Application of Rice OsERF52 Protein and Its Encoding Gene in Improving Plant Low Temperature Tolerance

Abstract

The present invention belongs to the field of molecular biology, and specifically discloses an application of a rice OsERF52 protein and its encoding gene in improving plant low temperature tolerance, and relates to the field of plant genetic engineering technology. The amino acid sequence of the rice OsERF52 protein is shown in SEQ ID No. 2. The present invention clarifies for the first time that the rice OsERF52 gene is involved in low temperature response at the protein level, and its protein content gradually increases with low temperature treatment; cold tolerance analysis shows that OsERF52 overexpressing rice plants have a low temperature resistance phenotype and a high survival rate, while Oserf52 mutants all show a low temperature sensitive phenotype, and the survival rate is significantly lower than that of the wild type, indicating that OsERF52 is a positive regulatory factor in rice response to low temperature. The rice OsERF52 protein and its encoding gene can be used to improve plant low temperature tolerance, which is of great significance for the study of the molecular mechanism of low temperature stress and the breeding of new low temperature resistant varieties.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and specifically discloses application of a rice OsERF52 protein and a coding gene thereof in improving plant low temperature tolerance. Background Art

[0002] With the deteriorating global climate and the frequent occurrence of extreme weather events, cold stress has become a major abiotic stress, severely impacting crop growth, production, and geographical distribution (Lesk et al., 2016; Zhu, 2016; Gross and Zhao, 2014). Rice (Oryza sativa L.) is one of the world's three major crops, a staple food that feeds more than half of the world's population. It is also a major staple food in my country, making its importance in ensuring food security self-evident. However, as a crop originating in temperate regions, rice is extremely sensitive to cold stress, which adversely affects its growth and development, especially during the early spring seedling stage. In severe cases, it can lead to significant losses in rice yield and quality (Mao et al., 2019; Zhang et al., 2019b; Muthayya et al., 2014). Therefore, elucidating the complex mechanisms of rice cold resistance and identifying genes associated with cold resistance can provide a theoretical basis for the breeding and improvement of new cold-resistant rice varieties. This also has important theoretical and practical significance for ensuring food security and achieving sustainable agricultural development.

[0003] In response to various biotic and abiotic stresses, rice has evolved a series of adaptive mechanisms to survive and reproduce. One of the most important components is the regulation of stress-responsive gene expression by transcription factors to enhance rice's adaptability. Currently, known transcription factors involved in low-temperature stress response include ZFPs, bZIPs, AP2 / ERFs, MYB / MYCs, and NACs. AP2 / ERFs are one of the largest families of transcription factors in rice and are widely involved in various biological processes, including rice growth and development and stress response. When faced with adversity, rice AP2 / ERF transcription factors regulate the expression of target genes by binding to cis-acting elements in the promoter regions of stress-related genes, such as GCAC(A / G)N(A / T)TCCC(A / G)ANG(C / T), GCC-box (AGCCGCC), and DRE / CRT (A / GCCGAC), thereby enhancing rice's adaptability to various stresses (Shoji and Yuan, 2021). Rashid et al. (2012) classified 170 rice AP2 / ERF transcription factor family genes into five subfamilies: AP2 (APETALA2), RAV (related to ABI3 / VP1), DREB (dehydration-responsive element binding protein), ERF (ethylene responsive factor), and soloist. The ERF and DREB subfamilies play crucial roles in rice's response to stress. To date, reports on the role of ERF and DREB subfamily members in rice stress resistance have primarily focused on disease resistance, drought resistance, and salt tolerance. For example, overexpression of OsEREBP1 (ethylene responsive element binding protein 1) can increase JA and ABA content, enhancing rice resistance to bacterial blight (Jisha et al., 2015); OsERF83 binds to the GCC-box to regulate downstream gene expression, improving rice blast resistance (Tezuka et al., 2019); and OsERF3 is a phosphorylation substrate of the receptor-like kinase GUDK (growth under drought kinase). Overexpression of GUDK and OsERF3 can reduce drought tolerance in rice. OsDERF1 (drought-responsive ERF genes) and OsERF109 can directly bind to the GCC-box or DRE elements in the OsERF3 promoter, activating its expression and negatively regulating drought resistance (Wan et al., 2011; Zhang et al., 2013).In salt stress research, OsSERF1 (salt-responsive ERF1) is a core positive regulator of salt stress response. When rice is exposed to salt stress, the MAP3K6-MKK4-MAPK5 pathway is activated, and the Ser 105 residue of the OsSERF1 protein is phosphorylated by MAPK5, enhancing its transcriptional activation activity and improving salt tolerance. Furthermore, OsSERF1 expression is induced by salt stress. OsSERF1 recognizes and binds to the A / GCCGAC motifs of MAP3K6 and MAPK5, directly activating target genes and its own expression, forming a feedback regulation mechanism (Schmidt et al., 2013). Overexpression of OsERF922 increases the concentration of Na in rice. + / K + The increased ratio leads to a weakening of rice tolerance to salt stress (Liu et al., 2012). However, the function and application of OsERF52 in rice response to low temperature have not been reported. Summary of the Invention

