Carbapenem drug resistance gene detection reagent / kit and application thereof

Abstract

The invention discloses a carbapenem drug resistance gene detection reagent or kit, the detection reagent comprises a PCR detection liquid, the PCR detection liquid comprises upstream and downstream primer sequences and probe sequences of target genes, and the target genes are KPC, OXA-23, NDM, VIM and IMP. The invention also discloses application of the reagent or the kit. The reagent / kit provided by the invention has simple components, only comprises a PCR detection liquid and negative and positive quality control, can obtain detection results of five major carbapenem drug resistance genes, namely KPC, OXA-23, NDM, VIM and IMP, within about 50 minutes only once, and is simple and convenient to operate, low in detection cost, short in detection time and high in sensitivity. In addition, the lowest detectable concentration of detection of carbapenem drug resistance genes KPC, OXA-23, NDM, VIM and IMP is 10 copy / mL, and the sensitivity is high.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically, it relates to a carbapenem resistance gene detection reagent / kit and its application. Background Technology

[0002] Antimicrobial resistance is a global health problem, particularly concerning drug-resistant Gram-negative bacteria. Carbapenems are the most broad-spectrum and potent antimicrobial antibiotics among β-lactams, serving as the last line of defense against multidrug-resistant Gram-negative bacterial infections. Imipenem, meropenem, ertapenem, and doripenem are among the main antibiotics already in clinical practice. However, unfortunately, after more than 30 years of clinical use, various carbapenemases capable of hydrolyzing carbapenems have been identified. Among these, those causing the greatest harm to global clinical anti-infective therapy include: the KPC family of class A carbapenemases encoded by chromosomes or plasmids; the IMP, VIM, and NDM families of class B metallocarbapenemases; and OXA-48, OXA-23, OXA-51, and OXA-59 of class D carbapenemases. Because carbapenem-resistant strains often carry genes that also confer resistance to other antimicrobial drugs, exhibiting extensive or even pan-drug resistance, clinical anti-infective treatment faces a dilemma of having no effective drugs available. Therefore, conducting carbapenem resistance gene detection is of great significance.

[0003] Currently, laboratory methods for detecting carbapenemases are divided into phenotypic and genotypic detection. Phenotypic detection methods include the modified Hodge test, EDTA synergistic test, 3-aminophenylboronic acid inhibition test, Carba NP test, and CIM test. All of these methods require obtaining pure cultures and culturing for 16-24 hours before determining the strain's resistance, taking 2-3 days and significantly impacting clinical anti-infective treatment. The Carba NP test, in particular, requires self-made reagents, which have a short shelf life and may produce invalid results for some isolates, such as chromosome-mediated OXA isolates. The CIM test also presents problems such as false negatives when identifying a bacterium that simultaneously produces serine-type carbapenemases and metallo-β-lactamases, due to the different characteristics of the two enzymes.

[0004] Genotyping methods include enzyme immunochromatography (ELISA) and gene detection techniques. ELISA utilizes the principle of antigen-antibody binding. Its disadvantages include the need for specialized reagents to detect specific target genes, the possibility of false negatives if the gene being tested differs from the target gene, and its relatively high cost. Molecular detection techniques offer advantages such as speed (direct detection from samples) and ease of interpretation. For example, rapid detection of carbapenemase genes in CRE strains isolated from high-risk patients (immunosuppressed patients or bone marrow transplant recipients) can assist clinicians in initiating targeted anti-infective treatment programs as early as possible.

[0005] In summary, providing a reagent or kit with high specificity and sensitivity for detecting carbapenemase-encoding genes is of great significance for the research field of carbapenem-resistant bacteria. Summary of the Invention

[0006] The purpose of this invention is to provide a reagent or kit for detecting carbapenemase genes with high specificity and high sensitivity.

