A fluorescent nanoparticle, a fluorescent probe, a preparation method and an application
The dual input logic AND gate activated fluorescent probe was solved by using Pr, Sm and Mn-doped SrS nanoparticles and DNAzyme complexes, and the false positive signal and low signal intensity problems of traditional fluorescent probes were achieved, achieving high signal-to-noise ratio and resolution bioimaging.
Patent Information
- Application Number
- CN202311421066.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-30
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2043-10-30
AI Technical Summary
Traditional fluorescence imaging probes have problems with false positive signals and low signal intensity, resulting in low spatiotemporal resolution and insufficient detection sensitivity of biological imaging.
Pr, Sm and Mn doped SrS nanoparticles are used as fluorescent nanoparticles, combined with mesoporous silicon and DNAzyme complexes to construct a dual-input logic-activated fluorescent probe, and use near-infrared light to activate the fluorescent signal to achieve high signal-to-noise ratio and resolution imaging.
It improves the activation efficiency and response speed of fluorescent probes, simplifies operation, reduces background interference, and improves the spatio-temporal resolution performance and detection sensitivity of biological imaging.
Smart Images

Figure CN117467434B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of fluorescent nanoprobe, and particularly relates to a fluorescent nanoparticle, a fluorescent probe, a preparation method and an application thereof. Background Art
[0002] Biological fluorescence imaging has been increasingly valued for its application value in the medical field due to its advantages such as no radiation hazard, economy, convenience, and high sensitivity. Especially fluorescence imaging based on the second near-infrared region (NIR-II, 1000 - 1700 nm) has been successfully applied to the imaging of tumors, blood vessels, and lymphatic vessels, as well as fluorescence-guided surgery, etc. due to its deeper tissue penetration ability, higher resolution, and signal-to-noise ratio. However, considering the actual application of biomedical diagnosis, traditional fluorescence imaging probes have two major deficiencies:
[0003] (1) Most fluorescence probes are non-activated types based on passive labeling, thus inevitably generating false positive signals, which easily results in low spatio-temporal resolution of biological imaging.
[0004] (2) The low fluorescence signal intensity leads to the detection sensitivity of biomedical imaging, especially for imaging deep tissue organs, needing to be improved.
[0005] Aiming at the deficiency of traditional fluorescence probes lacking specific spatio-temporal response, although there are currently various environment-responsive fluorescence probes developed at home and abroad, such as pH-dependent, reactive oxygen species-activated, enzyme-degradable, time-dependent, pressure-type fluorescence probes, etc., these design strategies often belong to single-signal-activated fluorescence probes. In fact, the differences in many targets (such as reactive oxygen species, pH, markers, etc.) between non-imaging / imaging sites are not significant. Therefore, single-activated response probes also often generate false positive signals; and affected by the complex physiological and pathological environmental factors of organisms, there are obvious differences in the activation responses of fluorescence probes under different conditions.