[0004] To address the above problems, the present invention discloses an application of rice OsERF52 protein and its encoding gene in improving plant low temperature tolerance, and provides a method for cultivating transgenic plants tolerant to low temperature stress, providing a theoretical basis for the study of the molecular mechanism of plant cold resistance and the cultivation of new drought-resistant varieties.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0006] In one aspect, the present invention provides a use of a rice OsERF52 protein and a gene encoding the same for improving plant low temperature tolerance. The amino acid sequence of the rice OsERF52 protein is shown in SEQ ID No. 2.

[0007] The present invention constructed an overexpression vector and mutants of the rice gene OsERF52. Overexpression-positive plants and mutant-positive plants were obtained by infecting rice callus with Agrobacterium. Four mutant transgenic lines and six overexpression transgenic lines with varying degrees of upregulated expression were obtained. Functional characterization revealed that the protein content of OsERF52 gradually increased with low-temperature treatment, indicating that OsERF52 responds to low-temperature stress at the protein level. Cold resistance analysis of the transgenic lines revealed that all Oserf52 mutants exhibited a cold-sensitive phenotype, with significantly lower survival rates than the wild type. In contrast, all overexpression plants exhibited a cold-resistant phenotype, and their survival rates were positively correlated with the upregulation of OsERF52 transcripts, indicating that OsERF52 is a positive regulator of rice's response to low temperatures.

[0008] The "rice OsERF52 protein" in the present invention includes a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2, and a protein with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2.

[0009] In one embodiment, the nucleotide sequence of the gene encoding the rice OsERF52 protein is shown as SEQ ID No. 1.

[0010] The present invention encompasses sequences having a similarity of 90% or more, preferably 95% or more, and more preferably 99% or more to the nucleotide sequence of SEQ ID No. 1 and having the same function. The present invention also encompasses sequences having one or more base substitutions, replacements, deletions, and / or additions to the nucleotide sequence of SEQ ID No. 1 and having the same function.

[0011] In another aspect, the present invention provides a use of a biological material comprising a gene encoding a rice OsERF52 protein for improving plant low temperature tolerance, wherein the biological material comprises:

[0012] (A) an expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID No. 1;

[0013] (B) a recombinant vector containing the expression cassette described in (A);

[0014] (C) a recombinant microorganism containing the expression cassette described in (A) or the recombinant vector described in (B);

[0015] (D) A recombinant cell containing the expression cassette described in (A) or the recombinant vector described in (B).

[0016] In one embodiment, the present invention comprises transgenic plants containing a gene encoding a rice OsERF52 protein. Such transgenic plants include seeds, callus tissue, whole plants, and cells. Such transgenic plants include not only first-generation transgenic plants obtained by transforming the gene into a target plant, but also progeny thereof.

[0017] In one embodiment, the recombinant vector is a recombinant expression vector, preferably an overexpression vector of the target gene (rice OsERF52 gene).

