Linked molecular marker of peanut hypocotyl elongation related gene locus, identification method and application of linked molecular marker

By developing the InDel molecular marker C2-15 related to peanut hypocotyl elongation, combined with PCR amplification and polyacrylamide gel electrophoresis detection, the problem of identification of peanut hypocotyl elongation traits was solved, rapid identification and improvement in peanut breeding was achieved, and the efficiency of flower production and plant type improvement was improved.

CN120272640APending Publication Date: 2025-07-08QINGDAO AGRI UNIV +1
View PDF 0 Cites 3 Cited by

Patent Information

Application Number
CN202510686115.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-02-19
Filing Date
2025-05-27
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art has failed to effectively develop molecular markers with tightly linked elongation traits of peanut hypocotyl, making it difficult to achieve the identification and improvement of elongation traits of peanut breeding.

Method used

A InDel molecular marker C2-15 related to peanut hypocotyl elongation was developed. By detecting the polymorphisms of peanut hypocotyl elongation-related gene loci, the elongation traits of peanut hypocotyl elongation was achieved quickly and accurately identifying peanut hypocotyl elongation traits.

Benefits of technology

The rapid and accurate identification of peanut hypocotyl elongation traits is achieved, the breeding process is simplified, and the efficiency of peanut yield and plant type improvement is improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005420621350000081
    Figure BDA0005420621350000081
  • Figure BDA0005420621350000091
    Figure BDA0005420621350000091
  • Figure HDA0005420621360000011
    Figure HDA0005420621360000011
Patent Text Reader

Abstract

The invention belongs to the technical field of crop genetic breeding, and relates to a linked molecular marker of a peanut hypocotyl elongation related gene locus, an identification method and application of the linked molecular marker. The primer pair is C2-15-F / R, and the sequence of the primer pair is as shown in SEQ ID NO. 1 and SEQ ID NO. 2; by designing an InDel marker C2-15, the peanut hypocotyl length character can be quickly distinguished by using a primer to amplify a target band and using polyacrylamide gel electrophoresis detection. The identification method is more accurate and convenient, has good repeatability, can efficiently distinguish the phenotype and genotype of an individual, shortens the experiment process, has the advantages of simple and feasible operation steps and the like, and saves expenditure. The method disclosed by the invention has important application value in the breeding work aspects such as peanut hypocotyl elongation character related gene positioning, genotype typing and later cultivation of excellent peanut varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field:

[0001] The present invention belongs to the technical field of crop genetic breeding, and particularly relates to a linkage molecular marker C2-15 related to peanut hypocotyl elongation, an identification method thereof, and an application thereof. Background Art:

[0002] Peanut (Arachis hypogaea L.) is an important economic and oil crop in China, and its total output has exceeded that of soybean, ranking first among oil crops in China. With the development of the peanut industry in China, the demand for peanuts has increased, and it is crucial to optimize the plant type and increase the yield per unit area. The hypocotyl is the initial stem connecting the cotyledons and the primary radicle, and its elongation is an important seedling trait of peanuts, which is closely related to the plant type and yield of peanuts. After germination, dicotyledonous plants rely on hypocotyl elongation to break through the soil to achieve photosynthetic autotrophy. The elongation speed and length of the hypocotyl are related to emergence and seedling vigor, and then affect traits such as lateral branch development, flowering, and fruiting, and thus affect the yield. The elongation of the hypocotyl responds to external signals such as light, temperature, and plant hormones. After the peanut seeds break through the soil and are exposed to light, the hypocotyl no longer elongates. The lateral branches produced at the first cotyledon node of peanuts bloom and peg down earliest and produce the most fruits, accounting for more than 60% of the whole plant. When sown deeply, the first cotyledon of peanuts remains in the soil, which may cause the growth of the first pair of lateral branches to be blocked, and in severe cases, they may not grow at all; when sown shallowly, if the soil moisture is insufficient, the yield will be greatly reduced. In addition, peanut hypocotyls can be used for edible peanut sprouts, which have high nutritional value and good economic benefits, and the market demand is increasing continuously. It is an important direction for the sustainable development of the peanut industry chain. The trait of hypocotyl elongation has been paid more and more attention in crop breeding, cultivation, and the peanut sprout industry. Therefore, exploring the genes controlling peanut hypocotyl elongation is an effective way to improve peanut yield, variety improvement, and promote the development of peanut sprouts.

[0003] The elongation of plant hypocotyls is affected by various environmental factors, endogenous hormones and other factors, and is also regulated by a complex gene network and signals. Environmental factors mainly include light and temperature. The mechanisms of regulating hypocotyl cell elongation by light intensity and light quality are similar. It is mainly through photoreceptors PHYA, PHYB, CRY1 and CRY2 to regulate PIFs, and then affect the expression of downstream genes, so as to achieve the regulation of hypocotyl elongation. And HY5 (ELONGATED HYPOCOTYL 5) is a basic domain / leucine zipper (bZIP) transcription factor, which has the function of inhibiting hypocotyl growth and promoting photomorphogenesis. The temperature regulation mechanism also mainly depends on PHYB. High temperature promotes the transformation of PHYB in the nucleus from Pfr (physiologically active form) to Pr (physiologically inactive form), and migrates to the cytoplasm, thus relieving its inhibition on PIFs and COP1-SPA, and inducing the elongation of hypocotyl cells. Plant hormones such as gibberellin, auxin, ethylene, strigolactone, jasmonic acid, abscisic acid, brassinolide, etc. all participate in the regulation of hypocotyl elongation. On the basis of molecular biology, regulatory genes in various signaling pathways related to hypocotyl elongation have been identified in many plant species, and a series of molecular markers related to hypocotyl elongation have been developed. Hypocotyl elongation belongs to a quantitative trait and is controlled by multiple genes. Using molecular markers for linkage analysis is an important means in the screening and identification of gene loci related to hypocotyl elongation.

