An IGF-1R-targeting nucleic acid aptamer and its application

Abstract

The present invention belongs to the fields of molecular biology and clinical medicine, and relates to a nucleic acid aptamer targeting IGF-1R and its application. The nucleic acid aptamer targeting IGF-1R includes any one of the nucleotides shown in SEQ ID NO.1 to SEQ ID NO.3; or any derivative of a nucleic acid aptamer with the same function obtained by chemical modification, chemical labeling or base change on the basis of SEQ ID NO.1 to SEQ ID NO.3. The nucleic acid aptamer of the present invention can be synthesized in large quantities in vitro, is cheap, has good stability, high affinity, is convenient for storage, and is easy to edit; at the same time, due to its small molecular weight, it is not easy to cause immune reactions, and the chemical stability of single-stranded DNA is good, and denaturation and renaturation are reversible, making it easy to store for a long time and transport at room temperature.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and clinical medicine, and relates to a nucleic acid aptamer sequence targeting IGF-1R and its application in the preparation of drugs or preparations for diagnosing and treating thyroid-associated ophthalmopathy. Background Art

[0002] Thyroid-associated ophthalmopathy (TAO) is an organ-specific autoimmune disease characterized by infiltrative lesions in the retrobulbar and periorbital tissues, often manifested as exophthalmos, eyelid retraction, diplopia, etc. In severe cases, it may even endanger vision and lead to blindness. According to investigations, 30%-50% of GD patients develop obvious orbital lesions, which is one of the most common extrathyroidal manifestations of thyroid diseases. In the early treatment of TAO, drugs are often used to restore thyroid function. Although the ocular symptoms of some patients sometimes improve relatively with the continuation of the drug effect, the ocular symptoms of some patients still continue to develop after the thyroid function returns to normal, resulting in uncertain treatment effects. Currently, the treatment methods for thyroid-associated ophthalmopathy mainly include drug treatment, radiotherapy and surgical treatment. The commonly used first-line drug treatments mainly include glucocorticoids, selenium supplementation treatment, etc. However, due to the lack of clear treatment targets, traditional drug treatments usually have obvious side effects.

[0003] IGF-1R is a heterotetrameric protein that is widely expressed on the surface of various cells and participates in the regulation of cell proliferation and metabolism. It belongs to the tyrosine kinase receptor and consists of two subunits: IGF-1Rα contains the ligand-binding domain, while IGF-1Rβ contains the tyrosine phosphorylation region and is mainly involved in signal transduction. IGF-1R participates in the signal transduction of a series of cellular responses, including the regulation of apoptosis. The IGF-1R receptor signaling pathway has been proven to play a role in the pathogenesis of autoimmune diseases by multiple experiments. The pathogenesis of thyroid-associated ophthalmopathy is complex and is currently considered to be mainly related to the disorder of the immune system. Research shows that the expression of IGF-1R on the surface of orbital fibroblasts (OF) in TAO patients is 3 times that of the normal population, while the content of soluble IGF-1R in the serum of TAO patients has no obvious difference from that of normal people, indicating that locally expressed IGF-1R in the orbit may play a major role in the pathogenesis of TAO.

[0004] Aptamer, also known as chemical antibody, has precise targeting and is composed of single-stranded ribonucleotides or deoxyribonucleotides. Aptamers can bind to complementary spatial structures on their targets through stem-loops, bulges, hairpins, pseudoknots, or G-quadruplexes formed by their own folding to achieve specific recognition functions. Its targets can be proteins, polypeptides, nucleic acids, amino acids, cells, or even some metal ions, etc. In addition, aptamers have the advantages of being able to be synthesized in large quantities in vitro, being inexpensive, having good stability, high affinity, being easy to store, and being easy to edit, so they are widely used in the fields of detection and targeted drug synthesis. At the same time, due to the small molecular weight of aptamers, they are not prone to immune reactions, and the chemical stability of single-stranded DNA is good, and denaturation and renaturation are reversible, making them easy to store for a long time and transport at room temperature, so they are ideal targeting molecules. Due to the clear target, the selected aptamers can recognize the same target expressed in different cells and tissues and can be used for the detection of targets and treatment against targets. Currently, there is no specific aptamer for IGF-1R. Summary of the Invention

[0005] The object of the present invention is to provide an aptamer targeting IGF-1R with high affinity and its applications.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] An aptamer targeting IGF-1R, comprising nucleotides as shown in SEQ ID NO.1 to SEQ ID NO.3; or derivatives of aptamers with the same function obtained by chemical modification, chemical labeling or base change on the basis of SEQ ID NO.1 to SEQ ID NO.3;

[0008] SEQ ID NO.1:

[0009] CAGCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGATGCGATGGAGATGT;

[0010] SEQ ID NO.2:

[0011] CAGCACCGTCAACTGAATACCAGCTGTGCCACCGGGAGACTTGGAAGTCGTACGGGTAGTGATGCGATGGAGATGT;

[0012] SEQ ID NO.3:

[0013] CAGCACCGTCAACTGAATAGCCACACCGCCGGGAGAGACGCGTACGGGACAGTTTACAGTGATGCGATGGAGATGT。

[0014] Preferably, the above chemical modification or base change includes one or more of phosphorylation, methylation, amination, carboxylation, thiolation or isotopic labeling.

[0015] Preferably, the above chemical label includes one or more of biotin, avidin, fluorescent group, radioactive substance, digoxin, enzyme, antibody, protein, polypeptide, polymer, nano-luminescent material or any other therapeutic substance.

[0016] Preferably, the nucleotide sequence of the above nucleic acid aptamer has a homology of more than 60% with SEQ ID NO.1 to SEQ ID NO.16.

[0017] Preferably, the nucleotide includes ribonucleotide and peptide nucleic acid.

[0018] Preferably, the derivatives of the nucleic acid aptamer with the same function obtained by chemical modification, chemical labeling or base change on the basis of SEQ ID NO.1 to SEQ ID NO.3 include:

[0019] SEQ ID NO.4 (IGF-1R-Apt4-3):

[0020] ACCGCCGGGAGAGACGCGTACGGG;

[0021] SEQ ID NO.5 (IGF-1R-Apt1-1):

[0022] GCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGA;

[0023] SEQ ID NO.6 (IGF-1R-Apt1-2):

[0024] GTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCAC;

[0025] SEQ ID NO.7 (IGF-1R-Apt1-3):

[0026] TCTGCACGTTAGGATCCTTTCTTCGGCTGG;

[0027] SEQ ID NO.8 (IGF-1R-Apt1-4):

[0028] TGCACGTTAGGATCCTTTCTTCGGCT.

[0029] The present invention also claims to protect a kit for detecting IGF-1R, comprising the nucleic acid aptamer targeting IGF-1R.

[0030] The present invention also claims to protect a molecular probe, comprising the nucleic acid aptamer targeting IGF-1R.

