.4 - 0.7 μm × 2 - 3 μm. The biochemical characteristics should conform to those of Escherichia coli in bacterial classification. Both PEDV-M and PDCoV-M are ampicillin-resistant (Amp+).

[0077] Cultural characteristics: PEDV-M and PDCoV-M grow rapidly in LB (Amp+) liquid medium (weigh 21 g of commercial LB broth powder, add 1 L of distilled water or deionized water, stir until completely dissolved, then dispense into test tubes or Erlenmeyer flasks, autoclave at 121 °C for 15 minutes. When the medium cools to about 50 °C, add Amp with a final concentration of 100 μg / ml, mix well, and store at 4 - 8 °C for later use). After culturing at 37 °C for 12 - 20 hours, it shows uniform turbidity and there is viscous precipitation at the bottom of the tube. On the LB solid plate (weigh 36 g of commercial LB agar powder, add 1 L of distilled water or deionized water, stir until completely dissolved, then dispense into Erlenmeyer flasks, autoclave at 121 °C for 15 minutes. When the medium cools to about 50 °C, add Amp with a final concentration of 100 μg / ml, mix well and pour into a sterile Petri dish, and store at 4 - 8 °C after solidification), after culturing at 37 °C for 24 hours, colonies are formed with neat edges, round convex, shiny, moist, smooth, translucent, and off-white in color, with a diameter of 2 - 3 mm. On the MacConkey agar plate (weigh 55 g of commercial MacConkey agar powder, add 1 L of distilled water or deionized water, stir until completely dissolved, then dispense into Erlenmeyer flasks, autoclave at 121 °C for 15 minutes, pour into a sterile Petri dish when cooled to about 50 °C, and store at 4 - 8 °C after solidification), black colonies with metallic sheen are formed (such as Figure 8 ); on the eosin methylene blue agar plate (weigh 37.5 g of commercial eosin methylene blue agar medium powder, add 1 L of distilled water or deionized water, stir until completely dissolved, then dispense into Erlenmeyer flasks, autoclave at 121 °C for 15 minutes, pour into a sterile Petri dish when cooled to about 50 °C, and store at 4 - 8 °C after solidification), red colonies are formed (such as Figure 9 ).

[0078] After Gram staining and microscopic observation, small red bacilli can be seen, with blunt ends at both sides, and the size is about 0.4 - 0.7 μm × 2 - 3 μm ( Figure 10 ), which conforms to the staining characteristics of Escherichia coli.

[0079] Molecular biological characteristics: The strains PEDV-M and PDCoV-M are respectively inoculated into LB (Amp+) liquid medium and cultured with shaking at 37 °C for 12 hours. The obtained bacterial liquid is used to extract plasmids according to the instructions of the plasmid extraction kit (Novizan, DC201-01). The plasmid is used as a template for PCR and the colloidal gold-based microfluidic method. After agarose gel electrophoresis, clear target bands can be seen; there are also positive bands on the colloidal gold strip.

[0080] The results of biochemical identification are shown in Table 4. For the PEDV-M and PDCoV-M strains, both the butt and the slant of the triple sugar iron base are yellow, ferment glucose and produce gas, ferment maltose and rhamnose, urease is negative, M.R. is positive, and V.P. is negative, which conforms to the biochemical characteristics of Escherichia coli.

[0081] Biochemical identification characteristics of bacterial strains in Table 4

[0082]

[0083]

[0084] Note: "+" represents a positive result; "-" represents a negative result.

[0085] The above identification results indicate that a common PCR positive reference product containing PEDV and PDCoV genes was indeed obtained.

[0086] Preparation of microfluidic PCR-gold immunochromatography positive reference product

[0087] The common PCR positive reference product prepared above was amplified with the universal primer M13, and then gel extraction was performed using a gel extraction kit (BioFlux, BSC02S1) to obtain the target fragment containing the T7 promoter. Then, an in vitro transcription kit (Vazyme TR101-01) was used to perform in vitro transcription on the linear fragment to obtain the RNA of the target fragment (shown as SEQ ID NO.9 and SEQ ID NO.10 respectively), which was purified (Novoprotein No.: S125) as the microfluidic PCR-gold immunochromatography positive reference product.