[0004] At present, methods for developing various molecular markers such as Indel, SNP, SSR, etc. have been widely used in gene identification and typing, molecular marker-assisted selection breeding, etc. related to the hypocotyl elongation trait of crops such as cucumber (Cucumis sativus L.), Arabidopsis thaliana L., and melon (Cucumis melo L.). However, there is no research report on the development of molecular markers closely linked to the hypocotyl elongation trait of peanut. Summary of the invention:

[0005] The purpose of the present invention is to provide an InDel molecular marker C2-15 for identifying genes related to peanut hypocotyl elongation, an identification method and its application. By detecting the genotype of molecular markers linked to the gene locus related to peanut hypocotyl elongation, marker-assisted selection is carried out on the hypocotyl elongation allele locus and traits of offspring individuals. The operation is simple and easy, and the cost is low. This invention is convenient for genotyping, mapping and cloning of genes related to peanut hypocotyl elongation, helps to accelerate the breeding process, and assists in improving and cultivating peanut plant types related to the hypocotyl elongation trait, thereby increasing the peanut yield per unit area.

[0006] The technical solution adopted by the present invention is:

[0007] The present invention provides a linked molecular marker C2-15 related to peanut hypocotyl elongation. This molecular marker C2-15 is located at the 6,150,737th base of chromosome No. 02 of peanut. The sequence within the 2 kb range of the long-hypocotyl peanut variety SLZ corresponding to it is as shown in SEQ ID NO.3, and the sequence within the 2 kb range of the short-hypocotyl peanut variety MJX 5 corresponding to it is as shown in SEQ ID NO.4. There is polymorphism between the sequences of the long-hypocotyl peanut variety SLZ and the short-hypocotyl peanut variety MJX 5 at the molecular marker locus. SLZ inserted an 18-bp sequence (CATGGTTCACGAGCTGGA) at the 6,150,737 locus of chromosome No. 02.

[0008] The present invention also provides a primer pair for amplifying the linked molecular marker C2-15 related to the peanut hypocotyl elongation gene. The primer pair for this marker C2-15 is C2-15-F / R, and the sequences are as shown in SEQ ID NO.1 and SEQ ID NO.2:

[0009] C2-15-F: 5`-TGGTTAATTAATAGTCAAATGTTTTGG-3` (SEQ ID No.1),

[0010] C2-15-R: 5`-CCAAACTAATTGTGGAGTCCC-3` (SEQ ID No.2).

[0011] SEQ ID NO.3:

[0012] CTAACAAGAATACATCCCTCCAGAACTGGCAAATCGAGGATGAAGTTCGTATTCCAAA

[0013] GATTGTTGCGCACAATTCGAGCAATGACTGTCATTGCAGTAGTGAATGTTCCTCTTTAC

[0014] ATGATGCTCCTATTCAAGGATTGGGATTGATAAACAAAAGACGAAAAATTCTCATTGA

[0015] AGAGGTAGAATTTTGTAGATCCAGTGAGATAGTTTAAGTGTGTAAATGCCAAAAGTCT

[0016] ATGGTAGATGAGTTTGTAAATCTAACTATTGTTCATGTCATTTGCAGAGTACCTTAAAA

[0017] GTTCAACATATTTGCTAAAAGAAAAAAGCTTGATTTTCAATCTGGGTGTTGAGTATCAT

[0018] TTTGTACTATATCTAACTAGAATGTGCCTTATAAAGGGGATTGAATTTTGGAATTTCTA

[0019] TATTGCATTATTGTGCAAATTCTTAGAAAACAAAATATGCCAATAATTGAACTAGAAA

[0020] GTTACTACATTACTATTTTGCACAAATCACCTAGACAATATTAAGAAAAAGAAAATAA

[0021] AAATAGCCTCAAAAAGCATATGCTTGATGTCTGTATTTTATTCCACTGGTGCACAGACT

[0022]

[0023] SEQ ID NO.4:

[0024] GTACAATACAAAATGAGTACCTGAAACATTTCTCCTACAAATCGACAACGGTGTTACC

[0025] TTACCTTACCATTAATCTTGGCATTTTCCTTATGCATTATTTTTTTGCTATCAGGGGCAA

[0026] TGCTGTAATGAGACCAACTGCTAGAAAGAATGCAGCTCAGGAAGCAGATCTATCTGTG

[0027] AATGTGGGGATGATTTCAGGCACTGCTGTTGATCCTCTAACAAGAATACATCCCTCCAG

[0028] AACTGGCAAATCGAGGATGAAGTTCGTATTCCAAAGATTGTTGCGCACAATTCGAGCA

[0029] ATGACTGTCATTGCAGTAGTGAATGTTCCTCTTTACATGATGCTCCTATTCAAGGATTG

[0030] GGATTGATAAACAAAAGACGAAAAATTCTCATTGAAGAGGTAGAATTTTGTAGATCCA

[0031] GTGAGATAGTTTAAGTGTGTAAATGCCAAAAGTCTATGGTAGATGAGTTTGTAAATCT

[0032] AACTATTGTTCATGTCATTTGCAGAGTACCTTAAAAGTTCAACATATTTGCTAAAAGAA

[0033] AAAAGCTTGATTTTCAATCTGGGTGTTGAGTATCATTTTGTACTATATCTAACTAGAAT

[0034] GTGCCTTATAAAGGGGATTGAATTTTGGAATTTCTATATTGCATTATTGTGCAAATTCTT

[0035] AGAAAACAAAATATGCCAATAATTGAACTAGAAAGTTACTACATTACTATTTTGCACA

[0036] AATCACCTAGACAATATTAAGAAAAAGAAAATAAAAATAGCCTCAAAAAGCATATGC

[0037] TTGATGTCTGTATTTTATTCCACTGGTGCACAGACTCAGATTGCGAATTTTGTTTTTATA

[0038] TTATTGTTAATATCTTTAAAATTTATGGTTAATTAATAGTCAAATGTTTTGGTATACTTT

[0039] CAATCTGCCAGGGGTGATATCTGTAAGGGACTCCACAATTAGTTTGGGTCCGAGTAGT

[0040] ATAAATATTAGGATTAGACAGCACACCTTTGGGTGAATGTTTTTCGATACTTTTTGTTC

[0041] AACATTATCTTTTTTGAAAAGTTTTTCTAGATGTGGACGGAGACTTTTTTCTAATCTTTT

[0042] CCGATCTCGAGTTAGATGGTCCGATCTCGAGTTAGATGGGGATTGGTATTTGCAAGGC

[0043] ACTTCGACGATAAAGTTAGTCTATATTTAAAAGTCATAGGGACTAGAGTTGCATAGCA

[0044] TATCTTTGGTGGACTCTTCACTTAATATTTACATGTGCCCTGATTGGTTTGGGAGGGAA

[0045] TCTTTAACAGATTCTAGCTGAATTTGGCAGGATATGATTTGATTCTGGTATAGTGGCAT

[0046] ATGTGATTAAAATGACAAGAGAAGACTTATTGTGAAAGCATGCCTCAGGCACTGACAC

[0047] TAAGTCATGCTTTTGATTAAGCTGTCTGAGCAATGGAAGATCTTGTGATGACAAAGAA

[0048] CATATGGACCAAGATATATGCTTGCCATTTTTAAGCCAAGCTAGCAATATTAATGGTGA

[0049] CTTGAATTGAATTGAACTTACATTTGTGTTGTCCAATCAAATCCCTTAGTCAAACATTC

[0050] CATGATCCTTACACTTAATGTTGTCAAGTCAATGGTGCCTTCACTCACCATCTAATCAT

[0051] GTTTATTTATTGGAACAAATCTCATTTTATTAAGAACTTATTAGCTTCTACTATTAATTT

[0052] ACTACTATACTAGAGGCTTGTGAAACCCCATCAAATATGCAATTAAGATTTAACCTATA

[0053] GTTGAGTGCTTATCTCATGCCTATCTTGTTTGAGCTTAAAAGTCTTTGTGAAAGTAAATT

[0054] TTTTCTTTTTAAGTCTTAACATACTTCCTAATTTAATTTGCTTAAAACAATTCAAGACTT

[0055] AGCCCTATTCAACAAGGTGTCAAGTTGGAATCTCCAAAGATTAGAAGAAGAAGTTATA

[0056] ACTTCGTGGTTATAACTTAACTTCTCATCTTATCTTTTAAATATAAATTCAGGAGTTTGAATTTTATCTTGACTTTGAAAATATTTTGTTGTTAGTCATTTATTTTTAAGTAGATAAT。

[0057] The present invention also provides a method for identifying the peanut hypocotyl elongation trait. DNA of the peanut material to be identified is extracted, and PCR amplification is performed on the DNA using the primer pair of molecular marker C2-15. The determination is made by comparing the band results, which specifically includes the following steps:

[0058] S1: Extract the DNA of the peanut leaves to be tested using a plant genomic DNA extraction kit (Aikerui Biology);

[0059] S2: Perform PCR amplification on the extracted DNA using the specific primer pair C2-15-F / R of marker C2-15. The specific amplification method is as follows:

[0060] (1) The total volume of PCR amplification is 10 μL: 2 μL of DNA template at 50 - 150 ng / μL, 1 μL of each primer pair at 10 μM, 5 μL of 2×TaqAccurate Buffer, and 1 μL of RNase free water;

[0061] (2) PCR amplification reaction conditions: Pre-denaturation at 98°C for 7 min; 98°C for 30 s, 59°C for 30 s, 72°C for 1 min, for 34 cycles; extension at 72°C for 5 min, cooling at 4°C for 10 min;

[0062] S3: Detect the amplification product obtained in step S2 by 8% non-denaturing polyacrylamide gel electrophoresis. When electrophoresis, add 1 - 1.5 μL of the PCR amplification product, and perform electrophoresis for 75 min (150 V, 250 mA, 260 W). After silver staining and developing, take a photo for standby. The specific silver staining steps are as follows:

[0063] (1) Rinsing: Rinse with distilled water 2 - 3 times, 30 s each time;

[0064] (2) Fixing: Add 300 ml + 30 ml ethanol + 1.5 ml glacial acetic acid, for 10 min;