[0031] The present invention also claims to protect the application of the nucleic acid aptamer targeting IGF-1R in diagnostic reagents, molecular imaging probes or targeting media.

[0032] The present invention also claims to protect the application of the nucleic acid aptamer targeting IGF-1R in the design and preparation of preparations for detecting, diagnosing and treating diseases related to IGF-1R.

[0033] Preferably, the diseases related to IGF-1R include Graves' disease, thyroid-associated ophthalmopathy or thyroid cancer.

[0034] The present invention uses a nucleic acid aptamer library and adopts SELEX technology to screen nucleic acid aptamers. Then, 293T cells are infected with lentiviral particles pLVX-puro-IGF-1R, and cells with puromycin resistance are screened using puromycin. The obtained cells are plated in a 96-well plate by the limiting dilution method to screen monoclonal cells. The screened monoclonal cell lines are confirmed by WB to have an overexpression effect of IGF-1R, and this cell line is named the 293T-IGF-1R stable transfection cell line. Based on this setting, positive screening targets and negative screening targets are set. When the confluence of the 293T-IGF-1R stable transfection cell line reaches 90%, the high-glucose complete medium is removed. After 3 PCR amplifications, one NAP-5 nucleic acid purification column is taken for incubation screening. The concentration of nucleic acid aptamers in the solution is measured using an enzyme-linked immunosorbent assay (ELISA) at an absorbance parameter of 260 nm to complete the first round of screening. After each round of screening, the screening pressure is increased: reducing the amount of the nucleic acid aptamer library used, reducing the amount of positive screening cells and positive screening time, increasing the amount of negative screening cells and negative screening time, increasing the number of washing times, intensity and time after incubation. After all the screening is completed, the products obtained from each round of screening are incubated with the 293T-IGF-1R stable transfection cell line, and the affinity is detected to determine the round of screening at the end point. Since the affinity of the nucleic acid aptamers obtained after the 12th round of screening has no obvious change compared with the previous round, the 12th round of screening is determined as the end point screening round. The nucleic acid aptamers at the end point screening round are sent for high-throughput sequencing.

[0035] The beneficial effects of the present invention are:

[0036] The IGF-1R nucleic acid aptamer screened by the invention using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology can replace traditional drug treatment and diagnostic methods for the diagnosis, detection and treatment of IGF-1R-related diseases. This aptamer has the following advantages:

[0037] (1) It can be synthesized in large quantities in vitro, is inexpensive, has good stability, high affinity, is convenient for storage, and is easy to edit; at the same time, due to its small molecular weight, it is not prone to immune reactions, and the chemical stability of single-stranded DNA is good, with reversible denaturation and renaturation, making it easy to store for a long time and transport at room temperature;

[0038] (2) Human orbital fibroblasts (OFs) were used to detect the affinity of the truncated and optimized aptamer, which maximally ensured the stability of the aptamer and laid a foundation for the development of detection methods and products;

[0039] (3) The IGF-1R nucleic acid aptamer has good application prospects. By appropriately modifying or labeling this nucleic acid aptamer, it can be used for the rapid detection and diagnosis of diseases in which IGF-1R is involved in the pathogenesis. Brief Description of the Drawings

[0040] Figure 1 It is the WB verification diagram (A) and protein quantification diagram (B) of the 293T-IGF-1R stable cell line;

[0041] Figure 2 It is the binding ability of sequence Apt1 to target cells;

[0042] Figure 3 It is the binding ability of sequence Apt2 to target cells;

[0043] Figure 4 It is the binding ability of sequence Apt3 to target cells;

[0044] Figure 5 It is the binding ability of sequence Apt4 to target cells;

[0045] Figure 6 It is the secondary structure of aptamers Apt1, Apt2, and Apt4;

[0046] Figure 7 It is the affinity of the aptamer to target cells;

[0047] Figure 8 It is the binding ability of IGF-1R-Apt2-1, IGF-1R-Apt2-2, and IGF-1R-Apt2-3 to target cells;

[0048] Figure 9 It is the binding ability of IGF-1R-Apt4-1 and IGF-1R-Apt4-2 to target cells;

[0049] Figure 10 is the binding ability of IGF-1R-Apt4-3 to target cells;

[0050] Figure 11 is the co-incubation of IGF1R aptamer with OFs cells;

[0051] Figure 12 is the immunofluorescence FITC / DAPI / Cy5 staining map of IGF1R aptamer;

[0052] Figure 13 is the effect of IGF-1R aptamer on the activation of orbital fibroblasts;

[0053] Figure 14 is the effect of IGF-1R aptamer on the adipogenic differentiation of orbital fibroblasts;

[0054] Figure 15 is the effect of IGF-1R aptamer on the inflammation of orbital fibroblasts. Detailed implementation mode

[0055] The present invention will be further described in detail below in conjunction with embodiments. However, these embodiments are only for illustrating the present invention and not for limiting the scope of the present invention. The experimental methods used in the following embodiments are all conventional methods unless otherwise specified, and the reagents, methods and equipment used are all conventional reagents, methods and equipment in the technical field of the present invention unless otherwise specified.

[0056] Example 1

[0057] Construct 293T-IGF-1R stable cell line

[0058] Infect 293T cells with lentiviral particles pLVX-puro-IGF-1R, and screen cells with puromycin resistance using puromycin. The obtained cells are plated in 96-well plates by limiting dilution method to screen polyclonal cells. The screened polyclonal cell line is confirmed by WB to have the overexpression effect of IGF-1R, and this cell line is named 293T-IGF-1R stable cell line ( Figure 1 is the WB verification map (A) and protein quantification map (B) of 293T-IGF-1R stable cell line). The specific process is as follows:

[0059] 1.1 Construction of IGF1R overexpression vector

[0060] 1.1.1 Primer design

[0061] The designed sequences are shown as follows:

[0062]

[0063]

[0064] For this experiment, the restriction enzyme cleavage sites XhoⅠ and EcoRⅠ were selected.

[0065] 1.1.2 Preparation of template DNA

[0066] A. Total RNA extraction

[0067] (1) Lysis of samples: Add 293T cell samples to a 6-well plate, and add 1 mL of Trizol per well. After gently pipetting and mixing, let it stand at room temperature for 5 min, then transfer to a new 1.5 mL Eppendorf tube.

[0068] (2) Add 200 μL of chloroform to each tube, shake the Eppendorf tube by hand for 15 s, let it stand at room temperature for 10 min, then centrifuge at 4℃, 12000 rpm for 15 min.

[0069] (3) At this time, the substances in the tube are divided into three layers. Use a 1 mL pipette tip to aspirate 600 μL of the upper layer liquid and transfer it to a new 1.5 mL Eppendorf tube. Add an equal volume of pre-cooled isopropanol to the upper layer of water taken, mix well, then let it stand at 4℃ for 10 min, and centrifuge at 4℃, 12000

[0070] rpm for 10 min.

