A method for rapid identification and propagation of super-male asparagus plants

Abstract

The invention discloses a method for rapid identification and propagation of asparagus super male plants, and belongs to the technical field of vegetable crop genetic breeding. The method is based on the asparagus genome sequence, develops a molecular marker that can quickly identify asparagus super male plants, designs corresponding primers (named as Asp-YY01F, Asp-YY01R) for PCR amplification, and can accurately identify super male plants; and then using tender stems as explants, through callus induction (MS+1.0mg / L 6-BA+0.75 mg / L NAA+30g / L sucrose), adventitious buds (MS+2.0 mg / L 6-BA+0.05 mg / L NAA+30g / L sucrose) and adventitious root differentiation (1 / 2 MS+1.0 mg / L IBA+0.02 mg / L KT+0.5 g / L AC+30g / L sucrose), a corresponding in vitro high-frequency regeneration system is established, which can realize the rapid propagation of asparagus super male plants. The molecular markers provided by the present invention can accurately distinguish super male plants from ordinary male plants, and can be used for sex identification of plants in the seedling stage and purity detection of F1 generation seeds in all-male breeding; super male plants have a high in vitro regeneration reproduction coefficient and stable traits, and can provide important germplasm materials for all-male asparagus breeding, thereby accelerating the all-male asparagus breeding process.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable crop genetic breeding and relates to a method for rapid identification and propagation of super male asparagus plants. Background Art

[0002] Asparagus (Asparagus officinalis L.) is a perennial herbaceous plant of the genus Asparagus in the family Liliaceae. It is also known as Asparagus officinalis and Asparagus officinalis. The new stems are edible. The tender stems are crisp and refreshing, rich in nutrition, and are known as "one of the top ten famous dishes in the world". Asparagus is rich in nutrients such as protein, minerals, vitamins, polysaccharides, flavonoids, and various amino acids required by the human body. It has health functions such as promoting digestion, anti-tumor, anti-aging, and lowering blood sugar, and has high therapeutic value (Sun Chunyan, et al. Research progress on the chemical composition and pharmacological effects of asparagus. Chinese Wild Plant Resources, 2004 (05): 1-5).

[0003] Asparagus is a dioecious plant that reproduces by seeds. The genetics within natural populations are complex, the varieties are severely degenerated, and the breeding rate is slow. At present, my country's high-quality asparagus varieties are mainly imported from abroad, and there is a lack of advanced breeding technology and innovative varieties in breeding. The sex of asparagus is determined by the heterotypic XY type, which is controlled by a pair of alleles M and m located on the sex chromosome (L5). The male genotype that blooms bisexual flowers can be called a male plant. Self-pollination of bisexual flowers can produce 25% "super male plants" (MM), and hybridization between "super male plants" and female genotypes (mm) can produce F 1 The male line is an all-male line with a male heterozygous genotype (Mm). Male plants do not produce seeds, and a large amount of carbohydrates are transported downward and stored in the bulb disk. The diameter of the sprouted new shoots is larger than that of female plants, so the yield is generally 20-25% higher than that of female plants, and male plants are superior to female plants in growth, lifespan, disease resistance and stress resistance. All-male breeding is one of the important directions of asparagus breeding. The identification of the sex of self-pollinated offspring by traditional morphological observation is limited by the flowering period of asparagus. Therefore, combining molecular marker-assisted breeding to identify the sex of self-pollinated offspring at the seedling stage can help select parents for hybrid seed production, speed up breeding, and lay the foundation for all-male breeding of asparagus. In recent years, researchers have successively developed molecular markers related to asparagus sex, but the only co-dominant marker Asp2-Sp6 is not polymorphic in the female and male DNA pools in some studies and cannot be used. Therefore, the development of accurate and efficient sex markers is of great significance for the breeding and seed production of all-male asparagus lines.