[0088] Example 2

[0089] Nucleic acid extraction: After extracting nucleic acid from the test sample according to the instructions of a commercially available viral nucleic acid extraction kit (RNA extraction kit, NewGene Biochemicals; M062), it was directly used for detection. If the sample was not immediately detected after extraction, it was stored at -70°C for later use, and repeated freezing and thawing should be avoided.

[0090] The extracted nucleic acid was subjected to PCR amplification using the PEDV-M2 primer pair: PEDV-M2 F: TATGGTGTCAAGATGGCTATTCTATGG (SEQ ID NO.1) and PEDV-M2 R: AAAGACCACCAAGAATGTGTCCT (SEQ ID NO.2). The reaction program was one cycle at 95°C for 3 min; 35 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 20 s; and one cycle at 72°C for 5 min. The reaction system was 10 μL of Taq enzyme (Vazyme), 0.2 μL of primer F / R, 7.6 μL of sterile water, and 2 μL of template. After the amplification was completed, agarose gel electrophoresis was performed. If a band appeared, it indicated that the test sample contained PEDV; if no band appeared, it indicated that the test sample did not contain PEDV.

[0091] Example 3

[0092] The difference from Example 2 is that the primer pair used (denoted as PDCoV-CM1) is the PDCoV-1 primer pair: PDCoV-1F: ACCAGTCGTTAAGCATGGCA (SEQ ID NO.3) and PDCoV-1R: TGGTGTGAAGTCCAGCGTTT (SEQ ID NO.4), and the rest is the same as in Example 2. If a band appears, it indicates that the sample to be tested contains PDCoV; if no band appears, it indicates that the sample to be tested does not contain PDCoV.

[0093] Comparative Example 1

[0094] The difference from Example 2 is that the primer pair used is different, and the rest is the same as in Example 2. The specific primers used are: three pairs of primers designed separately for the conserved region of PEDV. One pair of primers (denoted as PEDV-M1) is F: TGGCGCAGGACACATTCTT (SEQ ID NO.11), R: GGTGCTCCAAGCACTGGAA (SEQ ID NO.12), one pair of primers (denoted as PEDV-O2) is F: AGACATACTAATTTTTGTGTTGTGGGC (SEQ ID NO.13), R: ACAATGCTCATGGTGGTTAAGGC (SEQ ID NO.14), and the other pair of primers (denoted as PEDV-O1) is F: ACATAGTGCTTTTGTTAGTGTG (SEQ ID NO.15) R: TTTTCCTCTGGTTTTGCAT (SEQ ID NO.16).

[0095] The amplification products of Example 2 and Comparative Example 1 were subjected to agarose gel electrophoresis, and the results are as Figure 11 shown. It can be seen that the amplification efficiency of the primer pair in Example 2 of the present invention is higher.

[0096] Comparative Example 2

[0097] The difference from Example 3 lies in the different primer pairs used, and the rest is the same as in Example 3. The specific primers used are as follows: Three additional primer pairs were designed for the conserved region of PDCoV. One primer pair (denoted as PDCoV-cc) is F: GGTGCGTCTTATTATGTGCAACAT (SEQ ID NO.17) and R: TAGARACYTCATCHACHACHACAAT (SEQ ID NO.18). One primer pair (denoted as PDCoV-N) is F: CTATGAGCCACCCACCAA (SEQ ID NO.19) and R: TCCCACTCCCAATCCTGT (SEQ ID NO.20). Another primer pair (denoted as PDCoV-CM4) is F: TTGGCTGCTCCAACCCT (SEQ ID NO.21), R: CCATGCTTAACGACTGGTGTG (SEQ ID NO.22).