[0071] (4) At this time, a white precipitate appears in the tube, which is the total RNA required for the experiment. Use a 1 mL pipette tip to aspirate the supernatant.

[0072] (5) Add 1 mL of 75% ethanol to wash the precipitate, and centrifuge at 4℃, 12000 rpm for 5 min.

[0073] (6) Use a 1 mL pipette tip to aspirate the supernatant, and centrifuge at 4℃, 12000 rpm for 5 min.

[0074] (7) Carefully aspirate the remaining moisture with a 20 μL pipette tip, dry it at room temperature. When the RNA is basically transparent, add 20 μL of RNase-free water until it is completely dissolved, and measure the concentration of the extracted RNA with a microplate reader.

[0075] B. Reverse transcription

[0076] (1) Add 1 μL of OLigo dT (60 μm), 1 μL of Random primer (250 μm) and 2.0 μg of the extracted RNA to a PCR tube, supplement RNase-free water to 9 μL, mix well, and then micro-centrifuge to make the liquid gather at the bottom of the tube.

[0077] (2) Incubate at 65 °C for 10 min, then cool on ice for 2 min.

[0078] (3) Take out a new RNase-free PCR tube and prepare the reaction mixture as follows:

[0079]

[0080]

[0081] (4) After mixing, add it to step (1), mix well, centrifuge briefly, and let it stand at room temperature for 2 min.

[0082] (5) Incubate in a 42 °C water bath for 30 min, then inactivate the enzyme at 85 °C for 5 min to obtain cDNA.

[0083] Measure the cDNA concentration with a microplate reader and adjust the concentration to 30 ng / μL.

[0084] 1.1.3 PCR amplification

[0085] ① Take a sterile 0.5 mL EP tube and prepare the reaction solution (add in the order of more first and less later):

[0086] Table 1 PCR reaction system

[0087] Substance Addition amount <![CDATA[H2O]]> 33.3 μL <![CDATA[10×Buffer(Mg 2+ )]]> 10 μL dNTP (2.5 mM each) 4 μL Template (cDNA) 0.2 μL Forward primer (SEQ ID NO.9) 1 μL Reverse primer (SEQ ID NO.10) 1 μL DNA polymerase 0.5 μL Total 50 μL

[0088] ② Set the PCR reaction program as follows:

[0089]

[0090] After amplification, the amplification product is obtained.

[0091] ③ Recover the PCR product by DNA electrophoresis

[0092] A. Prepare 1% DNA agarose gel: Weigh 0.5 g of agarose dry powder, pour it into a triangular flask, add 50 mL of 1×TAE solution, heat it in a microwave oven until completely melted, add Super GelRed, shake well, pour it into the gel preparation tank, and insert the comb;

[0093] B. Load all 50 μL of the PCR product, use DL2000 Marker as a control, and perform electrophoresis at 110 V for 30 min;

[0094] C. Take out the gel block and take a photo in the gel imager;

[0095] D. Take a sterile 1.5 mL EP tube, cut and recover the target gene band (using the marker as a reference, the target band above 3000 bp and below 5000 bp is the target band), and refer to the user manual of the OMEGA agarose gel DNA recovery kit for the recovery steps;

[0096] E. After eluting with 30 μL ddH2O, use a multifunctional microplate reader to detect the concentration of the gel recovery product. The OD260 in the microplate reader is 0.154, the OD260 of the blank well is 0.063, and the measured concentration of the gel recovery product is 91 μg / mL. The gel recovery product is the target gene.

[0097] 1.1.4 Digest the plasmid linearly

[0098] A. Select a suitable reaction solution according to the restriction endonuclease and prepare the digestion system:

[0099] Table 2 Digestion system of pLVX-puro vector

[0100] Substance Addition amount pLVX - puro 2 μg <![CDATA[ddH2O]]> Up to 50 μL 10×Buffer 5 μL XhoⅠ 1 μL EcoRⅠ 1 μL Total 50 μL

[0101] The pLVX-puro vector was purchased from Hunan Ourui Biotechnology Co., Ltd.

[0102] B. Incubate in a 37 °C water bath for 1 h;

[0103] C. Recover the digested vector and fragment: Refer to the user manual of the Omega DNA purification and recovery kit for operation to obtain the linearized plasmid.

[0104] 1.1.5 Ligation

[0105] A. Prepare the ligation reaction system in a PCR tube as follows:

[0106] Substance Addition amount Target gene fragment: Linearized plasmid 3：1 2×Seamless Master Mix 5 μL <![CDATA[ddH2O]]> Up to 10 μL

[0107] B. React in a 50 °C water bath for 15 min, then take out the centrifuge tube and place it on ice for later use to obtain the ligation solution.

[0108] 1.1.6 Transformation

[0109] 1.1.6.1 Prepare the following solutions

[0110] A. LB liquid ampicillin-resistant medium: Weigh 25 g of LB broth medium, dissolve it in 1 L of distilled water, autoclave it, cool it to below 55 °C in a laminar flow hood, add ampicillin resistance at a final concentration of 100 μg / mL (do not expose to ultraviolet light after adding), and shake well. Then dispense these resistant media into 25 mm × 150 mm test tubes, 10 mL per tube, and store at 4 °C for later use;

[0111] B. LB liquid antibiotic-free medium: Weigh 25 g of LB broth medium, dissolve it in 1 L of distilled water, autoclave it, and place it in a laminar flow hood to cool to room temperature for later use.

[0112] C. LB agar medium: Weigh 40 g of LB agar medium, dissolve it in 1 L of distilled water, autoclave it, and place it in a laminar flow hood. Cool it to about 50 °C, add ampicillin resistance at a final concentration of 100 μg / mL (do not expose to ultraviolet light after addition), shake well, and pour it into a disposable 60 mm × 60 mm petri dish while it is still hot. Cover the bottom of the dish with the medium. After it solidifies, invert the petri dish and store it at -4 °C to obtain the target plasmid.

[0113] 1.1.6.2 Transformation experiment procedure

[0114] A. Use a sterile pipette tip to transfer 50 μL of the competent cell suspension to a sterile microcentrifuge tube. Add 5 μL of the ligation solution obtained in Section 1.1.5 to each tube, gently rotate to mix, and place it on ice for 30 min.

[0115] B. Preheat a water bath to 42 °C and perform heat shock for 90 s.

[0116] C. Quickly transfer the tube to an ice bath and cool for 2 min.

[0117] D. Add 700 μL of LB liquid antibiotic-free medium to each tube, then transfer the tubes to a shaker at 37 °C and 200 rpm for 45 min of recovery.

[0118] E. Take 100 μL of the recovered competent cells and transfer them onto LB agar medium containing Amp resistance.

[0119] F. Cover the petri dish and place it at room temperature until the liquid is absorbed.

[0120] G. Invert the petri dish and incubate it at 37 °C for 16 h.