[0007] To achieve the above objectives, a first aspect of the present invention provides a carbapenem resistance gene detection reagent, the reagent comprising a PCR detection solution, the PCR detection solution comprising the upstream and downstream primer sequences and probe sequences of the target gene:

[0008] The target genes are Klebsiella pneumoniae carbapenemase (KPC), oxacillinase (OXA-23), New Delhi metallo-β-lactamase (NDM), Verona integron-encoded metallo-β-lactamase (VIM), and imipenemase (IMP), among which:

[0009] The upstream and downstream primer sequences of the KPC gene are shown in SEQ ID NO.1 and 2, and the probe sequence is shown in SEQ ID NO.3;

[0010] The upstream and downstream primer sequences of the OXA-23 gene are shown in SEQ ID NO.4 and 5, and the probe sequence is shown in SEQ ID NO.6;

[0011] The upstream and downstream primer sequences of the NDM gene are shown in SEQ ID NO.7 and 8, and the probe sequence is shown in SEQ ID NO.9;

[0012] The upstream and downstream primer sequences of the VIM gene are shown in SEQ ID NO.10 and 11, and the probe sequence is shown in SEQ ID NO.12;

[0013] The upstream and downstream primer sequences of the IMP gene are shown in SEQ ID NO.13 and 14, and the probe sequence is shown in SEQ ID NO.15.

[0014] According to the present invention, the PCR detection solution further includes upstream and downstream primers and probes for an internal standard gene. IIProbe qPCR SuperMix UDG, where:

[0015] The upstream and downstream primer sequences of the internal control gene are shown in SEQ ID NO.16 and 17, and the probe sequence of the internal control gene is shown in SEQ ID NO.18.

[0016] According to the present invention, the 5′ end of the probe contains a fluorescent reporter group and the 3′ end contains a fluorescent quencher group.

[0017] Furthermore, the fluorescent reporter group is selected from FAM, VIC, CY5 and ROX; the fluorescent quencher group is selected from BHQ1, BHQ2 and DBQ1.

[0018] According to the present invention, the negative control is RNase-free water; the positive control includes artificially synthesized sequences of the KPC gene, NDM gene, OXA-23 gene, VIM gene, IMP gene and RNaseP gene, which are respectively cloned into the pUC57 plasmid recombinant plasmid.

[0019] Furthermore, the artificially synthesized sequences of the KPC gene, NDM gene, OXA-23 gene, VIM gene, IMP gene and RNaseP gene are shown in SEQ ID NO.19-24, respectively.

[0020] In a second aspect, the present invention provides a carbapenem resistance gene detection kit, comprising the detection reagents described above.

[0021] Preferably, the concentrations of the upstream and downstream primers for the target KPC gene and OXA-23 gene are both 0.6 μM; the concentrations of the probes for the target KPC gene and OXA-23 gene are both 0.4 μM; the concentrations of the upstream and downstream primers for the target NDM gene, VIM gene, and IMP gene are both 0.4 μM; the concentrations of the probes for the target NDM gene, VIM gene, and IMP gene are both 0.2 μM; the concentrations of the internal control gene primers are both 0.2 μM; and the concentrations of the internal control gene probes are both 0.1 μM.

[0022] A third aspect of the present invention provides a primer and probe composition for detecting carbapenem resistance genes, comprising:

[0023] Upstream and downstream primers with sequences shown in SEQ ID NO. 1 and 2, and probe with sequence shown in SEQ ID NO. 3, for detecting the KPC gene;

[0024] Upstream and downstream primers with sequences shown in SEQ ID NO. 4 and 5, and probes with sequences shown in SEQ ID NO. 6, for detecting the OXA-23 gene;

[0025] Upstream and downstream primers with sequences shown in SEQ ID NO. 7 and 8, and probes with sequences shown in SEQ ID NO. 9, for detecting the NDM gene;

[0026] Upstream and downstream primers with sequences shown in SEQ ID NO. 10 and 11, and probe with sequence shown in SEQ ID NO. 12, for detecting the VIM gene;

[0027] Upstream and downstream primers with sequences shown in SEQ ID NO. 13 and 14, and a probe with a sequence shown in SEQ ID NO. 15, for detecting the IMP gene.

[0028] A fourth aspect of the present invention provides a method for detecting carbapenem resistance genes, comprising the following steps:

[0029] S1: Sample collection;

[0030] S2: Nucleic acid extraction;

[0031] S3: Add the extracted nucleic acid samples to the PCR detection solution described above;

[0032] S4: PCR amplification detection;

[0033] S5: Read and interpret the Ct values ​​of each gene.

[0034] Furthermore, the PCR amplification detection steps are as follows:

[0035]

[0036] In step 2, fluorescence detection is performed at 55℃. Detection channels: FAM, VIC, CY5, ROX.