[0018] In one embodiment, the recombinant expression vector comprises a transcript that initiates transcription of the target gene. To achieve overexpression of the target gene, the promoters included in the recombinant expression vector include, but are not limited to, constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters.

[0019] In a preferred embodiment, the overexpression vector contains a Ubiquitin promoter or a CaMV 35S promoter; the nucleic acid molecule of the target gene is operably linked to the promoter.

[0020] In one embodiment, the recombinant expression vector comprises a suitable transcription terminator, including but not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, etc.

[0021] In one embodiment, the recombinant vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as but not limited to pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb vectors.

[0022] In one embodiment, the recombinant vector also includes a gene encoding an enzyme or luminescent compound that can produce color changes (GUS gene, luciferase gene, etc.) and an antibiotic marker gene (such as a gene that confers resistance to kanamycin and related antibiotics) to facilitate the identification and screening of transgenic plant cells or plants.

[0023] In one embodiment, the microorganism is Agrobacterium, preferably, the microorganism is Agrobacterium EHA105.

[0024] In one embodiment, the recombinant vector is Ubi-XX-3FLAG.

[0025] In one embodiment, the recombinant cell comprises an overexpression vector of the rice OsERF52 gene or an overexpression mutant of the rice OsERF52 gene.

[0026] In one embodiment, the application is to overexpress the rice OsERF52 protein or its encoding gene to improve the low temperature tolerance of the plant.

[0027] In another aspect, the present invention provides a method for cultivating transgenic plants tolerant to low temperature stress, wherein the expression level of the OsERF52 gene or the activity of the OsERF52 protein in the plant is increased by genetic engineering methods to obtain transgenic plants with improved low temperature tolerance.

[0028] In one embodiment, the method for increasing the expression level of the OsERF52 gene in the plant comprises introducing a gene encoding the OsERF52 protein into plant tissues or plant cells.

[0029] The present invention also provides a method for improving plant tolerance to low temperature stress, comprising: 1) constructing an expression vector containing the rice OsERF52 gene; 2) transforming the constructed expression vector into plants or plant cells; and 3) cultivating transgenic plants.

[0030] In the present invention, the expression vector can be introduced into plant cells by using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation and other conventional biotechnology methods; for example, it can be introduced into rice by infecting callus tissue.

[0031] In one embodiment, after the recombinant expression vector containing the target gene is infected with the target plant, positive plants are screened to obtain transgenic plants with enhanced cold resistance compared with normal plants.

[0032] In a specific embodiment, the improved cold resistance of the transgenic plants (introduced with the OsERF52 gene) is manifested as: the transgenic plants have higher cold resistance than non-transgenic plants (wild-type plants) or plants introduced with an empty vector that does not contain the target gene; in particular, the transgenic plants have a higher level of cold resistance, and their OsERF52 protein level is also higher under low temperature stress, and the survival rate of the transgenic plants is also higher than that of the wild type.

[0033] In one embodiment, the hosts transformed by the recombinant expression vector include various plants.

[0034] In one embodiment, the plant is a monocot or a dicot, including but not limited to Arabidopsis thaliana, rice, rapeseed, etc.

[0035] In a preferred embodiment, the plant is rice, preferably wild rice (Nipponbare).

[0036] The present invention has the following beneficial effects:

[0037] The present invention clarifies that the OsERF52 gene is an important gene for rice cold tolerance. This gene can respond to low temperature stress and play a positive regulatory role in rice cold resistance. The rice gene OsERF52 or its encoded protein can be used to improve plant stress resistance (cold resistance).

[0038] The present invention provides applications for enhancing or improving plant cold tolerance by increasing the expression of the OsERF52 gene, thereby producing plants with improved cold resistance. This approach has high application value and lays a foundation for research into breeding cold-tolerant transgenic plants. Cultivating cold-tolerant transgenic plants by overexpressing the rice OsERF52 protein or its encoding gene can improve plant survival rates in cold-stress environments, contributing to food security and sustainable agricultural development. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the mutation sites of four mutants of rice OsERF52 gene;

[0040] Figure 2 is the transcription level of rice OsERF52 in wild type and different overexpression transgenic lines;

[0041] Figure 3 is the protein level of OsERF52 in rice during low temperature treatment;

[0042] Figure 4 The results of the analysis of the rice Oserf52 mutant's reduced cold resistance and survival rate;

[0043] Figure 5 Analysis results of rice OsERF52 gene overexpression improving rice plant resistance to low temperature and survival rate. DETAILED DESCRIPTION

[0044] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. The following embodiments and features of the embodiments may be combined with each other unless there is a conflict.