[0004] Tissue culture is a method of inoculating explants on culture media through aseptic operation and culturing them under artificially controlled nutrition and environmental conditions to rapidly regenerate a large number of complete plants in a short period of time. Previous studies have shown that under the same culture conditions, in vitro regeneration of asparagus is greatly affected by genotype (Kong Mengmeng, et al. Asparagus tissue culture rooting technology. Journal of Shanghai Normal University (Natural Science Edition), 2006 (02): 91-94.). At present, there are few reports on the research of inducing explants to differentiate callus tissues, and then inducing adventitious buds and adventitious roots to efficiently form complete plants through organogenesis. Therefore, the establishment of asparagus callus induction and its efficient regeneration system can quickly obtain a large number of super male plants, provide a large number of important germplasm materials for asparagus all-male breeding, and provide technical support for the establishment of asparagus genetic transformation system. Summary of the invention

[0005] The purpose of the present invention is to provide a method for rapid identification and propagation of super male asparagus plants, so as to solve practical industry problems such as the long breeding period of all-male asparagus, the poor adaptability and low accuracy of existing sex molecular marker varieties, and the shortage of super male parent materials.

[0006] The technical solution provided by the present invention is: a method for rapid identification and reproduction of super male asparagus plants, comprising the following steps:

[0007] Step 1, genomic DNA extraction: take young leaves or tender shoots of asparagus plant materials of different sexes, and extract genomic DNA using the improved CTAB method;

[0008] Step 2, PCR amplification: PCR amplification was performed using asparagus genomic DNA as a template and primers that produced the co-dominant marker Asp-YY01. The PCR reaction system was 10 μL, i.e., 5 μL of 2× Rapid Taq Master Mix, ddH 2 O 3μL, 10μM primer F / R 0.5μL each, 20ng / μL DNA template 1μL. The PCR amplification reaction program is: 94℃ pre-denaturation for 3min; 95℃ denaturation for 45s, 55℃ annealing for 45s, 72℃ extension for 40s, 30 cycles; 72℃ extension for 5min; 10℃ storage. The sequences of the forward primer and reverse primer of the co-dominant marker Asp-YY01 are as follows:

[0009] Asp-YY01F:5'-GGTATGGAGCTTACATTGATGCA-3'

[0010] Asp-YY01R:5'-CTAGTGCATATAGGCTGTGATGT-3'

[0011] The amplified sequence of the co-dominant marker Asp-YY01 in the super male strain is a band with a length of 226 bp, and the specific sequence is as follows:

[0012] GGTATGGAGCTTACATTGATGCATCTCTCCATTATCTCTCCATACTCTTCTTCTGCTGAATTATATCTTTGATATAAGATACTAAAGATTGTCAAATTAAAGTAAAATGAGGGAGGGGAAGTCTTTCATCATCTTAGGGGGGGAATGAATCAGTAAACTTTATCGAGCTTTATAGGGAAGCGAATTGATCTTCGTTAACATTTACATCACAGCCTATATGCACTAG;

[0013] Step 3, gel electrophoresis: PCR product detection is performed using 6% polyacrylamide gel (PAGE) electrophoresis. After the gel is clearly developed, take a photo and save it. The specific steps are as follows:

[0014] (1) Preparation of gel. Wash and dry the electrophoresis glass plate, place gel strips on both sides of the glass plate, clamp the frame, and insert a comb to adjust the tightness. Prepare the Acr:bis (29:1) gel mixture and slowly pour it into the gel plate, insert a comb, and wait for the gel mixture to solidify for later use.

[0015] (2) Pre-electrophoresis. Remove the clips and gel strips, install the gel plate into the electrophoresis tank, pour 1×TBE buffer into the upper and lower electrophoresis tanks, remove the comb, and pre-electrophoresis for 10 min at 90 V.

[0016] (3) Electrophoresis: 1.2 μL of sample was applied and electrophoresis was performed at a constant voltage of 120 V for 1.5 h.

[0017] (4) Fixation and silver staining. Remove the gel block and place it flat in a fixation silver staining solution made of pure water, glacial acetic acid, ethanol and silver nitrate. Place it on a shaker in the dark and shake gently for 15 minutes.

[0018] (5) Development. Pour away the silver staining solution and wash twice with clean water. Pour into the color developing solution prepared with pure water, formaldehyde and sodium hydroxide, place on a shaker and shake gently until the bands are clear. Take a photo with a camera and save it.