[0121] H. Obtain the samples for positive clone PCR identification.

[0122] 1.1.6 PCR identification of positive clones

[0123] A. The colony PCR reaction system is as follows:

[0124] Reagent Volume Forward Primer (SEQ ID NO.9) 0.5 uL Reverse Primer (SEQ ID NO.10) 0.5 uL 2×PCR mix 10 uL Colony PCR template A small amount <![CDATA[ddH2O]]> Up to 20 uL

[0125] For the PCR reaction, use the following cycling conditions:

[0126]

[0127] B. Colony PCR Template: Use a white pipette tip to pick a single colony and transfer it into a PCR tube containing 6 μL of sterilized deionized water. Take 2 μL as the PCR template, and transfer the remaining 4 μL into an ampicillin-resistant LB liquid medium. Incubate the culture overnight at 37 °C with shaking at 200 rpm.

[0128] C. Agarose Gel Electrophoresis: ① Dissolve 0.25 g of agarose (Spain 111935) in 25 mL of 1×TAE (50×TAE brand:

[0129] Sangon Biotech B548101-0500. Add distilled water to 1 mL of 50×TAE to a final volume of 50 mL to obtain 1×TAE) electrophoresis buffer in a conical flask and heat it in a microwave oven until completely dissolved. ② Let the dissolved liquid cool down to about 50 °C, add 2.5 μL of nucleic acid dye (Super GelRed brand: Lianke S2001), shake well, pour it into the gel tank, insert the accompanying comb, and let it stand until solidified. ③ Remove the comb, place the gel in the gel tank of the electrophoresis apparatus (constant voltage electrophoresis apparatus brand: Tanon EPS-300)

[0130] and add 1×TAE to cover the gel. ④ Mix 5 μL of the colony PCR product with 1 μL of DNA loading buffer evenly, and add it to the comb wells of the gel. Add 2 μL of DNA marker (TransGen Biotech BM121) to one of the comb wells behind the sample. ⑤ Turn on the electrophoresis apparatus and set the conditions to 110 V for 30 min. ⑥ After electrophoresis, observe the band sizes under ultraviolet light. D. Plasmid Submission for Sequencing: After culturing the single colony with positive electrophoresis results, take 800 μL of the preserved bacteria (the bacterial solution is mixed with 80% sterilized glycerol at a ratio of 5:

[0131] 2), extract the plasmid using a kit (Tiangen Biochemical Technology, product number DP105) and then sequence it to accurately detect whether it is a positive clone.

[0132] Compare the sequences. If it is positive, streak the corresponding preserved bacterial solution, pick single colonies, culture them, and extract the plasmid for subsequent experiments. The operation method is the same as above.

[0133] 1.1.7 Sequencing Identification

[0134] For the bacterial solution with positive PCR identification, after culturing it overnight, miniprep the plasmid and send it to Tsingke Biological for sequencing and comparison. After the comparison sequence is correct without mutations, proceed with subsequent lentivirus packaging.

[0135] 1.2 Lentivirus Packaging Experiment

[0136] 1.2.1 Lentivirus Packaging

[0137] Trypsinize 293FT cells in logarithmic growth phase for lentivirus packaging. When the cell density reaches 5×10⁸, re-seed them into a 10-cm cell culture dish and culture overnight in an incubator at 37°C with 5% CO₂.

[0138] Before lentivirus packaging, prepare the packaging plasmid mixture in advance: pLP1 (5 μg) + pLP2 (4 μg) + pLP / VSVG (3 μg); pLP / VSVG is an auxiliary plasmid from Hunan Ourui Biotechnology Co., Ltd. Use pLVX-puro as the negative control plasmid and pLVX-puro-IGF1R as the experimental plasmid respectively, and carry out virus packaging according to the following steps. The virus of pLVX-puro after packaging is lv-NC; the virus of pLVX-puro-IGF1R after packaging is lv-IGF1R.

[0139] When the cell density reaches 90% - 95%, transfection can be carried out. In an EP tube a, add the above-prepared packaging plasmid mixture and 9 μg of the target plasmid (pLVX-puro or pLVX-puro-IGF1R), mix them, then add Opi-MEM to make the volume up to 1 mL, and incubate at room temperature for 5 min;

[0140] A. Add 950 μl of Opti-MEM + 50 μL of lip2000 to another new EP tube b, mix well and incubate at room temperature for 5 min;

[0141] B. After mixing the EP tubes a and b for 20 min, transfer the mixed solution to the culture medium containing monolayer cells, mix well, and discard the culture medium containing the transfection mixture after culturing for 8 h;

[0142] C. Add 8 mL of cell culture medium containing 10% fetal bovine serum to each dish of cells and continue to culture for 48 h;

[0143] D. Collect the supernatant of 293T cells transfected for 72 h;

[0144] E. Centrifuge the collected supernatant at 4°C and 3500 g for 10 min, and collect the supernatant;

[0145] F. Filter the supernatant through a 0.45-μm filter;

[0146] G. Collect again after 60 h (repeat G - I);

[0147] H. In a 40-mL ultracentrifuge tube, centrifuge at 4°C and 38000 r / min for 2 h to obtain the lentivirus packaging plasmid;

[0148] I. Then resuspend the lentivirus packaging plasmid with PBS and dissolve the precipitate at 4°C overnight. Obtain lv-NC and lv-IGF1R lentiviruses.

[0149] 1.2.2 Titer Detection

[0150] A. Prepare a 1×105 cells / mL cell suspension of 293FT cells (Hunan Ourui Biotechnology Co., Ltd.) and wait for plating;

[0151] B. Pipette 500 μL into each well of a 24-well plate, i.e., 5×10 4 cells / well;

[0152] C. Add lentiviral packaging plasmid at a 10-fold gradient (1×10 -1 , 1×10 -2 , 1×10 -3 );

[0153] D. Take 18 μL of PBS and add 2 μL of the original polybrene (10 mg / mL) stock solution, dilute 10-fold, and the concentration becomes 1 mg / mL. Add 2.5 μL of the diluted polybrene to each well, and finally the concentration of polybrene in the cell sample reaches 5 μg / mL;

[0154] E. Replace the medium after 24 h: Discard the medium and add 500 μL of fresh medium to each well;

[0155] F. After 48 h of infection, digest the cells with trypsin and extract the genomic DNA in the sample according to the operating steps of the DNA extraction kit (Bomed Biotech, DL107-01);

[0156] G. Design two pairs of qPCR primers for qPCR detection and measure the expression levels of the following factors in each sample. The primer information is as follows (ACTB is the internal reference and WPRE is the target gene):

[0157] Table 3 qPCR Primers

[0158]

[0159] Set the reaction program on the qPCR instrument to pre-denature at 95 °C for 30 s, and then set 40 cycles of 95 °C for 5 s and 60 °C for 30 s;

[0160] H. Calculate the Ct value of each group of samples according to the standard product, obtain the titer of each group of viruses, and the results show that: lv-IGF1R

[0161] The titer is 3.28*10 9 ; lv-NC is 7.84*10 8 .