[0045] The detailed description of the embodiments of the present invention provided below is not intended to limit the scope of the claimed invention, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.

[0046] In one embodiment, the present invention provides a use of rice OsERF52 protein or its encoding gene in improving plant drought tolerance, wherein the amino acid sequence of the rice OsERF52 protein is shown in SEQ ID No. 2; the nucleotide sequence of the gene encoding the rice OsERF52 protein is shown in SEQ ID No. 1.

[0047] ERF can specifically bind to GCC-box and / or DRE / CRT elements. It is by regulating the expression of related genes that ERF participates in the plant's salt resistance, drought resistance, cold resistance and other related biotic and abiotic stress processes. The plant's response to adversity is regulated by multiple signal pathways, which may promote or antagonize each other, thereby achieving adversity defense responses. At present, the functions of many ERF genes in rice are still unknown, and there are few research articles on the role of ERF transcription in rice drought resistance. In addition, plant drought resistance involves the participation of a large number of genes. Discovering and verifying more genes involved in plant drought resistance is of great significance for the research and cultivation of drought-resistant crop varieties. There is no literature report on the function of OsERF52 protein or its encoding gene in regulating rice cold resistance. The present invention proposes that the OsERF52 gene can improve the growth state of rice under low temperature conditions. Therefore, it can be used to cultivate transgenic plants that tolerate low temperature stress.

[0048] For genes that respond to cold stress at the protein level, whether they have transcriptional activation activity and what role they play in the cold stress response is unknown, requiring specific experiments to clarify the gene's function. This study used genetic engineering methods to study the expression characteristics of this gene and the phenotypic changes in mutant strains. The relationship between gene expression changes and crop phenotype and survival rate was analyzed, revealing that rice plants overexpressing the OsERF52 gene exhibited significantly greater cold tolerance than wild-type controls.

[0049] In another embodiment, the present invention provides a method for cultivating transgenic plants tolerant to low temperature stress, wherein the expression level of the OsERF52 gene or the activity of the OsERF52 protein in the plant is increased by genetic engineering methods to obtain transgenic plants with improved low temperature tolerance.

[0050] Under adverse stress, a series of responses will occur in plants, accompanied by many physiological, biochemical and developmental changes. Since plant stress tolerance is a complex trait regulated by multiple genes, clarifying the important genes in the stress resistance process is of great significance for the cold resistance mechanism and the cultivation of cold-resistant crops. The present invention illustrates that up-regulation of the OsERF52 gene improves the tolerance of transgenic rice to low temperatures, and the loss of OsERF52 expression reduces the cold resistance of rice. The OsERF52 protein and its encoding gene can enhance the tolerance of plants to adversity, indicating that the gene has application value in crop drought resistance modification and stable yield. The present invention has important theoretical and practical significance for improving and enhancing rice stress resistance and accelerating the process of stress resistance molecular breeding.

[0051] Definitions of terms used in this invention

[0052] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides, and polymers thereof, in single- or double-stranded form.

[0053] The term "transcription factor" refers to a class of DNA-binding proteins that can specifically bind to cis-acting elements in the promoter region of eukaryotic genes, thereby activating or inhibiting the transcription and expression of downstream genes at a specific time and space.

[0054] In the present invention, the term "identity" or "similarity" refers to sequence similarity to a natural nucleic acid sequence. Identity or similarity can be evaluated with the aid of computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0055] As used herein, the term "expression" or "gene expression" refers to the transcription of a specific gene, genes, or gene construct into structural RNA (rRNA, tRNA) or mRNA, with or without subsequent translation of the RNA into protein. This process includes transcription of DNA and processing of the resulting mRNA product.

