Non-saccharomyces cerevisiae and application thereof

Abstract

The application provides a non-Saccharomyces cerevisiae strain and application thereof, the strain SIVE8901 has been preserved in China Center for Type Culture Collection (CCTCC) on May 31, 2023; address: Wuhan, China, Wuhan University, the preservation number is CCTCC NO:M 2023882, and the Latin name is Starmerella bacillaris The strain SIVE8901 is Candida zeylane, the strain SIVE8901 has good flavone tolerance, after non-Saccharomyces cerevisiae and Saccharomyces cerevisiae mixed fermentation, characteristic aroma components such as ethyl decanoate and ethyl palmitate are produced, coconut aroma and butter aroma are given to fruit wine, and it is of great significance to improve the flavor of fruit wine and improve the quality of fruit wine.

Description

Technical Field

[0001] This invention relates to the field of bio-brewing technology, specifically to a non-brewing yeast strain and its applications. Background Technology

[0002] Fruit wine fermentation is a complex and multi-layered biochemical reaction process involving the metabolic activities of various microorganisms, and the products change with the microbial growth environment. Fruit wine fermentation mainly involves two categories of yeasts: brewer's yeast and non-brewing yeast. Brewing yeast primarily produces alcohol during fruit wine fermentation, while non-brewing yeast can produce esters, aldehydes, alcohols, and other substances, contributing to the aroma of the fruit wine.

[0003] Fruit wines develop more aroma components after fermentation with non-brewing yeasts; while fermentation with brewing yeasts not only preserves the trace elements and bioactive substances of fresh fruit but also produces a large number of metabolites, making the resulting fruit wine rich in microorganisms and amino acids, which are easily absorbed and utilized. In other words, mixed fermentation with brewing yeasts and non-brewing yeasts not only produces alcohol but also aroma compounds such as alcohols, esters, and terpenes, thereby enhancing the taste and flavor of the fruit wine. Therefore, in recent years, the application of mixed fermentation with brewing yeasts and non-brewing yeasts in fruit wine fermentation has increased and attracted much attention.

[0004] Citrus fruits, as one of the world's most important fruits, have high nutritional value and health benefits. With the increasing health awareness of people, these fruits are becoming increasingly popular. Navel oranges are known as the "King of Citrus Fruits," and the current market consumption is mainly for fresh consumption and juicing. However, with the increasing planting area and output of navel oranges year by year, they are currently facing problems such as overproduction and difficulty in storage. Fruit wine made from navel oranges has a mellow and refreshing taste and is rich in various vitamins, citric acid, flavonoids and other nutrients. It has the characteristics of cleansing the intestines and improving immunity. Therefore, processing fresh navel oranges into easily stored fruit wine has become another way for the development of navel oranges.

[0005] During fermentation, non-saccharifying yeasts mainly participate in the initial stage. However, navel oranges are characterized by high acidity and high flavonoid content. Flavonoids have antibacterial and antioxidant effects, which hinders the metabolic activity of non-saccharifying yeasts, making it difficult or time-consuming to initiate fermentation. When non-saccharifying yeasts cannot compete effectively in the early stages of fermentation, saccharifying yeasts will start prematurely. Furthermore, as the alcohol content in the fermentation broth gradually increases, non-saccharifying yeasts undergo autolysis and die off, preventing them from contributing to the aroma of the navel orange wine. Consequently, the resulting navel orange wine has an unbalanced aroma and a thin taste. Therefore, providing a non-saccharifying yeast that is highly tolerant to flavonoids and can contribute to the aroma of navel orange wine is of great significance for the utilization of navel oranges. Summary of the Invention

[0006] In view of this, the present invention provides a non-Saccharomyces cerevisiae strain and its application. This non-Saccharomyces cerevisiae strain, with accession number SIVE8901, was deposited on May 31, 2023, at the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China; accession number: CCTCC NO: M 2023882, Latin name... Starmerella bacillaris The strain SIVE8901 is *Candida zeptospira*. This strain exhibits good flavonoid tolerance, preferentially propagating and fermenting in navel orange juice with a flavonoid content of 5.0 mg / mL. It increases the levels of isoamyl hexanoate, methyl octanoate, methyl decanoate, and propyl decanoate in the resulting navel orange wine, contributing to its aroma. Furthermore, mixed fermentation with *S. zeptospira* increases the content of ethyl decanoate in the navel orange wine, making its typical aroma more prominent. Simultaneously, mixed fermentation also adds ethyl palmitate and 1-decene to the navel orange wine, imparting coconut and creamy aromas, which is significant for improving the flavor and quality of the wine.