[0065] (3) Penetration: Add 300 ml + 0.6 g silver nitrate, soak for 8 - 12 min, and can be reused 5 - 6 times;

[0066] (4) Rinsing: Wash with deionized water 2 times, 30 s each time;

[0067] (5) Developing: Add 300 ml + 4.5 g NaOH + 3 ml formaldehyde, for 5 min;

[0068] (6) Rinse clean with distilled water and take a photo;

[0069] S4: Compare and determine the band results. If the band shows a characteristic band of 132 bp in size, then determine that the phenotype of the peanut material to be tested is long hypocotyl; if the band shows a characteristic band of 114 bp in size, then determine that the phenotype of the peanut material to be tested is short hypocotyl; if the characteristic bands of 132 bp and 114 bp appear simultaneously, then determine that the peanut to be tested is of the F1 type, intermediate type. The remaining bands are non-specific amplification.

[0070] The present invention also provides a kit, and the kit includes the primer pair C2-15-F / R.

[0071] The present invention also provides the application of the primer pair or the kit in molecular marker-assisted selection in the genetic improvement of peanut hypocotyl elongation, and the specific method is as follows:

[0072] Using the DNA extracted from the long hypocotyl parent and the short hypocotyl parent as templates, perform PCR amplification with the primer pair of the molecular marker C2-15. The amplification products show bands of different fragment sizes through polyacrylamide gel electrophoresis, so as to distinguish the parental genotypes of the loci related to hypocotyl elongation traits on chromosome 02. The hybrid offspring individuals are compared with the parental bands after PCR and electrophoresis, and then their genotypes and corresponding traits are determined. If the size of the marker amplification of the offspring individual is the same as that of the long hypocotyl parent, then the genotype of the gene related to hypocotyl elongation of this individual is the long hypocotyl parent type, and its phenotype is long hypocotyl; if the size of the marker amplification of the offspring individual is the same as that of the short hypocotyl parent, then the genotype of the gene related to hypocotyl elongation of this individual is the short hypocotyl parent type, and its phenotype is short hypocotyl; when the marker amplification products of the offspring individual have both parental bands, then the genotype of the gene related to hypocotyl elongation of this individual is heterozygous, and the phenotype of this individual is intermediate type.

[0073] The present invention also provides the application of the primer pair or the kit in identifying the phenotype or genotype of peanut hypocotyl elongation.

[0074] Compared with the prior art, the advantages of the present invention are as follows:

[0075] The present invention can quickly distinguish the traits of long and short peanut hypocotyls only through the InDel marker C2-15, using primer amplification of the target band and polyacrylamide gel electrophoresis detection. This identification method is more accurate, convenient and has good repeatability. When the population is large, it can efficiently distinguish the phenotypes and genotypes of individuals and shorten the experimental process. In terms of technology, compared with the cumbersome CAPS molecular marker, it has the advantages of simple and easy operation steps, etc., and saves expenses. This invention has important application value especially in the aspects of gene mapping, genotype typing related to peanut hypocotyl elongation traits, and breeding work such as cultivating excellent peanut plant types in the later stage. Description of the drawings:

[0076] Figure 1 The phenotypic diagram of hypocotyl length of the peanut hypocotyl parent SLZ and the short hypocotyl parent MJX 5 involved in the present invention under different cultivation conditions of soil cultivation and hydroponics.

[0077] Figure 2 The schematic diagram of the initial mapping principle of BSA whole-genome resequencing involved in the present invention. In the F2 population constructed by screening, 30 individuals with long hypocotyls and 30 individuals with short hypocotyls were used to construct extreme mixed pools, and two parents (MJX5 and SLZ) were subjected to whole-genome second-generation resequencing. In Figure A, the abscissa represents 62 individuals, the extreme individuals for constructing the short hypocotyl mixed pool are on the left, the extreme individuals for constructing the long hypocotyl are on the right, and the parents are in the middle. The ordinate represents the length of the hypocotyl (unit: mm). Figure B shows the schematic diagram of the initial mapping result of the gene controlling the elongation of peanut seedling hypocotyls.

[0078] Figure 3 The schematic diagram of the fine mapping of the gene controlling the elongation of peanut hypocotyls and the development result of the tightly linked molecular marker C2-15.

[0079] Figure 4 The schematic diagram of the 8% polyacrylamide gel electrophoresis detection result of the primer pair of the marker C2-15 in the parents and the F2 population involved in the present invention.

[0080] Figure 5 The violin diagram of the change of hypocotyl elongation traits of the C2-15 haplotype of the molecular marker involved in the present invention. Among them, a is the hypocotyl trait of the C2-15 haplotype of the F2 population in 2023; b is the hypocotyl trait of the C2-15 haplotype of the F2 population in 2024. The abscissa represents three genotypes: "A" genotype, "B" genotype, and "H" genotype. The upper and lower dotted lines in the figure represent the upper quartile and the lower quartile, and the middle dotted line represents the median. The limits of the dotted lines at both ends represent 1.5 times the interquartile range. Specific implementation method:

[0081] The present invention will be further described below through specific examples in combination with the accompanying drawings.