[0098] The amplification products of Example 3 and Comparative Example 2 were subjected to agarose gel electrophoresis, and the results are as Figure 12 shown. It can be seen that the primer pair in Example 3 of the present invention has a higher amplification efficiency.

[0099] Example 4

[0100] The difference from Example 2 is that the test samples were replaced with a positive control (PEDV ordinary PCR positive reference product obtained in Example 1), a negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), and transmissible gastroenteritis virus of swine (TGEV), respectively, and the rest is the same as in Example 2. The results are as Figure 13 shown. It shows that the primer pair designed in Example 2 of the present invention has high specificity.

[0101] Example 5

[0102] The difference from Example 3 is that the test samples were replaced with a positive control (PDCoV ordinary PCR positive reference product obtained in Example 1), a negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), transmissible gastroenteritis virus of swine (TGEV), and porcine epidemic diarrhea (PEDV), respectively, and the rest is the same as in Example 3. The results are as Figure 14 shown. It shows that the primer pair designed in Example 3 of the present invention has high specificity.

[0103] Example 6

[0104] Nucleic acid extraction: After extracting nucleic acid from the sample to be tested according to the instructions of a commercially available viral nucleic acid extraction kit (RNA extraction kit, NewBase Biochemical; M063), it is directly used for detection. If the sample is not immediately detected after extraction, it is stored at -70 °C for future use, and repeated freezing and thawing should be avoided.

[0105] The primer pairs described in Example 2 were labeled with digoxin and FAM, namely 5’Dig-TATGGTGTCAAGATGGCTATTCTATGG and 5’6-FAM-AAAGACCACCAAGAATGTGTCCT. The modified primer pairs were used for detecting the sample to be tested by the microfluidic PCR colloidal gold method. The microfluidic chip and the microfluidic PCR instrument were both purchased from Beijing Yuanjingtaike Biotechnology Co., Ltd. The colloidal gold test strip was made by Beijing Yuanjingtaike Biotechnology Co., Ltd. Nanogold particles labeled with anti-FAM fluorescent group antibody were fixed at the upper sample plate of the colloidal gold test strip, and the antibody of anti-FAM fluorescent group antibody was at the quality control line. The detection line was designed as a digoxin hapten binding line.

[0106] The reaction system containing the sample to be tested and the modified primers as shown in Table 1 (the enzyme mixture formula in the reaction system was respectively according to the specifications in Table 2: AK Taq DNA Polymerase - without glycerol 24.2 μL, Mutiscript ReverseTranscriptaseⅡ - without glycerol 14.2 μL, RNasin - without glycerol 20 μL, Heat-labileUracil-DNAGlycosylase-1 without glycerol 40 μL, and the Buffer mixture was respectively according to the specifications in Table 3: SolutionⅠ 20 μL, dUTPMix 10 μL, upstream primer 10 μL, downstream primer 10 μL, 5×AK RT Buffer (Mg 2+ Plus) 120 μL, Mg 2+ 10 μL, DEPC-treated water

[0107] 525 μL) was added to the sample loading hole of the microfluidic chip as Figure 3 shown. The microfluidic PCR instrument was turned on, the chip was placed in the microfluidic PCR instrument, an aluminum film was pasted to prevent volatilization, the cover was covered, and the reaction program was set as 55 °C for 5 min; 95 °C for 150 s, 1 cycle; 95 °C for 5 s, 60 °C for 20 s, 35 cycles. After the reaction was completed, the liquid in the chip was collected and detected using a colloidal gold test strip. If both the detection line (T) and the quality control line (C) showed positive color, it indicated that the sample to be tested contained PEDV. If only the quality control line (C) showed positive color, it indicated that the sample to be tested did not contain PEDV. If the quality control line (C) did not show color, the result was regarded as invalid and needed to be retested.