[0162] 1.3 Construction of Polyclonal Stable Transfected Strains

[0163] 1.3.1 Cell Resuscitation

[0164] A. Remove the 293T cell cryopreservation tube from the liquid nitrogen tank, quickly place it in a water bath containing warm water at 37 °C, shake continuously, and thaw as soon as possible; B. After wiping and disinfecting with 75% alcohol, transfer it to the biosafety cabinet, aspirate the cell suspension into a 6 cm culture dish, and supplement with 3 mL of culture

[0165] medium, and place it in an incubator (5% CO2, 37 °C) for culture;

[0166] C. Replace the culture medium once the next day and then continue the culture.

[0167] 1.3.2 Cell passage

[0168] A. Discard the old culture medium, add 2 mL of sterile PBS solution, gently shake to wash the cell growth surface, and then discard the PBS solution; B. Add 500 μL of trypsin digestion solution and digest for 1 - 2 min until the cells are completely digested;

[0169] C. Add 500 μL of culture medium to terminate the digestion. Transfer the cell suspension to a 1.5 mL centrifuge tube, centrifuge at 1500 rpm for 3 min;

[0170] D. Aspirate the supernatant, resuspend the cells with 1 mL of culture medium, pipette 200 μL of the cell suspension into a new culture dish, add 4 mL of culture medium, and place it in the incubator for continued culture.

[0171] 1.3.3 Cell counting

[0172] A. Digest the cells in the logarithmic phase with trypsin (without EDTA), centrifuge at 1500 rpm for 3 min, aspirate the supernatant, and resuspend

[0173] the cells with culture medium to make a cell suspension;

[0174] B. Wash and dry the hemocytometer, pipette 7.5 μL of the cell suspension along one side of the coverslip slowly to add the cell suspension for cell counting.

[0175] 1.3.4 Cryopreservation of cell lines

[0176] A. Take the cells in the logarithmic phase, digest them with trypsin, centrifuge at 1500 rpm for 3 min, aspirate the supernatant, and prepare the cells into a concentration of 1×

[0177] 10 6 ~1×10 7 / mL. In a 1.5 mL cryopreservation tube, add 1 mL of the cell suspension and seal it. Mark the cell information on the outer tube wall, place it in a 4 °C refrigerator for 1 h, then in a -20 °C refrigerator for 2 h, and then transfer it to liquid nitrogen for long-term storage;

[0178] B. After one week of cryopreservation, take one vial of cells for resuscitation culture, observe the cell resuscitation efficiency, and determine the cryopreservation quality. For the failed cryopreserved cell batches, re-cryopreservation is required.

[0179] 1.3.5 Cell Infection

[0180] A. Digest the cells in the logarithmic growth phase with 0.25% trypsin, centrifuge at 1500 rpm for 3 min at room temperature, discard the supernatant, and resuspend the cells with 1 mL of medium

[0181] to make a cell suspension;

[0182] B. Adjust the cell density and inoculate into a 6-well plate (1.2×10 6 cells), add 2.5 mL of medium and culture the cells in a CO2 incubator (37°C, 5% CO2, relative humidity 95%, pH value 7.2 - 7.4). After the cells adhere, aspirate the medium, carefully add 1 mL of Opti-MEM medium, and then add the virus amount calculated by the following formula (Virus amount calculation formula: Virus volume = Cell MOI × Cell seeding number / Virus titer, the MOI of 293T cells is 1). The virus is lv-NC or lv-IGF1R. Gently mix and culture at 37°C in a 5% CO2 incubator. After 48 h of infection, continuously screen with puromycin and expand the culture;

[0183] C. When the cell number is close to the expected number, replace the complete medium without puromycin and continue to culture for 48 h;

[0184] D. Take out the culture plate, aspirate the medium, add 100 μL of complete medium and 5×10 3 cells to each well of a 96-well plate, and add

[0185] 2.5 mL of complete medium and 1.2×10 6 cells to each well of a 6-well plate, and continue to culture;

[0186] E. When the cell density is about 70%, take out the culture plate, aspirate the medium, add an appropriate amount of complete medium according to the size of the culture plate to each well, and place it in the incubator for 24 h. Obtain 293T cells infected with lv-NC (293T + lv-NC) and 293T cells infected with lv-IGF1R

[0187] (293T + lv-IGF1R).

[0188] F. Collect the cells (① 293T; ② 293T + lv-NC; ③ 293T + lv-IGF1R) for downstream Western bolt experiment verification.

[0189] 1.4 Western blot Verification

[0190] 1.4.1 Total cell protein extraction

[0191] A. Place the three groups of cell samples on ice and scrape the cells off the culture dish with a cell scraper (Note: Repeat scraping the wall to ensure no residual cells on the culture dish);

[0192]

[0193] B. Transfer the scraped cells into an EP tube, centrifuge at 4°C, 500g for 5 min;

[0194] C. Aspirate the supernatant, wash once with 1 mL PBS, centrifuge at 4°C, 500g for 5 min;

[0195] D. Discard the PBS, add an appropriate amount of 2×SDS Lysis Buffer according to the cell amount;

[0196] E. After sufficient lysis, centrifuge at 4°C, 12,000 rpm for 5 min, take the supernatant and perform protein quantification.

[0197] 1.4.2 Protein quantification (BCA method)

[0198] A. Add the samples to the plate at a volume of 2 - 5 μL per well, and add the standard (1 mg / mL BSA) to the plate at 2, 4, 6, 8, 10, 12 μL each time. Then add 200 μL of BCA working solution (Beyotime, P0010S) to each well and incubate at 37°C for 30 min. Ensure that the reading of the sample is within the standard curve, preferably in the middle of the standard curve. If it deviates from the standard curve range, it needs to be redetermined;

[0199]

[0200] B. Cool to room temperature, measure A562 with an enzyme - linked immunosorbent assay (ELISA) reader, calculate the protein concentration according to the standard curve, dilute the protein samples in the same group to the same concentration according to the quantification result, add 4×Loading buffer and boil in boiling water for 3 - 5 min;

[0201]

[0202] C. Invert the EP tube to mix the water vapor on the tube cap with the lysate obtained in 1.4.1, then centrifuge at 4°C, 12,000 rpm for 1 min and store at -20°C for later use.