[0007] The technical solution of the present invention is as follows: A non-Saccharomyces cerevisiae strain, designated SIVE8901, was deposited on May 31, 2023, at the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China; accession number: CCTCC NO: M 2023882; Latin name: Starmerella bacillaris The strain SIVE8901 is Candida zeplinii; this strain SIVE8901 has good flavonoid tolerance.

[0008] Preferably, the strain SIVE8901 has a tolerance to flavonoids of <5.5 mg / mL; within a flavonoid content range of 2.0-5.0 mg / mL, the strain SIVE8901 can be successfully started, propagated, and fermented.

[0009] Preferably, the strain SIVE8901 was screened from naturally fermented mash of Fengjie navel oranges; the nucleotide sequence of its 26S rDNA D1 / D2 region is shown in SEQ ID NO: 1.

[0010] SEQ ID NO: 1 AAGCTGTACATTAGTAGACTGAGATCCTCGCGCTCGGGTGGGAATATGAACTGCATCTATAATACTCCGAGGAGCTACATTCTACAGCATTTATCTTCCCCCCAAACACGGCTCTACATGGTTAGCGGCCTACCCTTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCCTCACAGTACTTGTTTACTATCGGTCTCTCGCAGATATTTAGCTTTA GATGGAGCATACCACCCATTTGAGCTGCATTCCCAAACAACTCGACTCCATGTTAAGATCCTATATGAGGTCAATGCTAGACGGGGCTATCACCCTCCATGGCGCTCCTTTCCAGAAGACTTAAGCATCGTTTCTCAGGACCCTAACTTCAGAATACAACGGCACAAAAGTGCCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCG.

[0011] Preferably, the SIVE8901 strain exhibits glucose tolerance between 100-500 g / L, fructose tolerance between 100-500 g / L, osmotic pressure tolerance (based on KCl concentration) between 0.8-1.2 mol / L, pH tolerance between 3.0-5.0, ethanol tolerance between 6-14% (v / v), SO2 tolerance between 100-500 mg / L, and temperature tolerance between 12-38°C. These properties make the SIVE8901 strain suitable for fruit wine fermentation.

[0012] Applying the above-mentioned strain SIVE8901 can improve the aroma of fruit wine.

[0013] Preferably, the above-mentioned strain SIVE8901 is used in the fermentation of navel orange wine. The resulting navel orange wine contains isoamyl hexanoate, methyl octanoate, methyl decanoate, and propyl decanoate, which makes the aroma of the navel orange wine more balanced and contributes to the aroma of the wine.

[0014] Preferably, SIVE8901 strain and Saccharomyces cerevisiae are mixed-culture fermented; the Saccharomyces cerevisiae is BV818; the mixed-culture fermentation of SIVE8901 and BV818 can effectively increase the content of ethyl decanoate in navel orange wine, giving the wine a coconut and cream aroma; the resulting navel orange wine contains added 1-decene and ethyl palmitate, which impart a creamy aroma to the wine, making the aroma of the navel orange wine fuller.

[0015] Preferably, in the above application, BV818 is added 48 hours after the addition of strain SIVE8901; it is added at a 1:1 mass ratio and fermented at 20°C for 10-20 days until the soluble solids content remains stable.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention provides a non-Saccharomyces cerevisiae strain, strain number SIVE8901, which was deposited on May 31, 2023, at the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province; postcode: 430072, accession number: CCTCC NO: M 2023882, Latin name... Starmerella bacillaris This strain was screened from naturally fermented mash of navel oranges and can preferentially ferment in navel orange juice with high flavonoid content.