[0037] In a fifth aspect, the present invention provides the application of the above-described detection reagents or kits for the detection of carbapenem resistance genes.

[0038] According to the present invention, the sample of S1 is sputum, urine, nasopharyngeal swab or bacterial strain sample.

[0039] The present invention has the following beneficial effects:

[0040] 1. The reagents / kits of this invention have simple components, including only PCR detection solution and negative and positive quality controls. They can obtain the detection results of five major carbapenem resistance genes in Klebsiella pneumoniae in about 50 minutes in just one test. The test is simple to operate, has low detection cost, and short detection time.

[0041] 2. The kit of the present invention has a minimum detectable concentration of 10 copies / mL for the carbapenem resistance genes KPC, OXA-23, NDM, VIM and IMP, and has high sensitivity.

[0042] 3. The kit of the present invention can detect carbapenem resistance genes in samples such as sputum, urine, nasopharyngeal swabs and bacterial strains, and the kit has high specificity. Attached Figure Description

[0043] Figure 1 10 recombinant plasmids containing the KPC gene 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 The results of amplification and detection using gradient dilution buffers at different concentrations (copy / mL) are given, with NC representing the negative control.

[0044] Figure 2 10 recombinant plasmids containing the OXA-23 gene 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 Results of tests using gradient dilutions at different concentrations (copy / mL, etc.) are given, with NC indicating a negative control.

[0045] Figure 3 10 recombinant plasmids containing the NDM gene 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 Results of tests using gradient dilutions at different concentrations (copy / mL, etc.) are given, with NC indicating a negative control.

[0046] Figure 4 10 recombinant plasmids containing the VIM gene 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 Results of tests using gradient dilutions at different concentrations (copy / mL, etc.) are given, with NC indicating a negative control.

[0047] Figure 5 10 recombinant plasmids containing the IMP gene 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1Results of tests using gradient dilutions at different concentrations (copy / mL, etc.) are given, with NC indicating a negative control.

[0048] Figure 6 This is a graph showing the test results of positive sputum sample No. 1 (a carbapenem-resistant clinical sample), where A and B are tubes A and B, respectively.

[0049] Figure 7 This is a graph showing the test results of positive sputum sample No. 2 (a carbapenem-resistant clinical sample), where A and B are tubes A and B, respectively.

[0050] Figure 8 This is a graph showing the test results of positive sputum sample No. 3 (a carbapenem-resistant clinical sample), where A and B are tubes A and B, respectively.

[0051] Figure 9 This is a graph showing the test results for positive urine sample No. 4 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0052] Figure 10 This is a test result image of positive nasopharyngeal swab sample No. 5 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0053] Figure 11 This is a graph showing the test results for positive sputum sample No. 6 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0054] Figure 12 This is a graph showing the test results for positive urine sample No. 7 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0055] Figure 13 The image shows the test results for positive sputum sample No. 8 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0056] Figure 14 This is a graph showing the test results for positive sputum sample No. 9 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0057] Figure 15 This is a test result image of negative sputum sample No. 1 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0058] Figure 16 This is a test result image of negative sputum sample No. 2 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0059] Figure 17This is a test result image of negative sputum sample No. 3 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0060] Figure 18 This is a graph showing the test results for negative sputum sample No. 4 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0061] Figure 19 This is a graph showing the test results for negative urine sample No. 5 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0062] Figure 20 This is a graph showing the test results for negative sputum sample No. 6 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0063] Figure 21 This is a graph showing the test results for negative sputum sample No. 7 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0064] Figure 22 This is a graph showing the test results for negative sputum sample No. 8 (a carbapenem-sensitive clinical sample), where A and B are tubes A and B, respectively.

[0065] Figure 23 This is a graph showing the test results for sample No. 1 (a clinical sample of a carbapenem-resistant strain), where A and B are tubes A and B, respectively.

[0066] Figure 24 This is a graph showing the test results for sample No. 2 (a clinical sample of a carbapenem-resistant strain), where A and B are tubes A and B, respectively.

[0067] Figure 25 This is a graph showing the test results for sample No. 3 (a clinical sample of a carbapenem-resistant strain), where A and B are tubes A and B, respectively.