[0203] 1.4.3 Loading and electrophoresis

[0204] A. Rinse the glass plate thoroughly and let it dry;

[0205] B. Place the dried glass plate into the fixture as required;

[0206] ​​​C. Prepare concentrated gels and separating gels with different concentrations according to the molecular weight of the target protein. The specific systems are as follows:

[0207] Table 4 Concentrated gels with different concentrations

[0208]

[0209]

[0210] Table 5 Concentrated gel system

[0211]

[0212] Selection of separating gel concentration: Determine the gel concentration according to the size of the target protein:

[0213] Table 6 Separating gels with different concentrations

[0214]

[0215] D. Prepare SDS-PAGE: First, prepare the separating gel. Add 5 mL of separating gel to the glass plate, then add 1 mL of absolute ethanol. After 30 minutes, when the separating gel has fully solidified, discard the absolute ethanol in the glass plate, blot the remaining absolute ethanol dry with filter paper, add 1.5 mL of concentrated

[0216] gel, and then insert the comb teeth;

[0217] E. Loading: After the gel has solidified, place it in the electrophoresis tank. After adding enough electrophoresis buffer, start preparing for loading;

[0218] F. Electrophoresis: Concentrated gel - constant voltage 60 V, 30 minutes; Separating gel - constant voltage 120 V, stop electrophoresis when the Loading dye is about 5 cm from the bottom.

[0219] 1.4.4 Immunoblotting (wet transfer)

[0220] A. After electrophoresis, use the transfer electrophoresis device, ice bath, and transfer the protein to the PVDF

[0221] membrane under a constant current of 350 mA for 120 minutes: Wet the PVDF membrane with methanol and then fully immerse it in the transfer buffer. Pour 500 - 800 mL of the electrotransfer buffer (Sangon Biotech B040131) into a medical tray. Take the glass plate out of the electrophoresis device, gently pry the two glass plates apart with a gel spatula, gently cut off the bottom end of the gel with a gel spatula, gently lift the gel and place it on the filter paper. The placement order from the negative electrode to the positive electrode is: filter

[0222] paper - gel (-) - PVDF membrane (+) - filter paper, and then place it in the transfer electrophoresis device;

[0223] B. Add 1 L of electrotransfer buffer and transfer the membrane at a constant current of 350 mA for about 1 - 2 h.

[0224] C. Immunoreaction:

[0225] a. Blocking: Pour 40 - 50 mL of blocking solution (TBST solution containing 5% skim milk) into a petri dish. Place the transferred PVDF membrane face up in the petri dish to prevent protein detachment. The PVDF membrane should be completely immersed in the blocking solution and blocked at room temperature for 1 - 2 h (adjust the blocking time according to room temperature).

[0226] b. Primary antibody incubation: Place the blocked PVDF membrane in a hybridization strip of appropriate size. Add the antibodies diluted with 5% skim milk (IGF1R antibody (anti - IGF1R, Huamei Biology, CSB - PA067618) and GAPDH antibody (anti - GAPDH, Affinity, AF7021)), remove the air bubbles, and incubate overnight at 4°C;

[0227] c. Membrane washing: Transfer the PVDF membrane to a petri dish, add 40 - 50 mL of TBST solution, and gently shake on a shaker for 10 min. Repeat the washing 3 times;

[0228] d. Secondary antibody (Anti - rabbit IgG(H + L), brand CST, 14708) incubation: Refer to the method of primary antibody dilution and incubation, and incubate the PVDF membrane at room temperature

[0229] for 2 h;

[0230] e. Membrane washing: Wash the membrane 3 times with TBST, 10 min each time;

[0231] D. Chemiluminescence, developing, and fixing:

[0232] a. Mix solution A and solution B in a 1:1 ratio (Super - sensitive ECL chemiluminescence kit, brand Xinsaimi, P10100) to prepare a total

[0233] volume of 1 mL of mixed solution;

[0234] b. Place the membrane in a chemiluminescence imaging system, add the pre - mixed AB mixed solution, and spread it evenly;

[0235] c. Expose the membrane in the chemiluminescence imaging system for 30 / 60 s, observe the results, and save the pictures.

[0236] E. The results are shown in the following figure. After 293T cells were infected with IGF1R and screened with puromycin, IGF1R protein was stably expressed, indicating the successful construction of a polyclonal stable transfection strain.

[0237] Example 2

[0238] SELEX technology for screening nucleic acid aptamers

[0239] Design and synthesize the nucleic acid aptamer library used, with the sequence CAGCACCGTCAACTGAAT(N40)GTGATGCGATGGAGATGT, where N40 represents a random nucleotide sequence of 40 A, T, C, or G, and the number of this sequence is 10 10 -10 12 The screening method used is SELEX technology, and the specific operation steps are as follows:

[0240] 1.1. Set the 293T-IGF1R stable transfected cells in Example 1 as the positive screening target, and 293T cells as the negative screening target. To minimize the loss of nucleic acid aptamers with high affinity during the initial screening, only the positive screening target is introduced in the 1st - 2nd rounds of screening, and the negative screening target is introduced starting from the 3rd round. Dissolve 1 OD of the initial library with enzyme-free and sterile water, denature the dissolved initial library at 95°C for 10 min, and then immediately place it on ice for 10 min.

[0241] 1.2. Observe the cell confluence of the 293T-IGF1R stable transfected cells in Example 1 under a microscope. After the cell confluence reaches 90%, remove the high-glucose complete medium, wash it 2 times with 2 mL of PBS, and then add 100 μL of binding buffer (4.5 g / L glucose, 5 nM MgCl2, 1 mg / mL BSA, and 1 mg / mL yeast tRNA dissolved in DPBS), and incubate with the nucleic acid aptamer library for 2 h. The incubation conditions are incubation on a 3D shaker at 4°C.

[0242] 1.3. After incubation, centrifuge at 2000 rpm for 3 min, remove the supernatant, add washing buffer (4.5 g / L glucose and 5 nM MgCl2 dissolved in DPBS) to wash once, resuspend with 100 μL of enzyme-free and sterile water after centrifugation, denature at 95°C for 10 min, and then immediately place it on ice for 10 min. Take the supernatant after centrifugation and name it template 1.

[0243] 1.4. Take 100 μL of Template 1 for PCR amplification. Add 2×Mix buffer, FAM forward primer, and Biotin - reverse primer to make a 200 μL system. The amplification conditions are 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, for 10 cycles, and 72°C for 2 min. The amplification system is shown in the following table. The forward primer sequence is: 5’-CAGCACCGTCAACTGAAT-3’ (SEQ ID NO.15), and the reverse primer is 5’-ACATCTCCATCGCATCAC-3’ (SEQ ID NO.16). The product obtained after amplification is named Template 2. This amplification is named PCR1.

[0244] Table 7 PCR1 Amplification System

[0245]

[0246] Take the amplified product for secondary PCR amplification. Configure a 60 μL amplification system with the product of the previous round of PCR amplification as the template, and add 1.1×Mix buffer, FAM forward primer, and Biotin - reverse primer. The amplification system is shown in the following table. The forward primer sequence is: 5’-CAGCACCGTCAACTGAAT-3’ (SEQ ID NO.15), and the reverse primer is 5’-ACATCTCCATCGCATCAC-3’ (SEQ ID NO.16). This amplification is named PCR2.