[0056] In the present invention, the term "increased expression / overexpression" refers to any form of expression that is increased relative to the original wild-type expression level. Methods for increasing the expression of genes or gene products have been described in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers.

[0057] In the present invention, the terms "increase", "improve" or "enhance" are interchangeable and shall in the applied sense mean at least 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and / or growth and / or changes compared to control plants as defined herein.

[0058] In the present invention, the term "transformation" refers to a process by which a heterologous DNA sequence or a vector containing a DNA sequence is introduced into a host cell or organism.

[0059] In the present invention, the term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often called binary vectors in the art.

[0060] In the present invention, the term "operably linked" refers to a functional connection between two or more elements, and the operably linked elements may be contiguous or non-contiguous.

[0061] In the present invention, the term "host cell" or "recombinant host cell strain" refers to a cell comprising a polynucleotide of the present invention, regardless of the method used to insert the polynucleotide to produce the recombinant host cell. The host cell can be a prokaryotic cell or a eukaryotic cell, and the host cell can also be a monocotyledonous or dicotyledonous plant cell.

[0062] Example 1

[0063] Cloning of the OsERF52 gene nucleotide sequence

[0064] RNA was extracted from rice using an Omega plant extraction kit. First-strand cDNA was synthesized using 1 μg of RNA as a template according to the cDNA synthesis kit (Yeasen).

[0065] The complete ORF of OsERF52 was obtained from the website (http: / / rice.plantbiology.msu.edu / expression.shtml), and specific primers were designed: the 5' forward primer was ATGGACGCCAGCCTCCGC (5'-3' direction, SEQ ID No. 3); the 3' reverse primer was CTAGAAGTTAAGCATCTC (5'-3' direction, SEQ ID No. 4) for PCR amplification reaction.

[0066] The PCR reaction system was as follows: 25 μL of 2×Phanta Max Master Mix, 1 μL of each 10 μM forward / reverse primer, 5 μL of template (cDNA), and sterile water was added to make up to 50 μL.

[0067] The PCR reaction procedure was as follows: 36 cycles of pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 20 s, followed by a final extension at 72°C for 5 min. The resulting amplified OsERF52 cDNA sequence (822 bp, shown in SEQ ID No. 1) encoding 273 amino acids (shown in SEQ ID No. 2) was obtained.

[0068] Example 2

[0069] Construction of OsERF52 gene mutant and overexpression vector

[0070] The CRISPR / Cas9 genome editing system was used to edit the OsERF52 gene in wild-type rice (Nipponbare) to obtain mutant plants.

[0071] (1) The exon sequence of the target gene OsERF52 was analyzed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), and two specific target sequences were selected, namely target site 1 (Cas9-1) CAGCCTCCGCACACTGCCTC CGG (SEQ ID No. 5) and target site 2 (Cas9-2) GTAGTAGACGCTGGAGCCGAG CGG (SEQ ID No. 6).

[0072] (2) Specific sgRNA-1 (CAGCCTCCGCACACTGCCTC) (SEQ ID No. 11) and sgRNA-2 (GTAGTAGACGCTGGAGCCGAG) (SEQ ID No. 12) were synthesized, and the gene editing vector psgR-CAS9-Os was digested with BsaI.

[0073] (3) First anneal the primers. The annealing reaction system is:

[0074] Target site 1, 10 μL F(5'-TGTGTGCAGCCTCCGCACACTGCCTC-3') (SEQ ID No. 13) + 10 μL R(5'-AAACGAGGCAGTGTGCGGAGGCTGCA-3') (SEQ ID No. 14) + 80 μL ddH2O and mix well;

[0075] Target site 2, 10 μL F(5'-TGTGTGGTAGTAGACGCTGGAGCCGAG-3')(SEQ ID No. 15)+10 μL(5'-AAACCTCGGCTCCAGCGTCTACTACCA-3')(SEQ ID No. 16)+80 μL ddH2O and mix well.

