A heavy chain antibody variable region sequence, recombinant nanobodies against newcastle disease virus of genotype vi and methods of making and using the same

Abstract

A heavy chain antibody variable region sequence, a recombinant nanobody against newcastle disease virus of genotype VI and a preparation method and application thereof relate to the technical field of biotechnology.The present application screens a heavy chain antibody variable region sequence from a VHH phage library of immunized llama, clones the heavy chain antibody variable region sequence into a pPIC9K vector to construct a recombinant eukaryotic expression plasmid, transforms the recombinant eukaryotic expression plasmid into Pichia pastoris X-33 competent cells to screen a recombinant expression engineering strain, induces the screened recombinant expression engineering strain with methanol, and then sequentially collects supernatant, and purifies by affinity chromatography to obtain the recombinant nanobody against newcastle disease virus of genotype VI, which has a yield as high as 14.5 mg / L, a neutralization titer of 7 log2 on DF-1 cells, and a neutralization titer of 5 log2 on pigeon embryos, and has significant biological activity, and can be used for preparing a novel nanobody preparation for preventing and / or treating pigeon newcastle disease.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a heavy chain antibody variable region sequence, a recombinant nanobody against genotype VI Newcastle disease virus, its preparation method, and its application. Background Technology

[0002] Newcastle disease (ND) is an acute, highly contagious, and deadly infectious disease of poultry caused by a virulent strain of Newcastle disease virus (NDV). NDV currently has only one serotype, but based on genetic evolutionary analysis of the hypervariable region of the F gene, all strains can be divided into Class I and Class II. Class I can be further divided into three genotypes, while Class II can be divided into at least 25 genotypes. Molecular epidemiological studies indicate that the NDV currently circulating in pigeon flocks is predominantly genotype VI of Class II (Pan Qunxing, et al. Biological characteristics of Newcastle disease isolates from different host sources [J]. Jiangsu Journal of Agricultural Sciences, 2011, 27(6): 1325-1329).

[0003] Current research indicates that Newcastle disease in pigeons is primarily caused by infection with genotype VI NDV strains, exhibiting high morbidity and mortality rates, posing a significant threat to pigeon flocks. Currently, there is no specific treatment for Newcastle disease in pigeons. In practice, chicken Newcastle disease vaccines are commonly used to immunize pigeons, but their effectiveness is often unsatisfactory. Therefore, developing a safe, highly effective, and easily standardized biological treatment agent that matches the antigenicity of the prevalent strain in unimmunized pigeon flocks exhibiting atypical symptoms is of paramount importance. This is crucial for ensuring the sustainable and healthy development of the pigeon farming industry.

[0004] Nanobodies are minimal functional antigen-binding fragments composed of the variable region (VHH) of heavy chain antibodies. Due to their high affinity, high specificity, strong penetrability, and ease of modification and expression, they have shown great potential in the development of novel biological agents. Currently, research reports on nanobodies against Newcastle disease virus are very limited. Furthermore, recombinant nanobodies targeting genotype VI Newcastle disease virus have not been reported at all. Summary of the Invention

[0005] To fill the gap in recombinant nanobodies against genotype VI Newcastle disease virus, this invention provides a heavy chain antibody variable region sequence, a recombinant nanobodies against genotype VI Newcastle disease virus, their preparation methods, and applications.

[0006] The technical solution adopted by this invention to solve the technical problem is as follows:

[0007] The present invention provides a heavy chain antibody variable region sequence, the nucleotide sequence of which is SEQ ID NO:1 and the encoded amino acid sequence of which is SEQ ID NO:2.

[0008] Furthermore, the present invention also provides a method for screening a single heavy chain antibody variable region sequence, specifically including the following steps:

[0009] Inactivated antigen of pigeon-derived Newcastle disease virus type VI rVI-HZ strain was prepared and emulsified with mineral oil adjuvant in an equal proportion to obtain pigeon-derived Newcastle disease virus type VI rVI-HZ strain inactivated vaccine, which was injected subcutaneously into the neck of 3-year-old male alpacas. Peripheral blood was collected from alpacas when the ELISA titer of serum antibodies reached 1:20000. Lymphocytes were isolated, and their RNA was extracted and reverse transcribed into cDNA. The variable region sequence of the heavy chain antibody was amplified by two rounds of nested PCR. The first round primer sequences were CALL-1 (GT CCTGGCTGCTCTTCTACAAGG) and CALL-2 (GGTACGTGCTGTTGAACTGT). The second round of primer sequences were Sac1-VHH-F (GAGCTCATGGATGTGCAGCTGGT) and Spe1-VHH-R (ACTAGTTGAGGAGACGGTGACCT). The amplified heavy chain antibody variable region sequence and pComb3Xss plasmid were digested with restriction endonucleases Sac I and Spe I, then ligated with T4 ligase and transformed into E. coli TG1 competent cells. Single colonies were picked the next day for bacterial PCR. Pigeon-derived Newcastle disease virus type VI rVI-HZ strain was coated on an ELISA plate, and antibody library solid-phase screening technology was used to screen for heavy chain antibody variable region sequences that could bind to pigeon-derived Newcastle disease virus type VI rVI-HZ strain.