[0017] 2. When the non-brewing yeast SIVE8901 provided by this invention is applied to fruit wine fermentation, it can produce high levels of glycerol, thereby improving the smoothness of the fruit wine. The navel orange fruit wine obtained by mixed fermentation of this yeast has a rich aroma and high quality. Ester compounds account for 84.29% of the total compounds, which can increase the content of ethyl decanoate in the fruit wine and give it a coconut aroma. This is of great significance for improving the taste and flavor of the fruit wine. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Cell morphology of strain SIVE8901 under an electron microscope.

[0020] Figure 2 The images show the colony morphology of strain SIVE8901 on different immobilized culture media; the left image shows the colony morphology of strain SIVE8901 on YPD solid medium, and the right image shows the colony morphology of strain SIVE8901 on WL solid medium.

[0021] Figure 3 This is a GC-MS ion image of strain SIVE8901. Detailed Implementation

[0022] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0023] Example 1: Isolation and Identification of Non-Saccharomyces cerevisiae SIVE8901 Strain 1. Strains Isolation (1) Crush the Fengjie navel oranges and weigh 200g into a 500mL Erlenmeyer flask. Seal the flask with a breathable sealing film and place it in a 28℃ biochemical incubator for 3 days to enrich the fermentation liquid. After bubbles are generated, take out the fermentation liquid and dilute it with sterile water to 10. -4 The diluted solution was obtained. (2) Take 100 μL of the above diluted solution and spread it evenly on WL solid medium. After incubating at 28℃ for 48 h, observe the colony characteristics. Select single colonies with different performance characteristics and perform 2-3 streak purifications to obtain single colonies. Inoculate them into YPD solid medium for culture. At the same time, pick single clones and observe cell morphology under a microscope. A total of 38 strains were isolated from Fengjie navel oranges.

[0024] 2. Identification Genomic DNA was extracted from the pure strain using a kit. The D1 / D2 region of 26S rDNA was amplified using primers NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3'). PCR amplification was performed in a 50 μL reaction system. The reaction system consisted of: 25 μL Master mix (2X), 1 μL NL1, 1 μL NL4, 4 μL Templap, and 19 μL ddH2O. Amplification conditions were as follows: 95℃ pre-denaturation for 5 min, followed by 95℃ denaturation for 15 s, 53℃ annealing for 20 s, and 72℃ extension for 1 min, for a total of 28 cycles. Finally, a full extension at 72℃ for 5 min was performed, and the sample was stored at 4℃. The PCR products were detected by agarose gel electrophoresis: 2 μL of PCR product was loaded onto the gel, and 3 μL of marker was loaded onto the gel. The gels were then separated in a 1.0% agarose gel electrophoresis at 120V for 20 min and analyzed using a gel imaging system. PCR products containing the target fragment were sent to a testing company for sequencing, and the results were compared using BLAST homology sequence search on NCBI. Homology sequence search revealed 15 non-Saccharomyces cerevisiae strains. These 15 strains were then subjected to a Durham tube gas production experiment and sensory evaluation, resulting in three non-Saccharomyces cerevisiae strains with distinctive aromas, designated SIVE8901, SIVE8902, and SIVE8903. These three strains were transferred to YPD agar slants and stored at 4°C for future use. The nucleotide sequence of the 26S rDNA D1 / D2 region of strain SIVE8901 is shown in SEQ ID NO: 1, as follows: SEQ ID NO: 1 AAGCTGTACATTAGTAGACTGAGATCCTCGCGCTCGGGTGGGAATATGAACTGCATCTATAATACTCCGAGGAGCTACATTCTACAGCATTTATCTTCCCCCCAAACACGGCTCTACATGGTTAGCGGCCTACCCTTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCCTCACAGTACTTGTTTACTATCGGTCTCTCGCAGATATTTAGCTTTA GATGGAGCATACCACCCATTTGAGCTGCATTCCCAAACAACTCGACTCCATGTTAAGATCCTATATGAGGTCAATGCTAGACGGGGCTATCACCCTCCATGGCGCTCCTTTCCAGAAGACTTAAGCATCGTTTCTCAGGACCCTAACTTCAGAATACAACGGCACAAAAGTGCCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCG; Primer NL1, as shown in SEQ ID NO: 2; SEQ ID NO: 2 5'-GCATATCAATAAGCGGAGGAAAAG-3'; Primer NL4, as shown in SEQ ID NO: 3; SEQ ID NO: 3 5'-GGTCCGTGTTTCAAGACGG-3'.