[0019] Step 4, result analysis: Ordinary male plants amplified two bands of 226bp and 200bp, super male plants amplified a longer band (226bp), and female plants amplified a shorter band (200bp). The gender detection results should be consistent with the field flower morphology.

[0020] Step 5, explant pretreatment: select the newly grown tender stems of the asparagus super male plant identified by the above molecular markers as explants, rinse with tap water for 5-10 minutes, then peel off the scales on the tender stems, rinse with ultrapure water and put into a sterilized bottle; place on a clean bench and soak in 75% alcohol for 35 seconds, rinse once with sterile water, then soak in 0.5% sodium hypochlorite for 12-15 minutes, finally rinse with sterile water 3-4 times, and dry on sterile filter paper for later use. Step 6, callus induction: cut the dried tender stem into 0.5-1.0 cm long stem segments with a scalpel and cut them into two halves longitudinally, and inoculate them into callus induction medium: MS+1.0 mg / L 6-BA+0.75 mg / L NAA+30 g / L sucrose+8 g / L agar, and adjust the pH value to 5.8-6.0; after inoculation, culture in a constant temperature culture room at a temperature of 25°C, a light intensity of 16 h / d, and a light intensity of 20,000 lux to induce primary callus. After culturing for 25-30 days, cut off the primary callus on the surface of the explant and place it on the same component culture medium for subculture and proliferation 2-3 times to obtain callus with differentiation ability.

[0021] Step 7, adventitious bud induction: the callus tissue with good growth status is inoculated into callus differentiation medium: MS + 2.0 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 8 g / L agar, and the pH value is adjusted to 5.8-6.0; after inoculation, the temperature is 25 ° C, the light intensity is 16h / d, and the light intensity is 20000 lux. The constant temperature culture room is cultured to induce the callus tissue to produce buds and then differentiate into adventitious buds.

[0022] Step 8, adventitious root induction: Cut the stem tip of the healthy seedling and plant it vertically in the rooting medium: 1 / 2MS+1.0mg / L IBA+0.02mg / L KT+0.5g / L AC+30g / L sucrose+8g / L agar, pH5.8-6.0; after inoculation, culture in a constant temperature culture room at 25°C, 16h / d of light, and 20,000 lux of light intensity to induce adventitious root formation. Root primordia are formed at the base of the stem 15-20 days after inoculation, and the root system gradually elongates and thickens, and a complete regenerated plant is formed in about 40 days.

[0023] Step 9, hardening and transplanting: Hardening and transplanting are carried out when the new plants have well-developed root systems and the stems and leaves are in good growth condition. Before transplanting, open the cap of the tissue culture bottle, add water to cover the culture medium, place it in the tissue culture room for 2-3 days for hardening, wash the culture medium at the roots with tap water, and transplant it to the substrate culture, which is composed of peat, vermiculite and nutrient soil in a ratio of 3:1:1.

[0024] The invention provides a method for rapid identification and propagation of super male asparagus plants, which has the following beneficial effects:

[0025] (1) The co-dominant marker provided by the present invention has high accuracy and wide variety adaptability, and can quickly and accurately separate and identify super male asparagus plants, ordinary male plants and female plants.

[0026] (2) The co-dominant markers provided by the present invention can be widely used in early sex identification of seedlings, separation and identification of self-fertilized progeny of bisexual plants, and all-male breeding F 1 Purity testing.

[0027] (3) The present invention uses the tender stems of super-male asparagus plants as explants to induce a large amount of callus tissue, which can be multiplied and propagated for multiple generations, thus reducing the seasonal restrictions on materials.

[0028] (4) The present invention uses callus tissue to carry out rapid propagation of super-male asparagus plants, which has a higher reproduction coefficient. Combined with early sex identification with molecular markers, super-male plants can be quickly obtained, providing important germplasm materials for all-male asparagus breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The primers for producing the co-dominant marker Asp-YY01 were used to amplify the results in male and female asparagus plants.

[0030] Figure 2 It is the callus tissue induced from the stem segment of super male plant.