[0006] The design of fluorescence probes activated by logic AND gates based on dual signals (optical signals and chemical signals) is considered an imaging technique that can actively and controllably image target substances at specific spatiotemporal sites in complex biological environments, resulting in higher signal-to-noise ratios and resolutions compared to traditional fluorescence probes and fluorescence probes activated by single signals. For the design of such fluorescence probes at home and abroad, photosensitive sites are often activated by ultraviolet light or blue-violet light, and then triggered by target molecules to achieve the response. Due to the phototoxicity of ultraviolet light and blue-violet light, combined with their insufficient penetration depth in biological tissues, traditional activation-type fluorescence probes based on ultraviolet light or blue-violet light are not suitable for in vivo detection and imaging applications. Currently, one solution is to combine upconversion fluorescent nanomaterials and use the ultraviolet or blue-violet light generated by them with anti-Stokes shift under near-infrared light irradiation to activate the light-responsive sites of fluorescence probes, thus avoiding the defects of directly using ultraviolet light or blue-violet light. However, this design strategy also has two deficiencies:
[0007] (1) The existing upconversion fluorescent nanomaterials have low fluorescence quantum yields, so as fluorescence donors, they cannot generate strong enough ultraviolet or blue-violet light, which may lead to low light activation efficiency and slow response of fluorescence probes;
[0008] (2) During the "activation-imaging" process of the probe, the use of "dual light sources" is often involved. That is, on the one hand, a near-infrared light source (such as a 980 nm wavelength light source) is required to irradiate the upconversion fluorescent nanomaterials to activate the fluorescence probe, and on the other hand, for the activated fluorescence probe, a short-wavelength light source (such as a 350-550 nm wavelength light source) is needed to effectively excite the fluorophore and collect its emitted light as a monitoring signal, which increases the complexity of imaging instruments and experimental operations. Summary of the Invention
[0009] The technical problem to be solved by the present invention is to provide a fluorescent nanoparticle, a fluorescence probe, a preparation method and an application, which can improve the activation efficiency and response speed, solve the problem of complex "dual light source" operation, and improve the sensitivity and resolution.
[0010] An embodiment of the present invention provides a fluorescent nanoparticle, which is a SrS nanoparticle doped with Pr, Sm and Mn, namely SrS:Pr,Sm,Mn.
[0011] Preferably, the molar amounts of Pr, Sm and Mn are 0.08% - 0.12%, 0.10% - 0.35%, 0.50 - 0.80% of the molar amount of SrS respectively. That is, the molar ratio of SrS, Pr, Sm and Mn is 1:0.08% - 0.12%:0.10% - 0.35%:0.50 - 0.80%.
[0012] The fluorescent nanoparticles described in the present invention have high near-infrared to ultraviolet light conversion performance. The average particle size of SrS:Pr,Sm,Mn fluorescent nanoparticles is 9 - 12 nm, and they can be excited by 980 nm near-infrared light to generate emission in the ultraviolet region (300 - 400 nm).
[0013] An embodiment of the present invention provides a method for preparing the fluorescent nanoparticles. Strontium oleate, praseodymium acetate, samarium acetate, manganese acetate and a solvent are mixed. The solvent is a mixture of oleic acid, oleylamine and octadecene. After degassing treatment, it is then heated and stirred, then cooled, and then a methanol solution containing a sulfur source is added. It is heated and stirred, calcined, cooled, centrifuged, and washed to obtain the fluorescent nanoparticles.
[0014] Preferably, the molar ratio of strontium oleate, praseodymium acetate, samarium acetate, manganese acetate is 1:0.08% - 0.12%:0.10% - 0.35%:0.50 - 0.80%.
[0015] Preferably, the volume ratio of the oleic acid, oleylamine and octadecene is 1:5 - 6:4 - 8.
[0016] Preferably, the sulfur source is one or more of tetrabutylthiuram disulfide, tetramethylthiuram disulfide, bis(1,5 - pentamethylene)tetrasulfide.
[0017] Preferably, strontium oleate, praseodymium acetate, samarium acetate, manganese acetate and the solvent are mixed, degassed at 70 - 90 °C, then heated to 105 °C and stirred, then cooled, and then a methanol solution containing a sulfur source is added. It is heated to 70 - 90 °C and stirred, heated to 310 - 330 °C for calcination, cooled, centrifuged, and washed to obtain the fluorescent nanoparticles.
[0018] An embodiment of the present invention provides a mesoporous silica loaded with the fluorescent nanoparticles.
[0019] The present invention provides a fluorescent probe, which includes a mesoporous silica loaded with the fluorescent nanoparticles, a DNAzyme complex coupled to the surface of the mesoporous silica, and a shell located outside the DNAzyme complex; the DNAzyme complex includes a substrate strand, a photosensitizer group - modified DNAzyme - 1 linked to the substrate strand, and a fluorescent group - modified DNAzyme - 2 linked to the substrate strand. A part of DNAzyme - 1 and DNAzyme - 2 is complementary to the sequence of the target nucleic acid; the shell includes a hyaluronic acid and a polydopamine shell.