[0025] Strain SIVE8901 was inoculated onto YPD solid medium plates and WL nutrient agar plates using the streak method. Results are shown in the figure. Figure 2 ; Figure 2 The left image shows the colony morphology on YPD solid medium plates. Figure 2 The right image shows the colony morphology on WL nutrient agar plates.

[0026] Example 2 Tolerance Test Tolerance tests were conducted on the three bacterial strains preserved in Example 1, numbered SIVE8901, SIVE8902, and SIVE8903, as follows: (1) Flavonoid tolerance test Tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. The method was as follows: orange peel was ground into powder using liquid nitrogen. The three yeast strains were inoculated into YPD liquid culture media containing different concentrations of flavonoids in test tubes. The flavonoid concentrations were 2.0 mg / mL, 3.0 mg / mL, 4.0 mg / mL, 5.0 mg / mL, and 5.5 mg / mL, respectively. The inoculation volume was 1 μL (one loop was scraped off). The YPD liquid culture medium was 10 mL. The cultures were incubated at a constant temperature for 7 days. The growth status was observed. The results are shown in Table 1. Table 1 Results of flavonoid tolerance test

[0027] As shown in Table 1, among the three non-Saccharomyces cerevisiae strains screened in Example 1, strain SIVE8901 exhibited the highest tolerance to flavonoids. To observe whether non-Saccharomyces cerevisiae could be suitable for navel orange wine fermentation, experiments were conducted on glucose tolerance, fructose tolerance, osmotic pressure tolerance, ethanol tolerance, SO2 tolerance, temperature tolerance, and pH tolerance. (2) Glucose tolerance Glucose tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different glucose concentrations in test tubes (100 g / L, 200 g / L, 300 g / L, 400 g / L, and 500 g / L). The inoculation volume was 1 μL (one loopful was scraped from the inoculation loop). The YPD liquid culture medium was 10 mL. The cultures were incubated at 28 °C for 7 days, and their growth was observed. The results are shown in Table 2. Table 2. Glucose tolerance results

[0028] (3) Fructose tolerance Fructose tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different fructose concentrations (100 g / L, 200 g / L, 300 g / L, 400 g / L, and 500 g / L) in test tubes. The inoculation volume was 1 μL (one loopful was scraped from the inoculation loop). The YPD liquid culture medium was 10 mL. The cultures were incubated at 28 °C for 7 days, and their growth was observed. The results are shown in Table 3. Table 3. Results of fructose tolerance

[0029] (3) Osmotic pressure tolerance Osmotic tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different osmotic concentrations (calculated as KCl) in test tubes. The KCl concentrations were 0.8 mol / L, 1.0 mol / L, 1.2 mol / L, and 1.6 mol / L. The inoculation volume was 1 μL (one loop was scraped off). The YPD liquid culture medium was 10 mL. The cultures were incubated at 28℃ for 7 days. The growth status was observed, and the results are shown in Table 4. Table 4. Results of osmotic pressure tolerance

[0030] (5) Ethanol tolerance Ethanol tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different ethanol concentrations in test tubes: 6% (v / v), 8% (v / v), 10% (v / v), 12% (v / v), 14% (v / v), and 16% (v / v). The inoculation volume was 1 μL (one loopful was scraped from the inoculation loop), and the YPD liquid culture medium was 10 mL. The cultures were incubated at 28℃ for 7 days, and their growth was observed. The results are shown in Table 5. Table 5 Ethanol Tolerance Results