[0031] Figure 3 The callus tissue of the super male plant differentiates into adventitious buds.

[0032] Figure 4 It is the rooting of adventitious buds of super male plants. DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only used to explain the present invention but not to limit the present invention.

[0034] Example 1 Polymorphism Analysis of Co-dominant Marker Asp-YY01

[0035] Step 1, primer design: Download the asparagus genome sequence from NCBI, use Primer Premier 5.0 software to design and develop a co-dominant marker, named Asp-YY01, and the forward primer and reverse primer sequences for generating the molecular marker are as follows:

[0036] Asp-YY01F:5'-GGTATGGAGCTTACATTGATGCA-3'

[0037] Asp-YY01R:5'-CTAGTGCATATAGGCTGTGATGT-3'

[0038] The amplified sequence of the co-dominant marker Asp-YY01 in the super male strain is a band with a length of 226 bp, and the specific sequence is as follows:

[0039] GGTATGGAGCTTACATTGATGCATCTCTCCATTATCTCTCCATACTCTTCTTCTGCTGAATTATATCTTTGATATAAGATACTAAAGATTGTCAAATTAAAGTAAAATGAGGGAGGGGAAGTCTTTCATCATCTTAGGGGGGGAATGAATCAGTAAACTTTATCGAGCTTTATAGGGAAGCGAATTGATCTTCGTTAACATTTACATCACAGCCTATATGCACTAG;

[0040] Step 2, construction of female and male DNA pools: Take 5 female and 5 male asparagus plants with known field flower morphology, mix their pseudo-leaves in equal amounts according to gender, extract genomic DNA using the modified CTAB method, and construct female and male DNA pools.

[0041] Step 3, PCR amplification: PCR amplification was performed using the genomic DNA of the female and male DNA pools as templates and primers that produced the co-dominant marker Asp-YY01. The PCR reaction system was 10 μL, i.e., 5 μL of 2× Rapid Taq Master Mix, ddH 2 O 3μL, 10μM primer F / R 0.5μL each, 20ng / μL DNA template 1μL. PCR amplification reaction program is: 94℃ pre-denaturation for 3min; 95℃ denaturation for 45s, 55℃ annealing for 45s, 72℃ extension for 40s, 30 cycles; 72℃ extension for 5min; 10℃ storage.

[0042] Step 4, gel electrophoresis: PCR product detection is performed using 6% polyacrylamide gel (PAGE) electrophoresis. After the gel is clearly developed, take a photo and save it. The specific steps are as follows:

[0043] (1) Preparation of gel. Wash and dry the electrophoresis glass plate, place gel strips on both sides of the glass plate, clamp the frame, and insert a comb to adjust the tightness. Prepare the Acr:bis (29:1) gel mixture and slowly pour it into the gel plate, insert a comb, and wait for the gel mixture to solidify for later use.

[0044] (2) Pre-electrophoresis. Remove the clips and gel strips, install the gel plate into the electrophoresis tank, pour 1×TBE buffer into the upper and lower electrophoresis tanks, remove the comb, and pre-electrophoresis for 10 min at 90 V.

[0045] (3) Electrophoresis: 1.2 μL of sample was applied and electrophoresis was performed at a constant voltage of 120 V for 3 h.

[0046] (4) Fixation and silver staining. Remove the gel block and place it flat in a fixation silver staining solution made of pure water, glacial acetic acid, ethanol and silver nitrate. Place it on a shaker in the dark and shake gently for 15 minutes.

[0047] (5) Development. Pour away the silver staining solution and wash twice with clean water. Pour into the color developing solution prepared with pure water, formaldehyde and sodium hydroxide, place on a shaker and shake gently until the bands are clear. Take a photo with a camera and save it.

[0048] Step 5, result analysis: Three bands (226bp, 200bp and 350bp) were amplified in the male DNA pool, while one band (200bp) was amplified in the female DNA pool, indicating that Asp-YY01 is polymorphic between the female and male DNA pools and can be used for rapid identification of asparagus sex. In addition to two bands (226bp and 200bp) amplified from the common male plant, a specific fragment of about 350bp was also amplified; a longer band (226bp) was amplified from the super male plant; and a shorter band (200bp) was amplified from the female plant.