[0082] Example 1: Genetic mapping of gene loci related to hypocotyl elongation

[0083] (1). Construction of segregating population and phenotypic investigation

[0084] Through the investigation of the hypocotyl length of peanut germplasm resources, the peanut variety SLZ with long hypocotyls and the peanut variety MJX5 with short hypocotyls were selected (the germplasm resources required for the experiment were provided by the Peanut Center of Qingdao Agricultural University). As Figure 1As shown, SLZ and MJX were placed in a temperature- and humidity-controlled light incubator (set to full light or full darkness) for soil culture and hydroponics. After 10 days, the hypocotyl lengths of the seedlings were measured. There were significant differences in hypocotyl lengths between the two varieties under different culture conditions. The peanut variety SLZ with long hypocotyls and the peanut variety MJX5 with short hypocotyls were crossed to obtain F1 seeds, which were then planted individually. An F2 segregation population was constructed by self-crossing. Under the condition of cultivating in soil at the same depth, in a light incubator (25°C, 16 h of daylight illumination at 4000 lx / 25°C, 8 h of night), F2 seeds were planted individually in small flower pots. After harvesting 10 days later, the hypocotyl lengths of individual plants were measured using a vernier caliper. The data results showed that the distribution pattern of the target trait conformed to a continuous distribution, indicating that this trait belongs to a quantitative trait.

[0085] (2). Bulked Segregant Analysis (BSA-seq) Pooled Sequencing

[0086] Thirty individual plants with long hypocotyls and thirty individual plants with short hypocotyls were selected from the F2 population. The DNA of the 30 individual plants with long hypocotyls was mixed equally to form a long hypocotyl pool (L-Pool), and the DNA of the 30 individual plants with short hypocotyls was mixed equally to form a short hypocotyl pool (S-Pool). Whole-genome resequencing was performed on the parents (MJX 5 and SLZ) and the pooled samples (sequencing company: Guangzhou Gene Denovo Biotechnology Co., Ltd.; sequencing depth: 30x). The ΔSNP-index values in the sequencing results were analyzed, and the results showed that the major gene controlling the elongation of peanut seedling hypocotyls was located on chromosome 2 ( Figure 2 ).

[0087] In this example, a plant genomic DNA extraction kit Ver.2 (Aikerui Biotech) was used to extract the DNA of the required materials. The specific operation steps are as follows:

[0088] Adopt a simple operation process for extracting plant materials, generally starting with 100 mg of plant materials;

[0089] 1. Accurately weigh a certain amount of plant samples and put them into a 2 mL centrifuge tube containing glass beads for grinding in liquid nitrogen. Then, quickly add 500 μL of Buffer LS-3 Ver.2 (lysis buffer), 10 μL of 50X DTT Buffer, and 10 μL of RNase A (10 mg / mL) to the ground sample powder, and mix well by shaking;

[0090] 2. Place the centrifuge tube in a 56°C water bath and heat for 15 min (during heating, it can be taken out and inverted for mixing);

[0091] 3. Add 62.5 uL of Buffer PA (1 / 8 volume of the lysis solution), and mix well. Incubate on ice for 5 min, then centrifuge at 12,000 rpm for 5 min; take the supernatant, add Buffer BS-2 Ver.2 with the same volume as the supernatant, and mix well (18 ml of absolute ethanol needs to be added to Buffer BS-2 Ver.2 in advance);

[0092] 4. Transfer the above solution to the Plant DNA Mini Column, let it stand at room temperature for 1 min, then centrifuge at 12,000 rpm for 1 min, and discard the filtrate (the maximum volume of the Plant DNA Mini Column is 750 ul. If the volume of the liquid exceeds the maximum volume during transfer, transfer it in batches: load 750 ul of the solution, centrifuge, and discard the filtrate, then load the remaining solution again, centrifuge, and discard the filtrate);

[0093] 5. Add 500 uL of Buffer WA (buffer WA) to the Plant DNA Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;

[0094] 6. Add 750 uL of Buffer WB (buffer WB) to the Plant DNA Mini column twice, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid; (63 ml of absolute ethanol needs to be added to Buffer WB in advance)

[0095] 7. Place the Plant DNA Mini column on a new 2 mL Collection Tube

[0096] and centrifuge at 12,000 rpm for 2 min;

[0097] 8. Repeat step (7) once;

[0098] 9. Place the Plant DNA Mini column on a new 1.5 mL centrifuge tube, add 50 uL of Elution Buffer (elution buffer) or sterilized water to the center of its membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min to elute the DNA, which can be directly used for subsequent experiments or stored at -20 °C (Using Elution Buffer or sterilized water heated to 50 - 65 °C is beneficial to improving the elution efficiency).

[0099] (III). Marker Development

[0100] The Indel molecular markers developed on chromosome 2 and the primer sequence information are shown in Table 1.

[0101] Primers for the markers used on chromosome 02

[0102]

[0103]

[0104] Using the newly developed markers on chromosome 2, the preliminary mapping results were finely mapped. The genotypes of each individual plant in the F2 population were detected and genotyped, and a genetic linkage map was constructed. Combining linkage analysis and comparative genomics analysis, the candidate gene controlling peanut hypocotyl elongation was finely mapped within the interval of 4,856,452 - 6,153,343 on chromosome 2, a total of 1.30 Mb interval ( Figure 3 ), among which, the marker C2-15 was tightly linked to hypocotyl elongation.