[0247] Table 8 PCR2 Amplification System

[0248]

[0249] The amplification conditions are 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, 72°C for 2 min, and the number of cycles is set to 10, 12, 14, 16, 18, 20. After PCR amplification, determine the optimal number of cycles by agarose gel electrophoresis. Take Template 2 for PCR amplification. Configure a 2000 μL amplification system and add 1.1×Mix buffer, FAM forward primer, and Biotin - reverse primer. The forward primer sequence is: 5’-CAGCACCGTCAACTGAAT-3’ (SEQ ID NO.15), and the reverse primer is 5’-ACATCTCCATCGCATCAC-3’ (SEQ ID NO.16). The amplification conditions are 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, 72°C for 2 min, and the number of cycles is set to the optimal number of cycles determined by PCR2. The amplification system is shown in the following table. This PCR is named PCR3. Recover the product obtained from PCR3.

[0250] Table 9 PCR3 Amplification System

[0251]

[0252] 1.5. Take 50 μL of streptavidin-agarose beads, wash them twice with PBS, incubate them with the recovered PCR3 amplification product at a ratio of 50 μL / 1 mL for 1 h, centrifuge to remove the supernatant, and recover the streptavidin-agarose beads.

[0253] 1.6. Take a NAP-5 nucleic acid purification column. To wash the streptavidin-agarose beads efficiently, first remove the salting-out column in the column, and then wash the nucleic acid purification column 3 times with 1 mL of PBS buffer. Resuspend the streptavidin-agarose beads with 1 mL of PBS buffer and transfer them to the NAP-5 nucleic acid purification column, and add 10 mL of PBS buffer to wash the agarose beads.

[0254] 1.7. Close the bottom switch of the NAP-5 nucleic acid purification column, add 500 μL of 0.2 M NaOH solution, incubate for 5 min, and collect the incubated solution.

[0255] 1.8. Transfer the collected incubated solution to a new NAP-5 nucleic acid purification column. After the liquid in the column naturally drains out, add 1 mL of enzyme-free and sterile water, and collect the enzyme-free and sterile water that naturally flows out of the column.

[0256] 1.9. Incubate the collected enzyme-free and sterile water with 100 μL of sodium acetate and 2750 μL of absolute ethanol at -20 °C for 30 min. After incubation, centrifuge at 15000 rpm for 15 min. Remove the supernatant and dry it.

[0257] 1.10. Add 50 μL of enzyme-free and sterile water to dissolve the dried precipitate, and use a microplate reader to measure the concentration of the aptamer in the solution at an absorbance parameter of 260 nm.

[0258] 1.11. Name the operations in 1.2 - 1.10 above as one round of screening. After each round of screening, increase the screening pressure: reduce the amount of aptamer library used, reduce the amount of positive screening cells and positive screening time, increase the amount of negative screening cells and negative screening time, increase the number of washes, intensity, and time after incubation. See the following table for details:

[0259] Table 10 Screening process

[0260]

[0261] 1.12. The screening was carried out for 12 rounds. After all the screening was completed, the products obtained in each round of screening were incubated with the 293T-IGF-1R stable transfected cells to detect whether there was an increase in affinity: Equal amounts of 293T-IGF-1R stable transfected cells and the products after each round of screening were incubated for 30 min. After incubation, they were washed twice with the washing buffer, centrifuged at 2000 rpm for 3 min, and then the supernatant was removed. 100 μL of PBS was added to resuspend, and the affinity between the aptamer and the positive screening cells was detected by flow cytometry (the operation was as described above) to determine the round of the screening endpoint. The results showed that as the screening rounds increased continuously, the affinity between the aptamer and the positive target increased continuously, and both the increase amplitude and the rounds were better than those of the negative control, indicating that the aptamers with affinity to the positive target were enriched. Since the affinity of the aptamer obtained after the 12th round of screening did not change significantly compared with the previous round, the 12th round of screening was determined as the endpoint screening round. During this process, due to the changes in the screening conditions in the first 11 rounds and the inconsistent amplification templates obtained after screening, the results of the samples sent for sequencing in each round were inconsistent. In addition, due to the long screening time, multiple experimental variables affected the experimental results at different time points during the screening process, so the results of the entire SELEX screening had a certain degree of contingency.

[0262] 1.13. The aptamers at the screening endpoint round were sent for high-throughput sequencing. The following aptamers targeting IGF-1R were obtained:

[0263] Table 11 Aptamers targeting IGF-1R

[0264]

[0265]

[0266] Example 3

[0267] Aptamer affinity detection (equilibrium dissociation constant determination)

[0268] 2.1. Sort the nucleic acid aptamers according to the number of nucleic acid aptamers based on the high-throughput sequencing results, and synthesize the nucleic acid aptamers (Apt1 - Apt4) in Table 11. Since the binding ability of nucleic acid aptamers depends on their complex spatial structures, and the complex spatial structures are closely related to the secondary structures of nucleic acid aptamers. Therefore, during this process, it is also necessary to analyze the secondary structures of nucleic acid aptamers. Generally, nucleic acid aptamers that can form complex secondary structures such as stem-loops are retained. Through a large number of high-throughput sequencing and numerous verification experiments, it is found that certain secondary structures of aptamers bind to target molecules through forms such as hydrogen bonds, hydrophobic interactions, pseudo-base pair stacking, and shape matching, forming complexes with strong affinity. However, the forms are complex and there are various interaction forms, making their selection quite difficult. Therefore, the selection results rely on years of experience and subjective judgment.

[0269] 2.2. Take the cells of the stable cell line, remove the culture medium and wash the cells with PBS buffer, and add 1 ml of trypsin to digest the cells. Divide the collected cells into 8 groups, and incubate them with FAM-fluorescently labeled Apt1 - Apt4 (synthesized nucleic acid aptamers with FAM fluorescent groups) at 0, 50, 100, 150, 200, 250, 500, and 750 nM respectively. Add binding buffer to make the incubation system 100 μL, mix the cells evenly in the system, and incubate under the conditions of 4 °C in the dark for 30 min. After incubation, centrifuge at 2000 rpm for 3 min, remove the supernatant, wash the cells once with 200 μL of washing buffer, and then resuspend the cells with 150 μL of PBS. Use a flow cytometer to detect the fluorescence intensity of the cells in each group, and repeat the measurement for each group of cells and take the average value as the fluorescence intensity in each group. Use Y = Vmax*X / (Kd + X) to simulate the curve of the fluorescence intensity and calculate the magnitude of the equilibrium dissociation constant (Kd). The results are as Figure 2 - Figure 5 shown. The sequences Apt1, Apt2, and Apt4 have strong binding ability to target cells. The equilibrium dissociation constant of Apt1 is 243.5 ± 15.8 nM; the equilibrium dissociation constant of Apt2 is 470.6 ± 89.2; the equilibrium dissociation constant of Apt4 is 221.0 ± 31.0; the sequence Apt3 has weak binding ability to target cells, and the equilibrium dissociation constant is 6632.3 ± 4332.7. The results show that Apt4 has the best effect, Apt1 is the second, Apt2 has a general effect, and Apt3 has a very poor effect. Finally, Apt3 is eliminated.