[0068] Figure 26 This is a graph showing the test results for sample No. 4 (a clinical sample of a carbapenem-resistant strain), where A and B are tubes A and B, respectively.

[0069] Figure 27 This is a graph showing the test results for sample No. 5 (a clinical sample of a carbapenem-resistant strain), where A and B are tubes A and B, respectively.

[0070] Figure 28 This is a graph showing the test results for sample No. 1 (a clinical sample of a carbapenem-sensitive strain), where A and B are tubes A and B, respectively.

[0071] Figure 29 The image shows the test results for sample No. 2 (a clinical sample of a carbapenem-sensitive strain), where A and B are tubes A and B, respectively.

[0072] Figure 30 This is a graph showing the test results for sample No. 3 (a clinical sample of a carbapenem-sensitive strain), where A and B are tubes A and B, respectively.

[0073] Figure 31 The image shows the test results for sample No. 4 (a clinical sample of a carbapenem-sensitive strain), where A and B are tubes A and B, respectively.

[0074] Figure 32 This is a graph showing the test results for sample No. 5 (a clinical sample of a carbapenem-sensitive strain), where A and B are tubes A and B, respectively. Detailed Implementation

[0075] The following detailed embodiments illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments.

[0076] In the following examples, unless otherwise specified, the experimental methods used are conventional methods; the materials and reagents used are commercially available unless otherwise specified; and the PCR detection solution contains... The IIProbeqPCR SuperMix UDG reagent was purchased from TransGen Biotech, while the primers, probes, and plasmids were synthesized by Sangon Biotech.

[0077] Example 1: Primers and Probes

[0078] To obtain a multiple primer-probe system combination with good specificity and sensitivity, this embodiment designed multiple sets of primers and probes, and conducted multiple experiments in combination. Finally, the primer-probe combination with good specificity and high amplification efficiency was selected as shown in Table 1.

[0079] Table 1: Primer and probe sequences

[0080] SEQ ID NO Primer and probe names Sequence (5′-3′) 1 KPC-F CAACTCCTTCAGCAACAAAT 2 KPC-R ATATCTGACAACAGGCATGAC 3 KPC-P TTATCACTGTATTGCACGGCGGCC 4 OXA23-F TTCTGCAGTCCCAGTCTATCA 5 OXA23-R ACCGAAACCAATACGTTTTACTT 6 OXA23-P CTTGCGCGACGTATCGGTCTTGATC 7 NDM-F GGTTTGGCGATCTGGTTTTC 8 NDM-R ATCCCTGACGATCAAACCG 9 NDM-P AGCTCGCACCGAATGTCTGGCA 10 VIM-F CTCGCGGAGATTGAGAAGC 11 VIM-R TGTCGACGGTGATGCGTAC 12 VIM-P AATTGGACTTCCTGTAACGCGTGCAGTCT 13 IMP-F GACGGTAAGGTTCAAGCCACA 14 IMP-R CCACTACGTTATCTGGAGTGTGT 15 IMP-P ATTCATTTAGCGGAGTTAACTATT 16 Rnasep-F AGATTTGGACCTGCGAGCG 17 Rnasep-R GAGCGGCTGTCTCCACAAGT 18 Rnasep-P TTCTGACCTGAAGGCTCTGCGCG

[0081] The probe contains a fluorescent reporter group at its 5′ end and a fluorescent quencher group at its 3′ end. The fluorescent reporter group can be FAM, VIC, CY5, or ROX; the fluorescent quencher group can be BHQ1, BHQ2, or DBQ1.

[0082] Example 2: Detection Reagents and Kits

[0083] The carbapenem resistance gene detection kit of this embodiment includes:

[0084] (1) PCR detection solution A: IIProbe qPCR SuperMix UDG includes upstream and downstream primers for the target gene, a probe for the target gene, upstream and downstream primers for the internal control gene, and a probe for the internal control gene; the target gene is KPC gene, NDM gene, or OXA-23 gene.

[0085] (2) PCR detection solution B: IIProbe qPCR SuperMix UDG includes upstream and downstream primers for the target gene, a probe for the target gene, upstream and downstream primers for the internal control gene, and a probe for the internal control gene; the target gene is the VIM gene or the IMP gene.

[0086] (3) Negative control: RNase-free water.