[0049] Example 2 Identification of Variety Adaptability and Accuracy Using Co-dominant Marker Asp-YY01

[0050] Step 1, genomic DNA extraction: 28 female plants and 52 male plants (including super male plants) of asparagus materials with known field flower morphology were taken, and the genomic DNA of individual plants was extracted using the improved CTAB method;

[0051] Step 2: PCR amplification: PCR amplification was performed using the genomic DNA of each individual strain as a template and primers that produced the co-dominant marker Asp-YY01. The PCR reaction system was 10 μL, i.e., 5 μL of 2× Rapid Taq Master Mix, 5 μL of ddH 2 O 3μL, 10μM forward / reverse primer 0.5μL each, 20ng / μL DNA template 1μL. The PCR amplification reaction program is: 94℃ pre-denaturation for 3min; 95℃ denaturation for 45s, 55℃ annealing for 45s, 72℃ extension for 40s, 30 cycles; 72℃ extension for 5min; 10℃ storage. The sequences of the forward primer and reverse primer for generating the co-dominant marker Asp-YY01 are as follows:

[0052] Asp-YY01F:5'-GGTATGGAGCTTACATTGATGCA-3'

[0053] Asp-YY01R:5'-CTAGTGCATATAGGCTGTGATGT-3'

[0054] The amplified sequence of the co-dominant marker Asp-YY01 in the super male strain is a band with a length of 226 bp, and the specific sequence is as follows:

[0055] GGTATGGAGCTTACATTGATGCATCTCTCCATTATCTCTCCATACTCTTCTTCTGCTGAATTATATCTT

[0056] TGATATAAGATACTAAAGATTGTCAAATTAAAGTAAAATGAGGGAGGGGAAGTCTTTCATCATCTTAGG

[0057] GGGGGAATGAATCAGTAAACTTTATCGAGCTTTATAGGGAAGCGAATTGATCTTCGTTAACATTTACATCACAGCCTATATGCACTAG;

[0058] Step 3, gel electrophoresis: PCR product detection is performed using 6% polyacrylamide gel (PAGE) electrophoresis. After the gel is clearly developed, take a photo and save it. The specific steps are as follows:

[0059] (1) Preparation of gel. Wash and dry the electrophoresis glass plate, place gel strips on both sides of the glass plate, clamp the frame, and insert a comb to adjust the tightness. Prepare the Acr:bis (29:1) gel mixture and slowly pour it into the gel plate, insert a comb, and wait for the gel mixture to solidify for later use.

[0060] (2) Pre-electrophoresis. Remove the clips and gel strips, install the gel plate into the electrophoresis tank, pour 1×TBE buffer into the upper and lower electrophoresis tanks, remove the comb, and pre-electrophoresis for 10 min at 90 V.

[0061] (3) Electrophoresis: 1.2 μL of sample was applied and electrophoresis was performed at a constant voltage of 120 V for 3 h.

[0062] (4) Fixation and silver staining. Remove the gel block and place it flat in a fixation silver staining solution made of pure water, glacial acetic acid, ethanol and silver nitrate. Place it on a shaker in the dark and shake gently for 15 minutes.

[0063] (5) Development. Pour away the silver staining solution and wash twice with clean water. Pour into the color developing solution prepared with pure water, formaldehyde and sodium hydroxide, place on a shaker and shake gently until the bands are clear. Take a photo with a camera and save it.

[0064] Step 4, result analysis: Ordinary male plants amplified two bands of 226bp and 200bp, super male plants amplified a longer band (226bp), and female plants amplified a shorter band (200bp). The gender detection results should be consistent with the morphological identification of field flowers.

[0065] Example 3 Super male strain in vitro rapid propagation

[0066] Step 1, explant pretreatment: select the newly grown tender stems of the asparagus super male plant identified by the above molecular markers as explants, rinse with tap water for 5-10 minutes, then peel off the scales on the tender stems, rinse with ultrapure water and put into a sterilized bottle; place on a clean bench and soak in 75% alcohol for 35 seconds, rinse once with sterile water, then soak in 0.5% sodium hypochlorite for 12-15 minutes, finally rinse with sterile water 3-4 times, and dry on sterile filter paper for later use.