[0010] Furthermore, based on the aforementioned heavy chain antibody variable region sequence, this invention also provides a recombinant eukaryotic expression plasmid constructed from the aforementioned heavy chain antibody variable region sequence.

[0011] Furthermore, the present invention also provides a method for constructing the recombinant eukaryotic expression plasmid, specifically including the following steps:

[0012] The variable region sequence of the heavy chain antibody and the pPIC9K vector were digested with restriction endonucleases EcoRI and NotI, respectively, and then recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, single colonies were picked and sequenced. The correctly identified recombinant eukaryotic expression plasmid was named pPIC9K-NDV-Nb048 and stored at -20℃ for later use.

[0013] Based on the above-described recombinant eukaryotic expression plasmid, the present invention also provides a recombinant expression engineered strain constructed from the recombinant eukaryotic expression plasmid.

[0014] Furthermore, the nucleotide sequence of the recombinant expression engineered strain is shown in SEQ ID NO:3.

[0015] Furthermore, the present invention also provides a method for constructing the recombinant expression engineered strain, specifically including the following steps:

[0016] The recombinant eukaryotic expression plasmid was linearized using the restriction endonuclease Sal I. The linearized recombinant eukaryotic expression plasmid was added to Pichia pastoris X-33 competent cells, mixed, and transferred to a pre-cooled electroporation cuvette. After electroporation, pre-cooled sorbitol was added, and the cells were transferred to centrifuge tubes and incubated statically at room temperature. The cells were then collected by centrifugation and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin and incubated at 37°C for 3 days. Single colonies were picked for PCR identification. After successful identification, the recombinant expression engineered strain was obtained.

[0017] Based on the aforementioned recombinant expression engineered strain, the present invention also provides a recombinant nanobody against Newcastle disease virus genotype VI prepared from the aforementioned recombinant expression engineered strain.

[0018] Furthermore, the present invention also provides a method for preparing the recombinant nanobody against genotype VI Newcastle disease virus, specifically including the following steps:

[0019] The recombinant expression strain was inoculated into YPG medium for rejuvenation. The next day, it was inoculated into a shake flask containing YPG medium and cultured overnight at 25-30℃ and 180-220 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. The cells were induced for 100-140 hours at 25-30℃ and 180-220 r / min. Methanol was added every 24 hours, and the supernatant was collected and purified to obtain the recombinant protein. The relative molecular mass of the recombinant protein was 15.5 kDa, consistent with the expected size. This recombinant protein is the recombinant nanobody NDV-Nb048.

[0020] Finally, the present invention also provides the use of the recombinant nanobody against genotype VI Newcastle disease virus in the preparation of nanobody formulations for the prevention and / or treatment of Newcastle disease in pigeons.

[0021] The beneficial effects of this invention are:

[0022] This invention screened a heavy chain antibody variable region (VHH) sequence from a VHH phage library of immunized alpacas. The VHH sequence was directionally cloned into the pPIC9K vector to construct a recombinant eukaryotic expression plasmid. The constructed recombinant eukaryotic expression plasmid was transformed into Pichia pastoris X-33 competent cells to screen for recombinant expression engineered strains. The screened recombinant expression engineered strains were induced with methanol, and after supernatant collection and affinity chromatography purification, recombinant nanobodies against Newcastle disease virus genotype VI were obtained.

[0023] The recombinant nanobody against Newcastle disease virus genotype VI prepared by this invention has a neutralizing titer of 7 log2 on DF-1 cells and 5 log2 on pigeon embryos, exhibiting significant biological activity. It can be used to prepare novel nanobody formulations for the prevention and / or treatment of Newcastle disease in pigeons.

[0024] The recombinant nanobody against genotype VI Newcastle disease virus prepared by this invention has a yield of up to 14.5 mg / L. Furthermore, the preparation method of the recombinant nanobody against genotype VI Newcastle disease virus is simple to operate, can ensure the yield and activity of the recombinant nanobody, has high production safety, and is suitable for large-scale production.