[0087] (4) Positive control: Recombinant plasmids containing artificially synthesized sequences of KPC gene, NDM gene, OXA-23 gene, VIM gene, IMP gene and RNase P gene (as shown in SEQ ID NO.19~24 respectively) cloned into pUC57 plasmid.

[0088] in:

[0089] The upstream and downstream primers and probes for the target gene include:

[0090] The upstream and downstream primers shown in SEQ ID NO.1-2 and the probe shown in SEQ ID NO.3 (used for detecting the KPC gene);

[0091] The upstream and downstream primers shown in SEQ ID NO.4-5 and the probe shown in SEQ ID NO.6 (used for detecting the OXA-23 gene);

[0092] The upstream and downstream primers shown in SEQ ID NO.7-8 and the probe shown in SEQ ID NO.9 (used for detecting the NDM gene);

[0093] The upstream and downstream primers shown in SEQ ID NO. 10-11 and the probe shown in SEQ ID NO. 12 (for detecting the VIM gene);

[0094] The upstream and downstream primers shown in SEQ ID NO. 13-14 and the probe shown in SEQ ID NO. 15 (used to detect the IMP gene);

[0095] The nucleotide sequences of the upstream and downstream primers of the internal control gene are shown in SEQ ID NO.16-17, and the nucleotide sequence of the probe of the internal control gene is shown in SEQ ID NO.18.

[0096] The concentrations of the primers for the target KPC gene and OXA-23 gene are both 0.6 μM; the concentrations of the probes for the target KPC gene and OXA-23 gene are both 0.4 μM; the concentrations of the primers for the target NDM gene, VIM gene, and IMP gene are all 0.4 μM; the concentrations of the probes for the target NDM gene, VIM gene, and IMP gene are all 0.2 μM; the concentrations of the primers for the internal control gene are all 0.2 μM; and the concentrations of the probes for the internal control gene are all 0.1 μM.

[0097] Example 3, Detection Method

[0098] This embodiment uses the carbapenem resistance gene detection kit from Example 2 for detection. The specific detection method includes the following steps:

[0099] 1. Sample collection: Applicable sample types include sputum samples, urine samples, nasopharyngeal swab samples, and pure colony samples.

[0100] 2. Nucleic acid extraction: Use commercially available DNA extraction kits, such as those based on silica gel membrane centrifuge columns or magnetic beads, and follow the kit instructions. Collect 60 μL of DNA solution for direct detection or store at -80℃ for later use. Positive control samples must be extracted.

[0101] 3. PCR reaction solution preparation: Take out the kit, thaw it at room temperature, and vortex to mix. Centrifuge at low speed for 10 seconds. Calculate the number of PCR test solutions N to be prepared (N = number of samples + 2 control tubes). Aliquot the PCR test solution into N PCR reaction tubes at a rate of 20 μL / tube.

[0102] 4. Adding samples: Add negative control, sample DNA solution, and positive control to the PCR reaction tubes that have been aliquoted with reagents. The amount of each sample added is 5 μL / tube. Tightly cap the tubes, mix well, centrifuge and collect the solution at the bottom of the tube.

[0103] 5. PCR amplification and detection: The PCR amplification program is set as shown in Table 2, and the detection time is about 50 minutes.

[0104] Table 2: PCR Procedure

[0105]

[0106] 6. Results Analysis: Under the premise of effective amplification, the criteria for determining the positive Ct of each target gene are shown in Table 3.

[0107] Table 3: Criteria for Determining Target Gene Positive Ct Results

[0108]

[0109] Example 4: Accuracy and Sensitivity Testing

[0110] This embodiment uses the carbapenem resistance gene detection kit from Example 2, and quantitatively detects the accuracy and sensitivity of plasmids containing KPC, NDM, OXA-23, VIM, and IMP genes according to the detection method in Example 3. The specific methods are as follows.

[0111] Plasmids containing the KPC, OXA-23, NDM, VIM, and IMP genes were quantified using DEPC-free water, with a quantification value of 10. 13 Copies / mL, and serially diluted to obtain 10 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 10 2 copies / mL, 10 1 Different concentration gradient dilutions per copy / mL.

[0112] Test results as follows Figures 1-5 As shown.