[0270] Example 4

[0271] Truncation and optimization of nucleic acid aptamers

[0272] Cell line source: Human primary OFs cells, isolated from the laboratory.

[0273] Aptamer truncation: The IGF-1R aptamers Apt1, Apt2, and Apt4 obtained from the previous screening were simulated for secondary structure using NUPACK software, as Figure 6 shown. The sites for truncation and optimization were identified, and sequences optimized by truncation were designed accordingly, named IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, IGF-1R-Apt1-4, IGF-1R-Apt2-1, IGF-1R-Apt2-2, IGF-1R-Apt2-3, IGF-1R-Apt4-1, IGF-1R-Apt4-2, IGF-1R-Apt4-3 (see Table 12).

[0274] Verification of the affinity of truncated aptamers: To verify the affinity of the truncated aptamers with the target cells (human OFs). The synthesized truncated aptamers IGF-1R-Apt1-1 to 4 were incubated with OFs cells respectively, and the equilibrium dissociation constant of the aptamers was detected to measure the affinity of the truncated and optimized aptamers with the target cells. The results are as Figure 7 shown. IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, and IGF-1R-Apt1-4 all had good affinity with the target cells.

[0275] And as Figure 8 shown, IGF-1R-Apt2-1, IGF-1R-Apt2-2, and IGF-1R-Apt2-3 all had weak binding ability with the target cells.

[0276] As Figure 9 shown, IGF-1R-Apt4-1 and IGF-1R-Apt4-2 also had weak binding ability with the target cells.

[0277] As Figure 10 shown, IGF-1R-Apt4-3 had the strongest binding ability with the target cells.

[0278] Table 12 Nucleic acid aptamers for truncated and optimized IGF-1R

[0279]

[0280]

[0281] Example 5

[0282] Detection of specific binding of nucleic acid aptamers

[0283] Take one dish of primary human orbital fibroblasts (OFs), remove the culture medium and wash the cells with 2 mL of PBS buffer. Add 1 mL of trypsin to digest the cells. Group the collected cells into an experimental group and a control group (cells incubated with binding buffer). To verify the specific binding of the aptamer to the target cells (human OFs). Incubate the above 5 aptamers with better affinity with OFs cells respectively. The results show that IGF-1R-Apt4-3, IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, and IGF-1R-Apt1-4 are determined to have binding specificity (as Figure 11 - 12 shown. Due to space limitations, Figure 11 - 12 only the results of IGF-1R-Apt4-3 are provided, and the other results are similar). This proves that the nucleic acid aptamers of the present invention have great application value in the differential diagnosis of human OFs and the development of targeted drugs.

[0284] Example 6

[0285] Establish the relationship between the expression level of IGF-1R and the clinical manifestations of patients with thyroid-associated ophthalmopathy

[0286] Take orbital fat specimens from patients with moderate to severe quiescent thyroid-associated ophthalmopathy and extract primary orbital fibroblasts. The process of extracting primary cells is as follows:

[0287] Under sterile conditions, take the orbital connective tissue and extraocular muscles of patients with moderate to severe quiescent thyroid-associated ophthalmopathy. After removing adipose tissue and large blood vessels, rinse the tissue blocks repeatedly 3 times with D-PBS buffer, and then cut them into small tissue blocks about 1 mm 3 in size with ophthalmic scissors. Use a dropper to evenly stick the cut small pieces on the bottom of the bottle at a spacing of 5 mm, and place them in an incubator at 37 °C and 5% CO2 for static incubation. After 6 h, when the tissue pieces are slightly dry and adhere tightly to the bottom of the bottle, digest and passage them with 0.25% trypsin and 0.02% EDTA, and continue to culture them with RPMII640 culture medium containing 10% fetal calf serum after passage.

[0288] Treat the above cultured orbital fibroblasts (OFs) with TGF-β1, and then give the IGF-1R aptamer (Apt-IGF-1R). Observe the effect of the IGF-1R aptamer on the activation of OFs into fibroblasts. The results show that compared with the thyroid ophthalmopathy cell model (OFs group) and the IGF-1R aptamer control group (OFs + Apt-control group), the IGF-1R aptamer can significantly inhibit the fibroblast activation of OFs ( Figure 13); In addition, the process of inducing adipogenesis of OFs in the adipogenic differentiation medium was carried out, and during the induction process, IGF-1R aptamer treatment was given to detect the effects of IGF-1R aptamer on adipogenic differentiation and inflammation of OFs. The results showed that compared with the thyroid ophthalmopathy cell model (OFs group) and the IGF-1R aptamer control group (OFs+Apt-control group), the IGF-1R aptamer could significantly inhibit the adipogenic differentiation of OFs and the expression of related inflammatory factors IL17A and IL23A ( Figure 14 and Figure 15 ).

[0289] As can be seen from the above embodiments, the nucleic acid aptamer targeting IGF-1R provided by the present invention has high affinity and specificity. The IGF-1R nucleic acid aptamer can be used to detect the activation, adipogenic differentiation and inflammatory indicators of orbital fibroblasts to evaluate the disease severity of patients, providing auxiliary quantitative indicators for the formulation of treatment strategies and the evaluation of prognosis of patients.

[0290] It should be noted that when the present invention involves a numerical range, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods adopted are the same as those in the embodiments, in order to prevent repetition, the present invention describes the preferred embodiments. Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0291] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A nucleic acid aptamer targeting IGF-1R, characterized in that, Comprising nucleotides as shown in SEQ ID NO.1, or SEQ ID NOs.5 - 8; SEQ ID NO.1: CAGCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGATGCGATGGAGATGT; SEQ ID NO.5: GCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGA; SEQ ID NO.6: GTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCAC; SEQ ID NO.7: TCTGCACGTTAGGATCCTTTCTTCGGCTGG; SEQ ID NO.8: TGCACGTTAGGATCCTTTCTTCGGCT.

2. A kit for detecting IGF-1R, characterized in that, Comprising a nucleic acid aptamer targeting IGF - 1R as described in claim 1.

3. A molecular probe, characterized in that, Comprising a nucleic acid aptamer targeting IGF - 1R as described in claim 1.

4. Use of the nucleic acid aptamer targeting IGF - 1R as described in claim 1 in the preparation of a diagnostic reagent, a molecular imaging probe or a targeting agent.

5. Use of the nucleic acid aptamer targeting IGF - 1R as described in claim 1 in the preparation of a preparation for detecting or diagnosing a disease related to IGF - 1R, wherein the disease related to IGF - 1R is Graves' disease or thyroid - associated ophthalmopathy.

Images