[0108] Example 7

[0109] The difference from Example 6 is that the modified primer set used is obtained by modifying the primers in Example 3, specifically 5’6-FAM-ACCAGTCGTTAAGCATGGCA and 5’-dig-TGGTGTGAAGTCCAGCGTTT, and the reaction program is set as 55 °C for 5 min; 95 °C for 150 s, 1 cycle; 95 °C for 5 s, 60 °C for 20 s, 35 cycles. The rest are the same as in Example 6. If both the test line (T) and the control line (C) show color, it indicates that the sample to be tested contains PDCoV. If only the control line (C) shows color, it indicates that the sample to be tested does not contain PDCoV. If the control line (C) does not show color, the result is regarded as invalid and needs to be retested.

[0110] Example 8

[0111] The difference from Example 6 is that the samples to be tested are replaced with a positive control (PEDV ordinary PCR positive reference product obtained in Example 1), a negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), porcine deltacoronavirus (PDCoV), transmissible gastroenteritis virus of swine (TGEV), and foot-and-mouth disease of swine (OZK93), respectively, and the rest are the same as in Example 6. The results are as Figure 15 shown. After the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are as Figure 16 shown. It shows that the modified primer pair in Example 6 of the present invention has high specificity, and the colloidal gold detection result has high accuracy.

[0112] Example 9

[0113] The difference from Example 7 is that the samples to be tested are replaced with a positive control (PDCoV ordinary PCR positive reference product obtained in Example 1), a negative control (sterile water), African swine fever virus (ASFV), porcine rotavirus (RV), transmissible gastroenteritis virus of swine (TGEV), foot-and-mouth disease of swine (OZK93), and porcine epidemic diarrhea (PEDV), respectively, and the rest are the same as in Example 7. The results are as Figure 17 shown. After the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are as Figure 18 shown. It shows that the modified primer pair in Example 7 of the present invention has high specificity, and the colloidal gold detection result has high accuracy.

[0114] Example 10

[0115] Sensitivity verification of the primer pair described in Example 2

[0116] Extract the plasmid from the well-cultured positive bacterial strain (PEDV ordinary PCR positive reference product) described in Example 1, measure the concentration, and perform ten-fold serial dilution. Then, use them as templates respectively to perform the PCR amplification described in Example 2, and check at what dilution the band disappears (the negative control is sterile water). The formula for converting copy number is:

[0117] (6.02×10 23 copies / mol)×(concentration g / μL)×10×10 -9 / (MW g / mol)=copies / μL

[0118] The results are as Figure 19 shown. The detection limit of the primer pair described in Example 2 is 97.62 copies / μL.

[0119] Example 11

[0120] Sensitivity verification of the primer pair described in Example 3

[0121] Extract the plasmid from the well-cultured positive bacterial strain (PDCoV ordinary PCR positive reference product) described in Example 1, measure the concentration, and perform ten-fold serial dilution. Then, use them as templates respectively to perform the PCR amplification described in Example 3, and check at what dilution the band disappears (the negative control is sterile water). The results are as Figure 20 shown. The detection limit of the primer pair described in Example 3 is 80.4 copies / μL.

[0122] Example 12

[0123] Sensitivity of the modified primer pair described in Example 6 for microfluidic PCR colloidal gold detection

[0124] Using the microfluidic PCR-colloidal gold positive reference product (SEQ ID NO.9) obtained in Example 1 as the detection sample, measure the concentration, and perform ten-fold serial dilution. Then, use them as templates respectively to perform the detection by the method described in Example 6, and check at what dilution the detection line of the colloidal gold test strip does not show color (the negative control is sterile water). The results are as Figure 21 shown. After the microfluidic PCR reaction is completed, perform agarose gel electrophoresis on the reaction solution in the chip. The results are as Figure 22 shown. The detection limit of the modified primer pair described in Example 6 is 280 copies / μL.