[0113] Depend on Figure 1 The results show that the lowest detectable concentration in the reaction system is 10. 1 At a concentration of 1 copy / mL of KPC recombinant plasmid template, the amplification results all showed obvious S-shaped amplification curves; however, various concentrations of NDM, OXA-23, IMP, and VIM gene recombinant plasmids could not be detected.

[0114] Depend on Figure 2 The results show that the lowest detectable concentration in the reaction system is 10. 1 At a concentration of OXA-23 recombinant plasmid template of 1 copy / mL, the amplification results all showed obvious S-shaped amplification curves; however, various concentrations of KPC, NDM, IMP, and VIM gene recombinant plasmids could not be detected.

[0115] Depend on Figure 3 The results show that the lowest detectable concentration in the reaction system is 10. 1 At a concentration of 1 copy / mL of NDM recombinant plasmid template, the amplification results all showed obvious S-shaped amplification curves; however, various concentrations of KPC, OXA-23, IMP, and VIM gene recombinant plasmids could not be detected.

[0116] Depend on Figure 4 The results show that the lowest detectable concentration in the reaction system is 10. 1At a concentration of VIM recombinant plasmid template of 1 copy / mL, the amplification results all showed obvious S-shaped amplification curves; however, various concentrations of KPC, OXA-23, NDM and IMP recombinant plasmids could not be detected.

[0117] Depend on Figure 5 The results show that the lowest detectable concentration in the reaction system is 10. 1 At IMP recombinant plasmid templates of copies / mL, the amplification results all showed obvious S-shaped amplification curves; however, various concentrations of KPC, OXA-23, NDM and VIM recombinant plasmids could not be detected.

[0118] The above results demonstrate that the kit has high amplification sensitivity and specificity.

[0119] Example 5: Clinical Sample Testing

[0120] This embodiment uses the carbapenem resistance gene detection kit from Example 2 and, according to the detection method from Example 3, tests were performed on 27 clinical samples, including sputum, urine, nasal swabs (9 positive, 8 negative) (17 samples) and bacterial strains (5 positive, 5 negative) (10 samples). Each sample was tested in triplicate. A conventional method was also used as a control.

[0121] Table 4 compares the detection results of the above samples using traditional methods with those obtained using this kit. Table 5 shows the source and information of the bacterial strains. The amplification curves detected by this kit are shown in Table 5. Figures 6-32 ,in: Figures 6-14 Nine cases tested positive in sputum, urine, and nasal swabs. Figures 15-22 Seven cases tested negative for sputum, urine, and nasal swabs. Figures 23-27 Five cases tested positive for the corresponding bacterial strain. Figures 28-32 Five cases tested negative for the corresponding strain.

[0122] Table 4: Comparison of Detection Results

[0123]

[0124]

[0125] This kit does not require specific results from the internal standard for the type of bacterial strain tested.

[0126] Table 5: Sources and Information of Strains Samples

[0127]

[0128]

[0129] Depend on Figures 6-32As shown in Tables 4 and 5, the detection kit of this invention can be directly applied to the detection of sputum, urine, nasal swabs, and clinical samples of various bacterial strains. The detection results are consistent with those of traditional methods, indicating that the detection kit of this invention has high accuracy. Furthermore, the detection kit of this invention can detect carbapenem resistance genes in common carbapenem-resistant strains, such as Klebsiella pneumoniae, Acinetobacter baumannii, Serratia marcescens, Pseudomonas aeruginosa, and Enterobacter cloacae, while traditional detection methods cannot identify specific resistance genes. The detection kit of this invention exhibits high specificity and no cross-reactivity against common pathogens such as Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, Enterococcus faecalis, and Staphylococcus aureus.

[0130] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the present invention. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A carbapenem resistance gene detection reagent, characterized in that, The detection reagent includes a PCR detection solution, which includes the upstream and downstream primer sequences and probe sequences of the target gene: The target genes are KPC, NDM, OXA-23, VIM, and IMP, among which: The upstream and downstream primer sequences of the KPC gene are shown in SEQ ID NO.1 and 2, and the probe sequence is shown in SEQ ID NO.3; The upstream and downstream primer sequences of the OXA-23 gene are shown in SEQ ID NO.4 and 5, and the probe sequence is shown in SEQ ID NO.6; The upstream and downstream primer sequences of the NDM gene are shown in SEQ ID NO.7 and 8, and the probe sequence is shown in SEQ ID NO.9; The upstream and downstream primer sequences of the VIM gene are shown in SEQ ID NO. 10 and 11, and the probe sequence is shown in SEQ ID NO. 12; The upstream and downstream primer sequences of the IMP gene are shown in SEQ ID NO. 13 and 14, and the probe sequence is shown in SEQ ID NO.