[0105] The whole genomes of two parents, MJX5 and SLZ, were re-sequenced. Comparing the sequences of MJX5 and SLZ with the wild-type peanut reference genome (Tifrunner), at the 6,150,737th base on chromosome 02, there was an 18-bp base polymorphism between MJX5 and SLZ. SLZ inserted an 18-bp sequence (CATGGTTCACGAGCTGGA) at the 6,150,737 locus on chromosome 02. The specific steps and methods for the development of the involved markers are as follows:

[0106] (1) Screening of markers and synthesis of primers

[0107] Based on the sequencing results, Indel markers were designed on chromosome 2 according to the variant site information and variant sequences, giving priority to sites with insertions or deletions of large fragments of more than 6 bp. The upstream and downstream primers were designed using Primer Premier 5. The primer length was controlled between 20 - 28 bp, the GC% content was 40 - 60%, and the annealing temperature was 55 - 65°C. The primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. (Qingdao);

[0108] (2) Extraction of DNA

[0109] The DNA of the required materials was extracted using the Plant Genomic DNA Extraction Kit Ver. 2 (Aike Rui Biotechnology), generally starting with 100 mg of plant material.

[0110] 1) Accurately weigh a certain amount of plant sample and put it into a 2 mL centrifuge tube containing glass beads for liquid nitrogen grinding. Then, quickly add 500 μl of Buffer LS-3 Ver. 2 (lysis buffer), 10 μl of 50X DTT Buffer, and 10 μl of RNase A (10 mg / ml) to the ground sample powder, and mix well by oscillation;

[0111] 2) Place the centrifuge tube in a water bath at 56 °C and heat for 15 min (during heating, it can be taken out and inverted for mixing).

[0112] 3) Add 62.5 μL of Buffer PA (1 / 8 volume of lysis buffer), mix well. Place on ice for 5 min, centrifuge at 12,000 rpm for 5 min; take the supernatant, add an equal volume of Buffer BS-2 Ver.2 to the supernatant, and mix well (18 ml of absolute ethanol needs to be added to Buffer BS-2 Ver.2 in advance).

[0113] 4) Transfer the above solution to a Plant DNA Mini Column, let it stand at room temperature for 1 min, then centrifuge at 12,000 rpm for 1 min, and discard the filtrate (the maximum volume of the Plant DNA Mini Column is 750 μl. If the volume of the liquid exceeds the maximum volume during transfer, transfer it in portions: load 750 μl of the solution, centrifuge, discard the filtrate, then load the remaining solution again, centrifuge, and discard the filtrate).

[0114] 5) Add 500 μL of Buffer WA (buffer WA) to the Plant DNA Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.

[0115] 6) Add 750 μL of Buffer WB (buffer WB) to the Plant DNA Mini column twice, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. (63 ml of absolute ethanol needs to be added to Buffer WB in advance)

[0116] 7) Place the Plant DNA Mini column on a new 2 mL Collection Tube

[0117] and centrifuge at 12,000 rpm for 2 min.

[0118] 8) Repeat step (7) once.

[0119] 9) Place the Plant DNA Mini column on a new 1.5 mL centrifuge tube, add 50 μL of Elution Buffer (elution buffer) or sterilized water to the center of its membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min to elute the DNA, which can be directly used for subsequent experiments or stored at -20 °C (using Elution Buffer or sterilized water heated to 50 - 65 °C is beneficial to improve the elution efficiency).

[0120] (3)PCR Amplification

[0121] The total volume of PCR amplification is 10 μL: 2 μL of DNA template at 50 - 150 ng / μL, 1 μL each of primer pairs at 10 μM, 5 μL of 2×TaqAccurate Buffer, and 1 μL of RNase free water. PCR amplification reaction conditions: pre-denaturation at 98 °C for 7 min; 98 °C for 30 s, 59 °C for 30 s (set according to the actual primer annealing temperature), 72 °C for 1 min, 34 cycles; extension at 72 °C for 5 min, cooling at 4 °C for 10 min. Using the DNA of two parents MJX 5 and SLZ as templates, PCR amplification was carried out according to the above 10 μL system.

[0122] (4) Analysis of 8% Polyacrylamide Gel Electrophoresis Results

[0123] 1) Gel preparation (for each plate): 28 mL of ddH2O; 4 mL of 10x TBE Buffer; 8 mL of liquid Acrylamide

[0124] 40% (19:1) 8 mL; 400 μL of AP Buffer; 40 μL of TEMED;

[0125] 2) Loading and electrophoresis: After 30 min, when the gel has completely solidified, start loading. Add 1 - 1.5 μL of each PCR amplification product per well and perform electrophoresis for 75 min (150 V, 250 mA, 260 W);

[0126] 3) Silver staining and color development: Fix for 10 min, penetrate for 10 min, rinse for 30 s, and develop color for 5 min. Markers with significant differences between the parents were screened according to the band positions.

[0127] Example 2: Development and Application of Auxiliary Selection Markers for Hypocotyl Elongation-Related Gene Loci

[0128] 1. Experimental Materials

[0129] Using MJX 5, SLZ and their F2 population in Example 1 as test materials.

[0130] 2. DNA Extraction:

[0131] The DNA of the required materials was extracted using the Plant Genomic DNA Extraction Kit Ver.2 (Aikrui Biotech), generally starting with 100 mg of plant material;

[0132] 1) Weigh a certain amount of plant samples accurately and put them into a 2 mL centrifuge tube containing glass beads for grinding in liquid nitrogen. Then, quickly add 500 μL of Buffer LS-3 Ver.2 (lysis buffer), 10 μL of 50X DTT Buffer, and 10 μL of RNase A (10 mg / mL) to the ground sample powder, and mix well by oscillation.