[0031] (6) SO2 tolerance SO2 tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different SO2 concentrations in test tubes (100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, and 500 mg / L). The inoculation volume was 1 μL (1 loop was scraped from the inoculation loop), and the YPD liquid culture medium was 10 mL. The cultures were incubated at 28℃ for 7 days, and their growth was observed. The results are shown in Table 6. Table 6 SO2 tolerance results

[0032] (7) Temperature tolerance Temperature tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture medium in test tubes and cultured statically at different temperatures: 10℃, 12℃, 14℃, 38℃, and 40℃. The inoculation volume was 1 μL (one loopful was scraped from the inoculation loop), and the YPD liquid culture medium was 10 mL. The culture was carried out at 28℃ for 7 days, and the growth status was observed. The results are shown in Table 7. Table 7 Temperature tolerance results

[0033] (8) pH tolerance pH tolerance experiments were conducted on strains SIVE8901, SIVE8902, and SIVE8903. They were inoculated into YPD liquid culture media with different pH concentrations in test tubes (pH 2.0, 3.0, 4.0, and 5.0, respectively), with an inoculation volume of 1 μL (1 loopful scraped from the inoculation loop). The YPD liquid culture medium was 10 mL, and the cultures were incubated at 28 °C for 7 days. The growth status was observed, and the results are shown in Table 8. Table 8 pH tolerance results

[0034] Based on Tables 1-8, it can be concluded that the flavonoid tolerance of strain SIVE8901 screened in this invention is between 2.0-5.5 mg / mL, with the optimal tolerance occurring between 2.0-5.0 mg / mL. SIVE8901 exhibits glucose tolerance between 100-500 g / L, fructose tolerance between 100-500 g / L, osmotic pressure tolerance (based on KCl concentration) between 0.8-1.2 mol / L, pH tolerance between 3.0-5.0, ethanol tolerance between 6-14% (v / v), SO2 tolerance between 100-500 mg / L, and temperature tolerance between 12-38℃.

[0035] Compared with strains SIVE8902 and SIVE8903, strain SIVE8901 exhibited the best performance, indicating that it is well-adapted to the fermentation environment of navel orange wine. Strain SIVE8901 was deposited at the China Center for Type Culture Collection (CCTCC) on May 31, 2023. Address: Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China; Postcode: 430072; Accession number: CCTCC NO: M 2023882; Latin name: Starmerella bacillaris .

[0036] Example 3: Application of strain SIVE8901 in navel orange wine The application process is as follows: (1) Navel oranges were sorted, washed, peeled and pressed into juice. The juice was centrifuged at 20℃ and 8000r / min for 5min. The supernatant was filtered through a 0.45μm sterile filter membrane to remove bacteria. The physicochemical properties of the juice were tested: total acid 10.50g / L, sugar 14Brix, pH 3.5, and flavonoid content 4.36mg / mL. (2) Adjust the sugar content of the juice to 20 Brix to obtain fermentation raw material. Divide the fermentation raw material into 1000ml blue cap bottles, with each bottle containing 600mL of fermentation raw material for later use. (3) The strain SIVE8901 preserved in Example 1 was activated overnight in YPD liquid medium and then inoculated twice. It was centrifuged at 20℃ and 6000r / min for 5min and the fresh strain was collected for later use. (4) Experimental setup: Experiment 1: 0.5g of fresh strain SIVE8901 preserved in Example 1 was added to the packaged fermentation raw materials to prepare 3 replicates; Experiment 2: 0.5g of Angel Wine Active Dry Yeast BV818 (hereinafter referred to as BV818) was added to the packaged fermentation raw materials to prepare 3 replicates; Experiment 3: The strain SIVE8901 preserved in Example 1 was added at a rate of 0.25g of fresh strain to the packaged fermentation raw material for fermentation, and three replicates were prepared. After fermentation for 48 hours, BV818 was added at a rate of 0.25g to each of the replicates for fermentation. Experiment 4: 0.5g of French LALVIN active dry yeast CY3079 was added to the packaged fermentation raw materials to prepare 3 replicates; Experiment 5: The strain SIVE8901 preserved in Example 1 was added at a rate of 0.25g of fresh strain to the packaged fermentation raw material for fermentation, and three replicates were prepared. After 48 hours of fermentation, 0.25g of French LALVIN active dry yeast CY3079 was added to the raw material for fermentation. (5) After setting the experimental parameters, the fermentation temperature was controlled at 19±0.5℃. The start of fermentation was determined by observing the time it took for bubbles to form, and the end of alcoholic fermentation was determined when the soluble solids content remained stable. The physicochemical properties of the navel orange wine were determined, including ethanol, total acid, and residual sugar, according to GB / T 15038—2006 "General Analytical Methods for Wine and Fruit Wine". The glycerol content after fermentation was determined by high performance liquid chromatography. The results are shown in Table 9 below: Table 9. Physicochemical properties of the prepared navel orange wine