15.

2. The carbapenem resistance gene detection reagent according to claim 1, characterized in that, The PCR detection solution also includes upstream and downstream primers and probes for the internal standard gene. IIProbe qPCR SuperMix UDG, where: The nucleotide sequences of the upstream and downstream primers of the internal control gene are shown in SEQ ID NO.16 and 17, and the nucleotide sequence of the probe of the internal control gene is shown in SEQ ID NO.

18.

3. The carbapenem resistance gene detection reagent according to claim 1 or 2, characterized in that, The probe has a fluorescent reporter group at its 5′ end and a fluorescent quencher group at its 3′ end.

4. The carbapenem resistance gene detection reagent according to claim 3, characterized in that: The fluorescent reporter group is selected from: FAM, VIC, CY5 and ROX; The fluorescence quenching group is selected from BHQ1, BHQ2 and DBQ1.

5. The carbapenem resistance gene detection reagent according to claim 1, characterized in that, The negative control is RNase-free water; the positive control includes artificially synthesized sequences of the KPC gene, NDM gene, OXA-23 gene, VIM gene, IMP gene and RNaseP gene, which are cloned into the pUC57 plasmid recombinant plasmid.

6. The carbapenem resistance gene detection reagent according to claim 5, characterized in that, The artificially synthesized sequences of the KPC gene, NDM gene, OXA-23 gene, VIM gene, IMP gene and Rnasep gene are shown in SEQ ID NO.19-24, respectively.

7. A carbapenem resistance gene detection kit, characterized in that, The detection reagent includes any one of claims 1 to 6.

8. The carbapenem resistance gene detection kit according to claim 7, characterized in that: The concentrations of the upstream and downstream primers for the target KPC gene and OXA-23 gene were both 0.6 μM; the concentrations of the probes for the target KPC gene and OXA-23 gene were both 0.4 μM. The concentrations of the upstream and downstream primers for the target NDM gene, VIM gene, and IMP gene were all 0.4 μM; the concentrations of the probes for the target NDM gene, VIM gene, and IMP gene were all 0.2 μM. The concentration of the internal control gene primers was 0.2 μM; the concentration of the internal control gene probes was 0.1 μM.

9. A primer and probe composition for detecting carbapenem resistance genes, characterized in that... include: The upstream and downstream primer sequences shown in SEQ ID NO.1 and 2, and the probe sequence shown in SEQ ID NO.3, are used to detect the KPC gene; The upstream and downstream primer sequences shown in SEQ ID NO. 4 and 5, and the probe sequence shown in SEQ ID NO. 6, are used to detect the OXA-23 gene. The upstream and downstream primer sequences, as shown in SEQ ID NO.7 and 8, and the probe sequence, as shown in SEQ ID NO.9, are used to detect the NDM gene; The upstream and downstream primer sequences shown in SEQ ID NO. 10 and 11, and the probe sequence shown in SEQ ID NO. 12, are used to detect the VIM gene; The upstream and downstream primer sequences for detecting the IMP gene are shown in SEQ ID NO. 13 and 14, and the probe sequence is shown in SEQ ID NO.

15.

10. A method for detecting carbapenem resistance genes, characterized in that... Includes the following steps: S1: Sample collection; S2: Nucleic acid extraction; S3: Add the extracted nucleic acid sample to the reagent or kit according to any one of claims 1 to 7; S4: PCR amplification detection; S5: Read and interpret the Ct values ​​of each gene.

11. The detection method according to claim 10, characterized in that, The sample for S1 is sputum, urine, nasopharyngeal swab, or bacterial strain sample.

12. The detection method according to claim 10, characterized in that, The steps for PCR amplification and detection are as follows: In step 2, fluorescence detection is performed at 55℃. Detection channels: FAM, VIC, CY5, ROX.

13. The reagent or kit according to any one of claims 1 to 8 is used for the detection of carbapenem resistance genes.

Images