[0020] The present invention uses mesoporous silica as a template, in - situ synthesizes SrS:Pr,Sm,Mn fluorescent nanoparticles by high - temperature thermal decomposition method, and further through amination modification and avidin modification, couples a DNAzyme complex with photo - activation function, and coats a polydopamine - hyaluronic acid shell.
[0021] Preferably, the sequence of the substrate strand is SEQ ID NO.1, the sequence of DNAzyme-1 is SEQ ID NO.2, the sequence of DNAzyme-2 is SEQ ID NO.3, and the fluorophore is FD-1080.
[0022] The embodiment of the present invention provides a method for preparing the fluorescent probe. Mesoporous silica, strontium oleate, praseodymium acetate, samarium acetate, manganese acetate and a solvent are mixed. The solvent is a mixture of oleic acid, oleylamine and octadecene. After degassing treatment, it is heated and stirred, then cooled, and then a methanol solution containing a sulfur source is added. It is heated and stirred, calcined, cooled, centrifuged and washed to obtain mesoporous silica loaded with fluorescent nanoparticles; then annealed under a reducing atmosphere (preferably CO gas or H2-N2 mixed gas), the annealed product is dispersed in a solvent, a silane coupling agent is added and mixed, centrifuged, glutaraldehyde is added and mixed, dispersed in a buffer solution, avidin phosphate buffer solution is added, reacted, centrifuged and washed, the precipitate is dispersed in a tris(hydroxymethyl)aminomethane hydrochloride buffer solution, and a biotin-modified substrate strand, a photosensitizer group-modified DNAzyme-1, and a fluorophore group-modified DNAzyme-2 are added for hybridization, incubated, centrifuged and washed; then the product is dispersed in a tris(hydroxymethyl)aminomethane hydrochloride buffer solution, dopamine hydrochloride and hyaluronic acid are added, mixed, centrifuged to collect the precipitate, washed to obtain the fluorescent probe.
[0023] The molar ratio of the biotin-modified substrate strand, the photosensitizer group-modified DNAzyme-1 and the fluorophore group-modified DNAzyme-2 is 1:(1.5-2):(1.5-1).
[0024] The molar ratio of the dopamine hydrochloride and hyaluronic acid is (1-3):1.
[0025] The embodiment of the present invention provides an application of the fluorescent probe. The fluorescent probe is used for preparing nucleic acid detection substances, including the detection of RNA and DNA.
[0026] The beneficial effect of the present invention is that the present invention realizes the activation of a dual-input logic AND gate. The fluorescent probe for the activation of the dual-input logic AND gate includes a mesoporous silica core loaded with SrS:Pr,Sm,Mn fluorescent nanoparticles, a DNAzyme complex structure with a photoactivation function, a hyaluronic acid and a polydopamine shell.
[0027] In the presence of near-infrared light and specific nucleic acid fragments, the present invention activates a fluorescence probe system and releases a fluorophore (cyanine dye FD-1080) in the DNAzyme complex structure, and monitors the near-infrared second near-infrared fluorescence emission of FD-1080 to achieve the analysis of target fragments. The present invention can not only broaden the available fluorescent nanomaterials for bioimaging, but also contribute to the development of near-infrared light-controlled biochemical sensors and near-infrared light-controlled drug delivery carriers, thereby promoting the application of fluorescence analysis technology and light-controlled nanomachines in the field of biomedical detection.
[0028] The present invention constructs a mesoporous silica photoactivation carrier with excellent near-infrared to ultraviolet light conversion performance. Compared with the traditional use of upconversion fluorescent nanoparticles, it has a faster and higher response to near-infrared light, and thus can generate ultraviolet light with higher intensity. Therefore, this mesoporous silica photoactivation carrier has a better photoactivation effect on the DNAzyme complex system that depends on ultraviolet light activation.