[0076] After the reaction system was mixed, annealed at 95 °C for 10 min;

[0077] Then ligate with the enzyme-digested vector psgR-CAS9-Os. The ligation system is as follows: 2 μL annealing product (containing sgRNA) + 2 μL recovered enzyme-digested vector + 0.5 μL 10x T4 buffer + 0.5 μL T4 ligase, ligate at room temperature for 15 minutes, and obtain the psgR-CAS9-OsERF52 vector containing the OsERF52-specific target.

[0078] The psgR-CAS9-OsERF52 vector containing the OsERF52-specific target was transformed into the competent Escherichia coli DH5α. The transformation system was as follows: 5 μL of the ligation product was added to the competent Escherichia coli, incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, incubated on ice for 2 minutes, added with 400 μL of antibody-free LB, revived at 37°C for 1 hour, centrifuged at 5000 rpm for 1 minute, most of the supernatant was aspirated, and 100 μL of the liquid was retained for mixing. The mixture was spread on an LB plate (50 mg / L Kan) and cultured at 37°C overnight.

[0079] After the plasmids were extracted from the positive clones, they were sent to the company for sequencing. The psgR-CAS9-OsERF52 plasmid with the correct result was selected and the mutant plants were obtained by infecting rice callus with Agrobacterium.

[0080] To construct Ubi:OsERF52-3FLAG, the full-length PCR product (819 bp) of the target gene, excluding the stop codon, was amplified and purified using the Omega gel extraction kit. The recovered product was then ligated with the HindIII-digested vector Ubi-XX-3FLAG by homologous recombination. The reaction system consisted of 2 μL of linearized vector, 3 μL of insert, 4 μL of 5× Cell Buffer, 2 μL of Exnase II, and a final volume of 20 μL with sterile water. The reaction conditions were 37°C for 30 minutes. The ligation product was transformed into DH5α competent cells and cultured overnight at 37°C (for kanamycin resistance). Positive single clones were isolated the next day for sequencing.

[0081] Example 3

[0082] Construction of OsERF52 gene mutants and overexpressing plants

[0083] Wild-type Nipponbare callus was transformed with Agrobacterium.

[0084] The OsERF52 gene mutant vector and plant overexpression vector obtained in Example 2 were transformed into Agrobacterium tumefaciens EHA105. The Agrobacterium-mediated rice genetic transformation system was primarily based on the method reported by Hiei et al. (Agrobacterium-mediated transformation of rice using immature embryos or calligraphic extract from mature seeds, 2008, Nature protocol. Doi: 10.1038 / nprot.2008.46).

[0085] The expression of the target gene in wild-type and transgenic plants was detected by hygromycin screening and qRT-PCR, and overexpression-positive plants were preliminarily screened; for mutant-positive plants, gDNA of the T0 generation plants needed to be extracted, PCR identified and sequenced.

[0086] Identification of Oserf52 mutants: Genomic DNA from leaves of T0 transgenic plants was extracted and used as a template. Based on the OsERF52 target site information, specific primers F (CAAATCACCACAAGAATGCC; SEQ ID No. 7) and R (GCGTTGGCTCTTCTTGCT; SEQ ID No. 8) were designed for PCR amplification. A single, clear amplification product of the target band was recovered (the PCR amplification product of positive plants was 694 bp in size) and sent to the company for sequencing to screen for mutant lines. T0 generation plants were continuously self-pollinated to obtain T2 generation plants. T2 generation plants were again screened with hygromycin and identified by PCR to identify independent lines that were free of the vector and homozygous for the mutation.

[0087] like Figure 1 As shown, four mutant strains were finally obtained, named Oserf52-1, Oserf52-2, Oserf52-3, and Oserf52-4. Two mutations occurred at target sequence 1: Oserf52-1, which had an addition of one base (+C), and Oserf52-2, which had a deletion of two bases (-CC). Two mutations also occurred at target sequence 2: Oserf52-3, which had a deletion of one base (-C), and Oserf52-4, which had a deletion of 17 bases (-TAGACGCTGGAGCCGAG). All four mutants resulted in frameshift mutations in the encoded protein.