[0133] 2) Place the centrifuge tube in a water bath at 56 °C and heat for 15 min (during heating, it can be taken out and inverted for mixing).

[0134] 3) Add 62.5 μL of Buffer PA (1 / 8 volume of the lysis buffer), and mix well. Place it on ice for 5 min, and centrifuge at 12000 rpm for 5 min; take the supernatant, add Buffer BS-2 Ver.2 with the same volume as the supernatant, and mix well (18 mL of absolute ethanol needs to be added to Buffer BS-2 Ver.2 in advance).

[0135] 4) Transfer the above solution to a Plant DNA Mini Column, let it stand at room temperature for 1 min, then centrifuge at 12000 rpm for 1 min, and discard the filtrate (the maximum volume of the Plant DNA Mini Column is 750 μL. When transferring, if the volume of the liquid exceeds the maximum volume, transfer it in batches: load 750 μL of the solution, centrifuge, discard the filtrate, then load the remaining solution again, centrifuge, and discard the filtrate).

[0136] 5) Add 500 μL of Buffer WA (buffer WA) to the Plant DNA Mini column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0137] 6) Add 750 μL of Buffer WB (buffer WB) to the Plant DNA Mini column twice, centrifuge at 12000 rpm for 1 min, and discard the waste liquid (63 mL of absolute ethanol needs to be added to Buffer WB in advance).

[0138] 7) Place the Plant DNA Mini column on a new 2 mL Collection Tube.

[0139] Centrifuge at 12000 rpm for 2 min.

[0140] 8) Repeat step (7) once.

[0141] 9) Place the Plant DNA Mini column on a new 1.5 mL centrifuge tube. Add 50 μL of Elution Buffer or sterilized water to the center of its membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min to elute the DNA. The eluted DNA can be directly used for subsequent experiments or stored at -20°C (Using Elution Buffer or sterilized water heated to 50 - 65°C is beneficial to improve the elution efficiency).

[0142] 3. PCR Amplification

[0143] Using the genomic DNA of MJX 5, SLZ and their F2 population in Example 1 as templates, perform PCR amplification on the above templates with the primer pair of molecular marker C2 - 15 on a PCR instrument. The total volume of the PCR amplification is 10 μL: 2 μL of DNA template at 50 - 150 ng / μL, 1 μL of each primer pair at 10 μM, 5 μL of 2×Taq Accurate Buffer, and 1 μL of RNase free water. PCR amplification reaction conditions: Pre - denaturation at 98°C for 7 min; 98°C for 30 s, 59°C for 30 s (set according to the actual primer annealing temperature), 72°C for 1 min, for 34 cycles; extension at 72°C for 5 min, cooling at 4°C for 10 min;

[0144] The molecular marker C2 - 15 is located on chromosome 02 of peanut. The sequence within the 2 kb range of the long - hypocotyl peanut variety SLZ corresponding to it is shown in SEQ ID NO.3, and the sequence within the 2 kb range of the short - hypocotyl peanut variety MJX 5 corresponding to it is shown in SEQ ID NO.4. The primer pair of marker C2 - 15 is C2 - 15 - F / R:

[0145] C2 - 15 - F: 5` - TGGTTAATTAATAGTCAAATGTTTTGG - 3` (SEQ ID No.1),

[0146] C2 - 15 - R: 5` - CCAAACTAATTGTGGAGTCCC - 3` (SEQ ID No.2);

[0147] Gel preparation system: 28 ml of ddH2O; 4 ml of 10x TBE Buffer; 8 ml of liquid Acrylamide 40% (19:1); 400 μl of AP Buffer; 40 μl of TEMED. 30 minutes after the gel is prepared, add 1 - 1.5 μl of the PCR amplification product. Add electrophoresis buffer (1x TBE Buffer) to the electrophoresis tank, and perform electrophoresis at a voltage of 150 V and a current of 250 mA for 75 minutes. Finally, fix the gel plate for 10 minutes, permeate for 10 minutes, rinse for 30 seconds, and develop color for 5 minutes.

[0148] Genotype typing of offspring individuals is carried out based on the bands in the electrophoresis results. According to the difference in the sizes of the amplification products of the primer pairs of the molecular markers between the parental individuals, the size of the amplification products of the primer pairs of the molecular markers in the hybrid offspring individuals is determined, and thus the corresponding parental genotypes are judged. Furthermore, the genotypes of the genes related to hypocotyl elongation in the linked region of the markers are determined, and the offspring individuals are selected according to the genotypes of the amplification products.

[0149] 4. Analysis of electrophoresis results

[0150] The electrophoresis detection results of the primer pairs of marker C2 - 15 in the parents and F2 population are shown in Figure 4 . From Figure 4 it can be seen that the amplification product of the primer pair of marker C2 - 15 in the peanut parent SLZ with long hypocotyls is a single band of 132 bp, and the amplification product in the parent MJX 5 with short hypocotyls is a single band of 114 bp; if the amplification product of an offspring individual is a single band of 132 bp, then the genotype of the gene locus related to hypocotyl elongation corresponding to this individual is the long - hypocotyl parent SLZ (denoted as genotype A), and the corresponding phenotype is long hypocotyls; if the amplification product of an offspring individual is a single band of 114 bp, then the genotype of the gene locus related to hypocotyl elongation corresponding to this individual is the short - hypocotyl MJX 5 type (denoted as genotype B), and the corresponding phenotype is short hypocotyls; if the amplification product of an offspring individual is two bands of 132 bp and 114 bp, then the genotype of the gene locus related to hypocotyl elongation corresponding to this individual is the heterozygous type (denoted as genotype H). Given that long hypocotyls is incompletely dominant over short hypocotyls, the phenotype of this individual is intermediate.