[0029] The present invention realizes the simultaneous "excitation-imaging" process under a single near-infrared light source. Compared with the traditional ultraviolet light-activated fluorescence probe, since near-infrared light is used as the excitation light source, the background interference of collecting fluorescence signals can be reduced; and compared with other photoactivated fluorescence probe systems designed based on upconversion fluorescent materials, since the "excitation-imaging" process can be completed with a single near-infrared light source, the instrument and operation can be simplified; and at the same time, near-infrared dyes in the second near-infrared region can be excited by near-infrared light to construct fluorescence analysis and imaging in the second near-infrared region, so that the sensitivity is higher in in vivo analysis.
[0030] The present invention uses a light-controlled process to achieve the collection and imaging of fluorescence signals at specific spatiotemporal sites. Compared with single-input-activated fluorescence probes, it has stronger initiative in signal collection, thereby improving the spatiotemporal resolution performance of fluorescence detection, especially fluorescence in vivo imaging.
[0031] The SrS nanoparticles with the property of near-infrared to ultraviolet light conversion of the present invention are reported for the first time at home and abroad. The SrS nanoparticles synthesized by other conventional methods have low stability and are difficult to apply. Therefore, the present invention proposes a mesoporous silica loaded with SrS, which can effectively protect SrS, and the relevant data are Figure 5 described. This composite is not a simple stacking, but combines the advantages of mesoporous silica and SrS to construct a stable photoactivation nanocarrier for near-infrared to ultraviolet light conversion.
[0032] The mesoporous silicon core loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals and the DNAzyme outside it are not simply superimposed. For ordinary fluorescent probes, they either respond passively (there is no such thing as "activation"), or although they are of the "activation" type, they are single-activated, or it is difficult to achieve photoactivation detection under a single light source, that is, under the irradiation of a single near-infrared light, and two light sources are required. The present invention solves this problem. The probe can be activated by one light source and has the characteristic of "dual activation". Therefore, the mesoporous silicon core loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals is irreplaceable. Coupled with the reasonably designed DNAzyme, photoactivation detection can be achieved. Description of the Drawings
[0033] Figure 1 TEM image of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 1;
[0034] Figure 2 Energy spectrum elemental analysis of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 1;
[0035] Figure 3 Zeta potential diagrams of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 1 before (1) and after (2) DNAzyme strand modification;
[0036] Figure 4 980 nm near-infrared excitation fluorescence spectra and photos of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 1;
[0037] Figure 5 Trend diagrams of the 980 nm near-infrared excitation fluorescence intensity of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 2 over time in three phosphate buffer solutions with pH = 5.0 (1), pH = 7.0 (2), and pH = 8.0 (3), and the trend diagram of the 980 nm near-infrared excitation fluorescence intensity of SrS:Pr,Sm,Mn over time in a phosphate buffer solution with pH = 8.0 (4);
[0038] Figure 6 980 nm near-infrared excitation fluorescence spectra of the mesoporous silicon fluorescent probe activated by a dual-input logic AND gate in Example 3 under different conditions: fluorescence emission spectrum of free FD-1080-labeled DNAzyme-2 (1), fluorescence emission spectrum of FD-1080-labeled DNAzyme-2 modified on the surface of SrS:Pr,Sm,Mn fluorescent nanocrystal-loaded mesoporous silicon (2), fluorescence emission spectrum of the mesoporous silicon fluorescent probe when the target nucleic acid miRNA-224 is added and irradiated with near-infrared light (3), fluorescence emission spectrum of the mesoporous silicon fluorescent probe when only the target nucleic acid miRNA-224 is added (4);
[0039] Figure 7 980 nm near-infrared light-excited fluorescence spectra of the mesoporous silica fluorescent probe activated by the dual-input logic AND gate in Example 4 incubated with target nucleic acid miRNA-224 solutions at different concentrations. The concentrations of target nucleic acid miRNA-224 in (1)-(5) are 0.1, 0.2, 0.5, 0.8, and 1.0 nM, respectively.