[0088] Identification of OsERF52 overexpressing plants: RNA extraction was carried out according to the instructions of the RNA plant extraction kit of Yeasen. RNA was extracted from 14-day-old wild-type and transgenic rice seedlings. 1 μg of RNA was used as a template and the first-strand cDNA was synthesized according to the operating instructions of the cDNA synthesis kit (Yeasen). Specific quantitative PCR primers were designed based on the OsERF52 gene cDNA (F is 5'-TCGTTCGATCCCGAGTTGATCTG-3', SEQ ID No. 9; R is 5'-GTTGGTTCGTGTCCATGGTTCG-3', SEQ ID No. 10). The expression of the OsERF52 gene in the wild-type and overexpressing transgenic lines was detected by qRT-PCR. The expression levels of #1, #4, #5, #13, #17 and #24, which were all upregulated and had different upregulation levels, were selected for the following experiments. Figure 2As shown, the abscissa represents the selected transgenic lines #1, #4, #5, #13, #17 and #24, and the ordinate represents the expression level of OsERF52.

[0089] Example 4

[0090] Functional characterization of OsERF52 mutants and overexpressing plants

[0091] 1. Western blot analysis of changes in OsERF52 protein levels during low temperature in rice

[0092] The OsERF52 gene quantitative PCR primers in Example 3 were used to detect the protein content of 2-week-old plants after low temperature treatment for different time periods. Figure 3 The results showed that the protein content of OsERF52 gradually increased with the low temperature treatment, indicating that OsERF52 responded to low temperature stress at the protein level.

[0093] 2. Analysis of cold tolerance of OsERF52 mutants and overexpressing plants

[0094] After germination of wild-type (Nipponbare), Oserf52 mutant, and Ubi:OsERF52 seeds at 37°C in the dark, each plant was planted in nutrient soil and then placed in the same plastic pot to ensure consistent water supply. After the plants grew for about 3 weeks, they were treated with low temperature for 3 to 5 days (depending on the degree of leaf curling) and then recovered. The phenotypes were observed and the survival rate was calculated. The results showed that the Oser52 mutants all showed a low-temperature sensitive phenotype, and the survival rate was significantly lower than that of the wild-type ( Figure 3 ); while the overexpressing plants all showed a cold-resistant phenotype, and the survival rate was positively correlated with the up-regulation level of OsERF52 transcripts ( Figure 4 These results indicate that OsERF52 is a positive regulator of low temperature response in rice.

[0095] From the above examples, it can be seen that the present invention clarifies that the OsERF52 gene is an important gene for rice cold tolerance. This gene can respond to low temperature stress and play a positive regulatory function in rice cold resistance. The rice gene OsERF52 or its encoded protein can be used to improve the stress resistance (cold resistance) of plants. In addition, the present invention provides an application in enhancing or improving the low temperature tolerance of plants by increasing the expression of the OsERF52 gene, thereby obtaining plants with improved cold resistance, which has high application value and lays the foundation for research on cultivating transgenic plants with cold tolerance. By overexpressing the rice OsERF52 protein or its encoding gene to cultivate transgenic plants that tolerate low temperature stress, the survival rate of plants in low temperature stress environments can be increased, which is beneficial to ensuring food security and achieving sustainable agricultural development.

[0096] Finally, it should be noted that the scope of protection of the present invention is not limited to the above embodiments. Ordinary technicians in this field should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents; and these modifications or replacements will fall within the scope of protection of the present invention.

Claims

1. A method for improving low temperature tolerance of rice, characterized in that: increasing the expression level of the OsERF52 gene in the rice by genetic engineering; The rice OsERF52 gene is a gene encoding rice OsERF52 protein; The amino acid sequence of the rice OsERF52 protein is shown in SEQ ID No.

2.

2. The method according to claim 1, characterized in that The genetic engineering method comprises introducing an overexpression vector containing the rice OsERF52 gene into rice cells.

3. The method according to claim 2, characterized in that The overexpression vector contains Ubiquitin promoter or CaMV 35S promoter.

Images