[0025] The recombinant nanobody against Newcastle disease virus type VI prepared in this invention has an immunogenic antigen that is the currently prevalent pigeon Newcastle disease virus type VI rVI-HZ strain, thus exhibiting higher binding compatibility with the currently prevalent virus strain. Attached Figure Description

[0026] Figure 1 The results are PCR identification results of the immune alpaca VHH phage library constructed in Example 2.

[0027] Figure 2 The ELISA detection results (OD) of the heavy chain antibody variable region (VHH) sequence screened in Example 3. 450nm ).

[0028] Figure 3 This is a map of the recombinant eukaryotic expression plasmid (pPIC9K-NDV-Nb048) constructed in Example 4.

[0029] Figure 4 The results are PCR identification of the recombinant expression engineered strain in Example 5.

[0030] Figure 5 The SDS-PAGE identification results of the recombinant nanobody NDV-Nb048 obtained in Example 6 are shown.

[0031] Figure 6The Western blot identification results are for the recombinant nanobody NDV-Nb048 obtained in Example 6. Detailed Implementation

[0032] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0033] Source of materials:

[0034] The pigeon-derived Newcastle disease virus type VI rVI-HZ strain was deposited on December 10, 2020, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province (Wuhan University Collection Center), with accession number CCTCC NO: V202083.

[0035] 9-day-old SPF chicken embryos were purchased from Nanjing Tianbang Biotechnology Co., Ltd.

[0036] The BCA protein quantification kit was purchased from Thermo Fisher Scientific.

[0037] BEI was purchased from Sigma and its full name is diethyleneimine.

[0038] The 3-year-old male alpaca was purchased from Haoke Farm in Jiaxiang County.

[0039] Camel peripheral blood lymphocyte separation fluid was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0040] The RNA extraction kit and reverse transcription kit were purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0041] pComb3Xss plasmid was purchased from Nanjing Yifeixue Biotechnology Co., Ltd.

[0042] Restriction endonucleases Sac I and Spe I were purchased from BioNTech Biotechnology (Beijing) Co., Ltd.

[0043] T4 ligase was purchased from Baori Biotechnology (Beijing) Co., Ltd.

[0044] Escherichia coli TG1 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0045] The pPIC9K carrier was purchased from Thermo Fisher Scientific (China) Co., Ltd.

[0046] Restriction endonucleases EcoRI and NotI were purchased from BioNTech Biotechnology (Beijing) Co., Ltd.

[0047] Escherichia coli DH5α competent cells were purchased from Baori Biotechnology (Beijing) Co., Ltd.

[0048] Pichia pastoris X-33 competent cells were purchased from Changsha Aikebo Biotechnology Co., Ltd.

[0049] The electroporation device was purchased from Bio-Rad Life Sciences (Shanghai) Co., Ltd.

[0050] Sorbitol was purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0051] Bleomycin (Zeocin) was purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0052] YPG culture medium was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0053] BMMY liquid culture medium was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0054] The affinity chromatography column was purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0055] DF-1 cells were purchased from ATCC, Inc., USA.

[0056] Example 1: Preparation of inactivated antigen of pigeon-derived Newcastle disease virus type VI rVI-HZ strain

[0057] Pigeon-derived Newcastle disease virus type VI rVI-HZ strain was inoculated into 9-day-old SPF chicken embryos. Allantoic fluid was collected 48 hours later, centrifuged at 8000 rpm for 30 minutes, and the supernatant was collected. Purification was performed using PEG precipitation and a discontinuous sucrose density gradient method. Virus concentration was determined using a BCA protein quantification kit and stored at -70℃ for later use. BEI inactivation agent was added to a final concentration of 0.5%, and after 24 hours of inactivation testing, the solution was collected and inoculated into cells. Cells were observed for cytopathic effects after 96 hours. This process was repeated three times; successful inactivation was confirmed if no cytopathic effects were observed. The inactivated virus was then stored at -70℃ for later use.