[0037] As can be seen from Table 9, in the experiments with added strain SIVE8901, fermentation started on the first day, such as in Experiments 1, 3 and 5. This indicates that the strain SIVE8901 provided by this invention has good adaptability and can rapidly proliferate and metabolize in navel orange juice. In other words, compared with brewer's yeast, the strain SIVE8901 provided by this invention can preferentially ferment in navel orange juice with high flavonoid content. The fermentation results from Experiment 1 show that single-strain fermentation of SIVE8901 can produce high levels of glycerol, up to 8.04 g / L, resulting in a smoother taste and playing a positive role in the quality of fruit wine.

[0038] Example 4: Effect of strain SIVE8901 on the aroma of navel orange wine The aroma compounds of the navel orange wines obtained after fermentation in Experiments 1, 2 and 3 of Example 3 were detected, and the results are shown in Table 10. Table 10 CG-MS Detection Results

[0039] As shown in Table 10, compared with Experiment 2 (BV818 pure culture fermentation), the navel orange wine obtained by Experiment 1 (SIVE8901 pure culture fermentation) had increased esters including isoamyl hexanoate, methyl octanoate, methyl decanoate, and propyl decanoate. Similarly, Experiment 3 (mixed culture fermentation) also had increased esters including isoamyl hexanoate, methyl octanoate, methyl decanoate, and propyl decanoate. It can be seen that, compared with Experiment 2, non-sacchariculture yeast increased the aroma components in the navel orange wine after mixed culture fermentation, making the aroma of the navel orange wine more balanced. Compared to the combination of Experiment 1 and Experiment 2, the navel orange wine obtained in Experiment 3 had the addition of ethyl palmitate and 1-decene. The addition of ethyl palmitate gave the wine a light creamy aroma, indicating that mixed fermentation can enrich the aroma components of navel orange wine. Compared to the combination of Experiment 1 and Experiment 2, the amount of ethyl decanoate in the navel orange wine obtained in Experiment 3 was significantly increased. Ethyl decanoate has a pleasant coconut aroma. After being enriched in the navel orange wine obtained in Experiment 3, the characteristic aroma of the navel orange wine became more prominent. Compared to the combination of Experiment 1 and Experiment 2, the acid content in the navel orange wine obtained in Experiment 3 was significantly reduced, making the wine taste more rounded and mellow. In particular, hexanoic acid was detected only in Experiment 3, which made the wine taste more refreshing.

[0040] It is evident that the fermentation process in Experiment 3 enriched the aroma components of the navel orange wine. The various aroma substances coordinated and promoted each other, making the aroma fuller and more three-dimensional, thus improving the quality of the navel orange wine.