[0040] Figure 8 Linear fitting relationship between the 980 nm near-infrared light-excited fluorescence intensity of the mesoporous silica fluorescent probe activated by the dual-input logic AND gate in Example 4 incubated with target nucleic acid miRNA-224 solutions at different concentrations and the miRNA-224 concentration.
[0041] Figure 9 Near-infrared second-region imaging diagrams of the mesoporous silica fluorescent probe activated by the dual-input logic AND gate in Example 4 incubated with target nucleic acid miRNA-224 solutions at different concentrations: The concentrations of target nucleic acid miRNA-224 in (1)-(5) are 0.1, 0.2, 0.5, 0.8, and 1.0 nM, respectively.
[0042] Figure 10 980 nm near-infrared light-excited fluorescence intensities of the mesoporous silica fluorescent probe activated by the dual-input logic AND gate in Example 5 after reacting with different analytes: The samples in (1)-(8) are miRNA-224, miRNA-16, miRNA-138, miRNA-155, miRNA-339, miRNA-375, bovine serum albumin, and immunoglobulin G, respectively.
[0043] Figure 11 Schematic structural diagram of the fluorescent probe of the present invention. Among them, A, B, and C are mesoporous silica loaded with fluorescent nanoparticles, DNAzyme complex, and outer shell, respectively; 1, 2, and 3 are substrate strand, photosensitizer group-modified DNAzyme-1, and fluorophore group-modified DNAzyme-2, respectively. Detailed implementation manners
[0044] The accompanying drawings serve to further explain the present invention and, as part of the specification, are used together with the detailed implementation manners section to explain the present invention, but should not impose limitations on the present invention.
[0045] Example 1
[0046] A mesoporous silica fluorescent probe activated by a dual-input logic AND gate and a preparation method thereof provided by this embodiment include the following steps: (1) Add 0.25 mL of triethanolamine to 100 ml of water, stir at 80 °C for 30 minutes, and then add 5 mmol of cetyltrimethylammonium bromide and 10 mmol of sodium salicylate to the above solution and stir for 1 hour. Subsequently, add 20 mL of tetraethoxysilane and 2 mL of ethanol and stir for 2 hours, centrifuge and disperse in an ethanol solution of ammonium nitrate, reflux at 60 °C for 1 h, centrifuge and wash the product with ethanol, and repeat the operation three times;
[0047] (2) Add strontium oleate, praseodymium acetate, samarium acetate, and manganese acetate in a molar ratio of 1:0.12%:0.20%:0.60%, together with the product of step 1, to a flask, and then add oleic acid, oleylamine, and octadecene with a volume ratio of 1:5:6. Perform degassing treatment at 80 °C for 30 minutes, then heat the mixed solution to 105 °C and stir for 60 minutes, and finally cool to room temperature; then add a methanol solution containing tetrabutylthiuram disulfide (the ratio of tetrabutylthiuram disulfide to strontium oleate is 2:1) to the above solution, stir at 80 °C for 30 minutes, then quickly raise the temperature to 320 °C, maintain this temperature under nitrogen protection for 60 minutes, and then quickly cool the reaction solution to room temperature by a nitrogen gas stream, centrifuge and wash with ethanol three times;
[0048] (3) Vacuum-dry the precipitate of step 2 and anneal it at 700 °C for 90 minutes in an H2-N2 gas environment. Then disperse the annealed product in 10 mL of chloroform, add 50 μL of 3-aminopropyltriethoxysilane, and drop 200 μL of ammonia water into it at a rate of 0.02 mL / min through an injection pump, and then stir and react at 60 °C for 12 hours, centrifuge and wash the product with ethanol;