[0058] Example 2: Construction of an immunized alpaca VHH phage library

[0059] According to Appendix 343 of the "Quality Standards for Veterinary Biological Products of the People's Republic of China", pigeon-derived Newcastle disease virus type VI rVI-HZ strain inactivated antigen was emulsified with mineral oil adjuvant in an equal proportion to obtain pigeon-derived Newcastle disease virus type VI rVI-HZ strain inactivated vaccine. The pigeon-derived Newcastle disease virus type VI rVI-HZ strain inactivated vaccine was injected subcutaneously into the neck of 3-year-old male alpacas (3 mL / alpaca). Booster immunizations were administered on days 14, 28, 42, and 56 post-immunization. Serum antibody titers were then measured. Peripheral blood was collected from alpacas when the ELISA titer reached 1:20000. Lymphocytes were separated using camel peripheral blood lymphocyte separation fluid, and RNA was extracted and reverse transcribed into cDNA using RNA extraction and reverse transcription kits. The heavy chain antibody variable region (VHH) sequence of the alpaca antibody was then amplified by two rounds of nested PCR. The first round primer sequence was CALL-1(GTCCTGGCTGCTCTTCTACAA). The primer sequences for the first round of primers were GG and CALL-2 (GGTACGTGCTGTTGAACTGTTCC), and the second-round primer sequences were Sac1-VHH-F (GAGCTCATGGATGTGCAGCTGGT) and Spe1-VHH-R (ACTAGTT GAGGAGACGGTGACCT). All of the above primers were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0060] The amplified heavy chain antibody variable region (VHH) sequence and pComb3Xss plasmid were digested with restriction endonucleases Sac I and Spe I, then ligated with T4 ligase and transformed into E. coli TG1 competent cells. The next day, 23 single colonies were picked and subjected to bacterial PCR.

[0061] PCR identification results as follows Figure 1 As shown, all 23 obtained single colonies were positive, and sequencing results revealed that these sequences were all distinct. This indicates that the VHH phage library achieved a 100% positive rate (23 / 23) and rich diversity (23 / 23), successfully constructing an immune alpaca VHH phage library. Based on plate counts and dilution ratios, the library size of the constructed immune alpaca VHH phage library is calculated to be 2.5 × 10⁻⁶. 8 indivual.

[0062] Example 3: Screening of heavy chain antibody variable region (VHH) sequences

[0063] The pigeon-derived Newcastle disease virus type VI rVI-HZ strain was coated onto an ELISA plate, and the variable region (VHH) sequence of the heavy chain antibody that can bind to the pigeon-derived Newcastle disease virus type VI rVI-HZ strain was screened using existing antibody library solid-phase screening technology.

[0064] ELISA test results as follows Figure 2 As shown, a total of 37 heavy chain antibody variable region (VHH) sequences were screened. Among them, sequence Nb048 had the highest OD value. Its nucleotide sequence is shown in SEQ ID NO:1, and the encoded amino acid sequence is shown in SEQ ID NO:2.

[0065] Example 4: Construction and Identification of Recombinant Eukaryotic Expression Plasmid (pPIC9K-NDV-Nb048)

[0066] See Figure 3 As described, the variable region (VHH) sequence of the heavy chain antibody screened in Example 3, namely sequence Nb048, and the pPIC9K vector were digested with restriction endonucleases EcoRI and NotI, respectively, and then recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, a single colony was picked, and the correctly identified recombinant eukaryotic expression plasmid was named pPIC9K-NDV-Nb048 and stored at -20℃ for later use.

[0067] Example 5 Construction of recombinant expression engineered strains

[0068] The recombinant eukaryotic expression plasmid pPIC9K-NDV-Nb048 was linearized using the restriction endonuclease Sal I. The linearized recombinant eukaryotic expression plasmid pPIC9K-NDV-Nb048 was added to Pichia pastoris X-33 competent cells, gently mixed, and transferred to a pre-chilled electroporation cuvette. After incubation on ice for 5 minutes, the cells were transferred to an electroporator for electroporation (voltage 1.5 kV, resistance 250 Ω, capacitance 25 μF). Immediately after electroporation, 1 mL of pre-chilled sorbitol (1 M) was added, and the mixture was pipetted twice and transferred to a 1.5 mL centrifuge tube. The cells were incubated statically at 30 °C for 1 h, followed by centrifugation at 4000 r / min for 4 minutes at room temperature. The cells were collected and resuspended in 100 μL YPG medium. The cells were then plated onto YPG solid medium containing bleomycin (100 μg / mL) and incubated at 37 °C for 3 days. Single colonies were picked for PCR identification.

[0069] PCR identification results as follows Figure 4 As shown, the length of a single colony is 384 bp, which is consistent with the expected size. After being identified as correct, the recombinant expression engineered strain was obtained, and its nucleotide sequence is shown in SEQ ID NO:3.

[0070] Example 6: Preparation of recombinant nanobody (NDV-Nb048)

[0071] First, the recombinant expression strain was inoculated into 20 mL of LYPG medium for rejuvenation. The next day, 5 mL of the inoculated strain was transferred to a 1 L shake flask containing 250 mL of LYPG medium and cultured overnight at 28°C and 200 rpm. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. The cells were induced at 28°C and 200 rpm for 120 hours, with methanol added every 24 hours to a final concentration of 0.5%. The supernatant was collected and purified according to the affinity chromatography column instructions to obtain the recombinant protein. The relative molecular mass and purity of the obtained recombinant protein were analyzed by SDS-PAGE and Western blot methods, respectively.