[0067] Step 2, callus induction: cut the dried tender stem into 0.5-1.0 cm long stem segments with a scalpel and cut them into two halves longitudinally, and inoculate them into callus induction medium: MS+1.0 mg / L 6-BA+0.75 mg / L NAA+30 g / L sucrose+8 g / L agar, and adjust the pH value to 5.8-6.0; after inoculation, culture in a constant temperature culture room at a temperature of 25°C, a light intensity of 16 h / d, and a light intensity of 20,000 lux to induce callus. After culturing for 25-30 days, cut off the primary callus on the surface of the explant and place it on the same component culture medium for subculture and proliferation for 2-3 times to obtain callus with differentiation ability.

[0068] Step 3, adventitious bud induction: inoculate the above-mentioned well-grown callus tissue into callus differentiation medium: MS + 2.0 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 8 g / L agar, pH 5.8-6.0; after inoculation, culture in a constant temperature culture room at a temperature of 25 ° C, a light intensity of 16h / d, and a light intensity of 20000 lux to induce the callus tissue to produce buds, and then differentiate into adventitious buds.

[0069] Step 4, adventitious root induction: Cut the robust adventitious bud stem tip and plant it vertically in the rooting medium: 1 / 2MS+1.0mg / L IBA+0.02mg / L KT+0.5g / L AC+30g / L sucrose+8g / L agar, adjust the pH value to 5.8-6.0; after inoculation, culture in a constant temperature culture room at 25℃, 16h / d of light, and 20000lux of light intensity to induce adventitious root formation. Root primordium is formed at the base of the stem 15-20d after inoculation, and the root system gradually elongates and thickens, and a complete regenerated plant with a well-developed root system is formed around 45d.

[0070] Step 5, hardening and transplanting: Hardening and transplanting are carried out when the root system of the new plants is well developed and the stems and leaves are in good growth condition. Before transplanting, open the cap of the tissue culture bottle, add water to cover the culture medium, place it in the tissue culture room for 2-3 days for hardening, then wash the root culture medium with tap water, and transplant it to the substrate culture. The substrate is composed of peat, vermiculite and nutrient soil in a ratio of 3:1:1.

[0071] The co-dominant marker Asp-YY01 provided by the present invention has high accuracy and wide variety adaptability, and can quickly and accurately separate and identify super male plants, ordinary male plants and female plants of asparagus, and can be widely used in early sex identification of seedlings, separation and identification of self-pollinated progeny of bisexual plants, all-male breeding F 1 The invention establishes a high-frequency rapid identification and reproduction and regeneration technology system for super male asparagus plants, which can quickly obtain a large number of super male plants, provide important germplasm materials for all-male asparagus breeding, and greatly accelerate the breeding process of all-male asparagus plants.

[0072] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make corresponding modifications and adjustments within the scope of the claims. Therefore, the present invention will not be limited to the embodiments shown herein.