[0041] Example 5: Sensory evaluation of fermented navel orange wine The navel orange wines obtained from Experiments 1, 2, and 3 in Example 3 were subjected to sensory evaluation by a panel of 10 professionally trained members. The average score was taken as the final score, with a maximum score of 100. The sensory evaluation criteria are shown in Table 11, and the evaluation results are shown in Table 12, as follows: Table 11 Sensory Evaluation Criteria for Navel Orange Wine

[0042] Table 12 Sensory Evaluation of Navel Orange Wine

[0043] Example 6: Effects of strain SIVE8901 on the aroma of Petit Mansée wines The application process is as follows: (1) Press the small Mansen grapes with skin into juice, centrifuge at 20℃ and 8000r / min for 5min, and take the supernatant and filter it with a 0.45μm sterile filter membrane to remove bacteria; (2) Adjust the sugar content of the juice to 20 Brix to obtain fermentation raw material. Divide the fermentation raw material into 1000ml blue cap bottles, with 600ml of fermentation raw material in each bottle for later use. (3) The strain SIVE8901 preserved in Example 1 was activated overnight in YPD liquid medium and then inoculated twice. It was centrifuged at 4°C and 6000r / min for 5 min and the fresh strain was collected for later use. (4) Experimental setup: Experiment 6: The strain SIVE8901 preserved in Example 1 was added at a rate of 0.5g of fresh strain to the packaged fermentation raw materials to prepare 3 replicates; Experiment 7: Add 0.5g of Angel Wine Active Dry Yeast BV818 to the packaged fermentation raw materials to prepare 3 replicates; Experiment 8: The strain SIVE8901 obtained in Example 2 was added to the packaged fermentation raw material at a rate of 0.25g of fresh strain and fermented to prepare 3 replicates; after 48h of fermentation, Angel wine active dry yeast BV818 was added at a rate of 0.25g and fermented. (5) After setting up the experiment, the fermentation temperature was controlled at 19±0.5℃. Fermentation was considered to be complete when the soluble solids content remained stable. The aroma compounds of the navel orange wine were then tested, and the results are shown in Table 13 below: Table 13 CG-MS Detection Results

[0044] As shown in Table 13, Experiment 6 (pure culture fermentation of strain SIVE8901) increased the content of phenylethanol and ethyl palmitate in Petit Mansson wine, bringing pleasant rose, fruit and coconut aromas to the wine. In Experiment 8 (mixed fermentation of strains SIVE8901 and BV818), the ester content was rich, with a significant increase in the content of isooctanol and ethyl decanoate, which added citrus and fruity flavors to the wine. Furthermore, after mixed fermentation, ethyl palmitate was added to Petit Mansson wine, which increased the aroma components in the product and enriched the aroma composition of the product.

[0045] As can be seen from Examples 4 and 6, when using the strain SIVE8901 provided by the present invention, ethyl palmitate was added to the fruit wine during the mixed fermentation process, giving the fruit wine a pleasant coconut aroma. In addition, after mixed fermentation, the aroma components were richer than those after single-strain fermentation, thus improving the quality of the fruit wine product.

[0046] The experimental methods involved in the above experiments are as follows: Ethanol, total acid, total sugar and other indicators were determined according to GB / T 15038—2006 "General Analytical Methods for Wine and Fruit Wine"; aroma compounds were detected using an Aglient GC 7890B / MS 5977A gas chromatography-mass spectrometry system.

[0047] Although the present invention has been described in detail with reference to preferred embodiments, it is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the claims.

Claims

1. A non-Saccharomyces cerevisiae strain Starmerella bacillaris Its characteristics are, The non-Saccharomyces cerevisiae strain is designated SIVE8901. This strain SIVE8901 was deposited at the China Center for Type Culture Collection on May 31, 2023, with accession number CCTCC NO: M 2023882. This strain SIVE8901 exhibits good flavonoid tolerance.

2. The non-Saccharomyces cerevisiae according to claim 1 Starmerella bacillaris Its application in fruit wine fermentation is characterized by... This strain, SIVE8901, can add aroma to fruit wine.

3. The application according to claim 2, characterized in that, The fruit wine is navel orange wine, and the obtained navel orange wine contains isoamyl hexanoate, methyl octanoate, methyl decanoate, and propyl decanoate.

4. The application according to claim 3, characterized in that, Fermenting with strain SIVE8901 for 48 hours, followed by fermentation with Angel wine active dry yeast BV818, can increase the content of ethyl decanoate in navel orange wine. The resulting navel orange wine contains 1-decene and ethyl palmitate.

Images