[0072] SDS-PAGE identification results are as follows: Figure 5 As shown, the Western blot identification results are as follows: Figure 6 As shown. The relative molecular mass of the obtained recombinant protein is 15.5 kDa, consistent with the expected size, indicating that the recombinant protein is the recombinant nanobody NDV-Nb048, with a concentration of 0.733 mg / mL and a purity of over 90%.

[0073] Example 7: Neutralization Activity Detection of Recombinant Nanobody (NDV-Nb048)

[0074] DF-1 cells were digested according to the fixed virus dilution antibody method and then seeded into 96-well cell plates; 2-fold serially diluted recombinant nanobody NDV-Nb048 was mixed with an equal volume of pigeon genotype VI Newcastle disease virus rVI-HZ strain suspension (containing 200 TCID50). 50 After thorough mixing and incubation at 37°C for 1 hour, a suspension of virus and antibody was obtained. This suspension was then inoculated into 96-well cell culture plates (0.1 ml per well), with virus and normal cell controls included. The plates were incubated at 37°C with 5% CO2, and the results were observed. Simultaneously, the virus and antibody suspension was inoculated into the allantoic cavity of 9-day-old pigeon embryos (0.1 ml per embryo), and incubated at 39°C. After 5 days, the allantoic fluid was collected, and the hemagglutination titer was determined using the hemagglutination method. The neutralizing efficacy of the recombinant nanobody NDV-Nb048 was defined as the maximum antibody dilution corresponding to a titer lower than 2 log2. The results showed that the neutralizing titer of the recombinant nanobody NDV-Nb048 was 7 log2 in DF-1 cells and 5 log2 in pigeon embryos, a first-time report.

[0075] This invention discloses a heavy chain antibody variable region sequence, a recombinant nanobody against genotype VI Newcastle disease virus, its preparation method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0076]

[0077]

[0078]

[0079]

[0080]

Claims

1. A recombinant nanobody against Newcastle disease virus genotype VI, characterized in that, The nucleotide sequence of the recombinant nanobody is SEQ ID NO:1, and the encoded amino acid sequence is SEQ ID NO:

2.

2. A recombinant eukaryotic expression plasmid for expressing the recombinant nanobody against Newcastle disease virus type VI as described in claim 1.

3. The method for constructing recombinant eukaryotic expression plasmids as described in claim 2, characterized in that, Includes the following steps: The nucleotide sequence shown in SEQ ID NO:1 and the pPIC9K vector were digested with restriction endonucleases EcoRI and NotI, respectively, and then recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, a single colony was picked and sequenced. The correctly identified recombinant eukaryotic expression plasmid was named pPIC9K-NDV-Nb048 and stored at -20℃ for later use.

4. A recombinant expression engineered strain constructed from the recombinant eukaryotic expression plasmid as described in claim 2.

5. The recombinant expression engineered strain according to claim 4, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

3.

6. The method for constructing the recombinant expression engineered strain as described in claim 4 or 5, characterized in that, Includes the following steps: The recombinant eukaryotic expression plasmid described in claim 2 was linearized using the restriction endonuclease Sal I. The linearized recombinant eukaryotic expression plasmid was added to Pichia pastoris X-33 competent cells, mixed, and transferred to a pre-cooled electroporation cuvette. After electroporation, pre-cooled sorbitol was added, and the cells were transferred to centrifuge tubes and incubated statically in an incubator. The cells were collected by centrifugation at room temperature and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin and incubated at 37°C for 3 days. Single colonies were picked for PCR identification. After successful identification, the recombinant expression engineered strain was obtained.

7. The method for preparing recombinant nanobodies against Newcastle disease virus genotype VI as described in claim 1, characterized in that, Includes the following steps: The recombinant expression engineered strain described in claim 4 or 5 was inoculated into YPG culture medium for rejuvenation. The next day, it was inoculated into a shake flask containing YPG culture medium and cultured overnight at 25-30°C and 180-220 r / min. The bacterial cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. The cells were induced for 100-140 hours at 25-30°C and 180-220 r / min. Methanol was added every 24 hours, and the supernatant was collected and purified to obtain the recombinant protein. The relative molecular mass of the recombinant protein was 15.5 kDa, which was consistent with the expected size. This recombinant protein is the recombinant nanobody NDV-Nb048.

8. Use of the recombinant nanobody against genotype VI Newcastle disease virus as described in claim 1 in the preparation of a medicament for the prevention and / or treatment of Newcastle disease in pigeons.

Images