[0151] 5. Analysis of the genotype of molecular marker C2 - 15 and hypocotyl traits in the population

[0152] According to the genotype of molecular marker C2 - 15 in the population, the influence of genotype on the hypocotyl phenotype is studied. All individuals in the F2 population in 2023 and the F2 population in 2024 are grouped according to genotype, and the hypocotyl phenotypes of each group are investigated. The results are as Figure 5 shown. From Figure 5It can be seen that there are significant differences in the values of genotypes A and B. The hypocotyl length of individuals carrying only genotype A is significantly lower than that of individuals carrying only genotype B. Genotype H is significantly correlated with genotype B and not correlated with genotype A. The results indicate that the molecular marker C2-15 is tightly linked to peanut hypocotyl elongation.

Claims

1. A primer pair for a linked molecular marker for amplifying genes related to peanut hypocotyl elongation, characterized in that, The molecular marker is located on chromosome 02 of peanut, and the primer pair is C2-15-F / R, and the sequences are as follows: C2-15-F: 5`-TGGTTAATTAATAGTCAAATGTTTTGG-3`, C2-15-R: 5`-CCAAACTAATTGTGGAGTCCC-3`.

2. A method for identifying peanut hypocotyl elongation, characterized in that It includes the following steps: (1) Extract the DNA of the peanut leaves to be tested; (2) Use the primer pair C2-15-F / R to perform PCR amplification on the extracted DNA; the sequences of C2-15-F / R are as follows: C2-15-F: 5`-TGGTTAATTAATAGTCAAATGTTTTGG-3`, C2-15-R: 5`-CCAAACTAATTGTGGAGTCCC-3`; (3) Monitor the amplification product obtained in step (2) by non-denaturing polyacrylamide gel electrophoresis. If a characteristic band of 132 bp appears, it is determined that the phenotype of the peanut material to be tested is long hypocotyl; if a characteristic band of 114 bp appears, it is determined that the phenotype of the peanut material to be tested is short hypocotyl; if characteristic bands of 132 bp and 114 bp appear simultaneously, it is determined that the peanut to be tested is intermediate type.

3. The method for identifying peanut hypocotyl elongation according to claim 2, wherein, In step (2), the total volume of the PCR amplification is 10 uL: 2 uL of DNA template at 50-150 ng / uL, 1 uL of each primer pair at 10 uM, 5 uL of 2×Taq Accurate Buffer, and 1 uL of RNase free water.

4. The method for identifying peanut hypocotyl elongation according to claim 2, wherein In step (2), the reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 7 min; 98°C for 30 s, 59°C for 30 s, 72°C for 1 min, 34 cycles; extension at 72°C for 5 min.

5. The method for identifying peanut hypocotyl elongation according to claim 2, wherein, In step (3), 8% non-denaturing polyacrylamide gel electrophoresis is used.

6. A kit, characterized in that, The kit includes the primer pair C2-15-F / R described in claim 1.

7. Use of the primer pair according to claim 1 or the kit according to claim 5 in molecular marker-assisted selection for genetic improvement of peanut hypocotyl elongation, characterized in that, The sequences of the primer pair C2-15-F / R are as follows: C2-15-F: 5`-TGGTTAATTAATAGTCAAATGTTTTGG-3`, C2-15-R: 5`-CCAAACTAATTGTGGAGTCCC-3`; Using the genomic DNA of the long hypocotyl parent, the short hypocotyl parent and their hybrid offspring as templates, PCR amplification and gel detection were performed on the above templates with the primer pair C2-15-F / R. The genotype of the individual marker was determined by comparing the size of the amplification product of the hybrid offspring individual with that of the parent, and then the genotype of the gene related to hypocotyl elongation and the hypocotyl elongation trait of the individual were determined. If the size of the marker amplification of the offspring individual is the same as that of the long hypocotyl parent, the genotype of the gene related to hypocotyl elongation of the individual is the long hypocotyl parent type, and its phenotype is the long hypocotyl. If the size of the marker amplification elongation of the offspring individual is the same as that of the short hypocotyl parent, the genotype of the gene related to the hypocotyl of the individual is the short hypocotyl parent type, and its phenotype is the short hypocotyl. Given that the long hypocotyl is dominant over the short hypocotyl, when the marker amplification product of the offspring individual has both the parental bands, the genotype of the gene related to hypocotyl elongation of the individual is the heterozygous type, and the phenotype of the individual is the intermediate type.

8. Use of the primer pair according to claim 1 or the kit according to claim 5 in identifying the genotype of peanut hypocotyl elongation.

Citation Information

Cited By

  • InDel molecular marker SL-12 for identifying sizes of peanut leaves, primer pair and application of InDel molecular marker SL-12

    CN121183030A

  • InDel marker CO-1 for peanut sprout petal opening character, detection primer pair and screening method

    CN121380438A

  • InDel marker co-1 for peanut bud opening character, detection primer pair and screening method

    CN121380438B