Claims

1. A method for rapid identification and propagation of super male asparagus plants, characterized in that: The following steps are involved: Step 1, genomic DNA extraction: take young leaves or tender shoots of asparagus plant materials of different sexes, and extract genomic DNA using the improved CTAB method; Step 2, PCR amplification: PCR amplification was performed using asparagus genomic DNA as a template and primers of the co-dominant marker Asp-YY01. The primers are as follows: Asp-YY01F:5'-GGTATGGAGCTTACATTGATGCA-3' Asp-YY01R:5'-CTAGTGCATATAGGCTGTGATGT-3' The amplified sequence of the primers of the co-dominant marker Asp-YY01 in the super-male asparagus strain is a band of 226 bp in length, as follows: GGTATGGAGCTTACATTGATGCATCTCTCCATTATCTCTCCATACTCTTCTTCTGCTGAATTATATCTTTGATATAAGATACTAAAGATTGTCAAATTAAAGTAAAATGAGGGAGGGGAAGTCTTTCATCATCTTAGGGGGGGAATGAATCAGTAAACTTTATCGAGCTTTATAGGGAAGCGAATTGATCTTCGTTAACATTTACATCACAGCCTATATGCACTAG; Step 3, gel electrophoresis: PCR product detection was performed using 6% polyacrylamide gel electrophoresis (PAGE), and the gel bands were clearly developed and photographed for preservation; Step 4, result analysis: ordinary male plants amplified two bands of 226bp and 200bp, super male plants only amplified the longer 226bp band, and female plants only amplified the shorter 200bp band. The gender detection results were consistent with the field flower type identification results; Step 5, explant pretreatment: select new tender stems of super-male asparagus plants as explants, peel off the scales on the tender stems, rinse with running water, disinfect and sterilize with alcohol and sodium hypochlorite, and dry on sterile filter paper for later use; Step 6, callus induction: using a scalpel to cut the dried tender stems into 0.5-1.0 cm long stem segments and cut them into two halves longitudinally, inoculating them into callus induction medium to induce callus; Step 7, adventitious bud induction: transfer the callus tissue with good growth status to the callus differentiation medium to induce adventitious buds; Step 8, adventitious root induction: Cut the healthy adventitious buds and plant them vertically in the rooting medium to induce adventitious roots; Step 9, seedling hardening and transplanting: When the new plants have well-developed root systems and good stem and leaf growth conditions, they can be hardened and transplanted. When hardening the seedlings, open the tissue culture bottle cap, add water to cover the culture medium, place it in the tissue culture room for 2 to 3 days for hardening, then wash the root culture medium with tap water and transplant it to the substrate for culture.

2. The method for rapid identification and propagation of super male asparagus plants according to claim 1, characterized in that: In step 2, in PCR amplification, the reaction system used for amplification is 10 μL, namely 5 μL of 2×Rapid Taq Master Mix, 3 μL of ddH2O, 0.5 μL of 10 μM primers F / R, and 1 μL of 20 ng / μL DNA template; the PCR amplification reaction procedure is: pre-denaturation at 94°C for 3 min; Denaturation at 95°C for 45 s, annealing at 55°C for 45 s, extension at 72°C for 40 s, 30 cycles; extension at 72°C for 5 min; storage at 10°C.

3. The method for rapid identification and propagation of super male asparagus plants according to claim 1, characterized in that: In step 5, in the explant pretreatment, first rinse the asparagus tender stems with tap water for 5 to 10 minutes, then peel off the scales on the tender stems, rinse with ultrapure water and put into a sterilized bottle; place on a clean bench and soak in 75% alcohol for 35 seconds, rinse once with sterile water, then soak in 0.5% sodium hypochlorite for 12 to 15 minutes, and finally rinse with sterile water 3 to 4 times, and dry on sterile filter paper for later use.

4. The method for rapid identification and propagation of super male asparagus plants according to claim 1, characterized in that: In step 6, during callus induction, the stem segments were dried and inoculated into callus induction medium: MS + 1.0 mg / L 6-BA + 0.75 mg / L NAA + 30 g / L sucrose + 8 g / L agar, and the pH value was adjusted to 5.8-6.0; after inoculation, the culture was carried out in a constant temperature culture room at a temperature of 25° C., a light intensity of 16 h / d, and a light intensity of 20,000 lux.

5. The method for rapid identification and propagation of super male asparagus plants according to claim 1, characterized in that: In step 7, during adventitious bud induction, callus tissue with good growth status was inoculated into callus differentiation medium: MS + 2.0 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 8 g / L agar, pH 5.8-6.0; after inoculation, the culture medium was cultured in a constant temperature culture room at 25°C, 16 h / d of light intensity, and 20,000 lux.

6. The method for rapid identification and propagation of super male asparagus plants according to claim 1, characterized in that: In step 8, in the adventitious root induction, the adventitious root induction medium is: 1 / 2MS + 1.0mg / L IBA + 0.02mg / L KT + 0.5g / L AC + 30g / L sucrose + 8g / L agar, pH 5.8-6.0; after inoculation, culture in a constant temperature culture room at 25°C, 16h / d of light, and 20000lux of light intensity.

Images