[0125] Example 13

[0126] Sensitivity of the modified primer pair described in Example 7 for microfluidic PCR colloidal gold detection

[0127] The microfluidic PCR-colloidal gold positive reference (SEQ ID NO.10) obtained in Example 1 was used as the test sample, the concentration was measured, and the sample was diluted tenfold, and used as a template, respectively, and the method described in Example 7 was used to detect the number of times the colloidal gold test strip test line did not show color (the negative control was sterile water). The results are as follows Figure 23 As shown, after the microfluidic PCR reaction is completed, the reaction solution in the chip is subjected to agarose gel electrophoresis, and the results are as follows Figure 24 The detection limit of the modified primer pair described in Example 7 is 265 copies / μL.

[0128] Embodiment 14

[0129] exist Figure 3 The reaction system (PEDV detection system) containing the modified primer pair described in Example 6 was added to the sample wells 1 and 2 of the microfluidic chip shown in FIG. Figure 3 The reaction system (PDCoV detection system) containing the modified primer pair described in Example 7 was added to the No. 3 and No. 4 sample wells as shown, the negative control sample (sterile water) was added to the No. 1 sample well, the clinically obtained PEDV virus nucleic acid sample was added to the No. 2 sample well, the negative control sample (sterile water) was added to the No. 3 sample well, and the clinically obtained PDCoV virus nucleic acid sample was added to the No. 4 sample well. Microfluidic PCR was performed according to the reaction procedure described in Example 6. After the reaction was completed, the microfluidic chip was placed as shown in Figure 2 Install the colloidal gold test strip into the card slot on the back of the card box and perform the test. Figure 25 It is shown that the detection method of the present invention has high accuracy and can simultaneously detect two swine pathogenic coronaviruses, porcine epidemic diarrhea virus and porcine deltacoronavirus.

[0130] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A microfluidic PCR-gold colloidal detection kit for porcine pathogenic coronavirus, characterized in that, The kit includes a modified primer set, a microfluidic chip and a colloidal gold test strip; an anti-fluorescent group antibody is fixed at the upper sample plate of the colloidal gold test strip, an antibody against the anti-fluorescent group antibody is at the quality control line, and the test line is designed as a hapten binding line; The modified primer set is a primer set labeled with a fluorescent group and a hapten; When the porcine pathogenic coronavirus is porcine epidemic diarrhea virus, the primer set includes Group 1 primers, and the nucleotide sequences of the primer pairs in the Group 1 primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; When the porcine pathogenic coronavirus is porcine deltacoronavirus, the primer set includes Group 2 primers, and the nucleotide sequences of the primer pairs in the Group 2 primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

2. The kit according to claim 1, wherein The fluorescent group includes 6-FAM, and the hapten includes digoxin.

3. A microfluidic PCR-gold colloidal detection method for porcine pathogenic coronavirus for non-diagnostic purposes, characterized in that, It includes the following steps: Add the reaction system containing the RNA of the sample to be tested and the modified primer set into the sample loading hole of the microfluidic chip, react with a microfluidic PCR instrument. After the reaction is completed, use a colloidal gold test strip for detection. If both the test line and the quality control line show positive, only the quality control line shows negative. If the quality control line does not show color, the result is regarded as invalid and needs to be retested; The modified primer set is a primer set labeled with a fluorescent group and a hapten; When the porcine pathogenic coronavirus is porcine epidemic diarrhea virus, the primer set includes Group 1 primers, and the nucleotide sequences of the primer pairs in the Group 1 primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; When the porcine pathogenic coronavirus is porcine deltacoronavirus, the primer set includes Group 2 primers, and the nucleotide sequences of the primer pairs in the Group 2 primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

4. The method according to claim 3, characterized in that The reaction program of the microfluidic PCR instrument is: 55°C for 5 min; 95°C for 150 s, 1 cycle; 95°C for 5 s, 60°C for 20 s, 35 cycles.

5. The method according to claim 3, wherein The reaction system is 20 μL in volume and includes 1 μL of enzyme mixture, 14 μL of Buffer mixture and 5 μL of template.

Images