[0049] (4) Add 3 mL of 2.5% glutaraldehyde solution to the product of step 3, react with shaking in the dark for 3 hours, centrifuge and wash three times and redisperse in 3 mL of phosphate buffer. Add 100 μL of phosphate buffer containing 1 mg / mL avidin, react with shaking at room temperature for 6 hours. After sufficient centrifugation and washing, disperse the precipitate in tris(hydroxymethyl)aminomethane hydrochloride buffer, and add biotin-modified substrate strand S, DNAzyme-1 modified with a photosensitive group (o-nitrobenzyl PC), and DNAzyme-2 modified with FD-1080 in a molar ratio of 1:1.5:1.5 for hybridization. The mixture is incubated at 95 °C for 5 minutes, then slowly cooled to room temperature, and centrifuged and washed three times. The sequence of the substrate strand is SEQ ID NO.1 (CTCGAGCGACTCACTATAGGAAGAGATGCAA), the sequence of DNAzyme-1 is SEQ ID NO.2 (TCAAGTCAACGTAGTTCAGTCGGTCGAAAAGTGAGTCGCTCGAG), and the sequence of DNAzyme-2 is SEQ ID NO.3 (TTGCATCTCTGATCACCAAGGCAAATC); the 17th group in the forward direction of SEQ ID NO.1, i.e., T, is preferably nucleotide T. The photosensitive group PC is located between the 8th and 9th deoxynucleotides in the 5 , to 3 , end direction of SEQ ID NO.2, and the FD-1080 is located at the 3 , end of SEQ ID NO.3.
[0050] (5) Redisperse the product of step 4 in 5 mL of tris(hydroxymethyl)aminomethane hydrochloride buffer, add dopamine hydrochloride and hyaluronic acid in a molar ratio of 3:1, stir in the dark for 8 hours, centrifuge to collect the precipitate and wash thoroughly to obtain the finally available mesoporous silica fluorescence probe activated by a dual-input logic AND gate.
[0051] The structure is as Figure 11 shown. Refer to Figure 1 , which is the transmission electron microscope photograph of the mesoporous silica fluorescence probe activated by the dual-input logic AND gate prepared in Example 1 of the present invention. It can be seen from the figure that the mesoporous silica fluorescence probe is in the shape of spherical particles with a size of about 200 - 400 nm, and contains many dispersed SrS:Pr,Sm,Mn fluorescent nanocrystals (SrS doped with rare earth Pr, Sm, and Mn, SrS is the substrate, and the other three are dopants) inside. The particle size distribution of SrS:Pr,Sm,Mn fluorescent nanocrystals is relatively uniform, and the average diameter is 11.2 nm. Refer to Figure 2, which is the energy dispersive X-ray spectroscopy analysis diagram of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared in Example 1 of the present invention. It can be seen from the figure that the elements such as silicon, strontium, sulfur, and oxygen exist, which is in line with the main element composition of the mesoporous silica fluorescent probe. Refer to Figure 3 , which is the Zeta potential diagram of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared in Example 1 of the present invention. It can be seen from the figure that after the modification of the substrate chain, DNAzyme-1, and DNAzyme-2, the absolute value of the Zeta potential becomes larger, and the surface of the particles carries more negative charges, indicating the successful modification of the negatively ionized nucleic acid chain. Refer to Figure 4 , which is the fluorescence spectrum diagram and the photo under near-infrared light irradiation of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared in Example 1 of the present invention. It can be seen from the fluorescence spectrum diagram that by testing the fluorescence emission spectrum excited by 980 nm near-infrared light, the prepared dual-input logic AND gate-activated mesoporous silica fluorescent probe has strong fluorescence emission in the ultraviolet and blue-violet light regions within the range of 300 - 450 nm.
[0052] Example 2
[0053] The stability evaluation study of a dual-input logic AND gate-activated mesoporous silica fluorescent probe provided in this example includes the following steps:
[0054] Equal amounts of the vacuum-dried dual-input logic AND gate-activated mesoporous silica fluorescent probe are respectively dispersed in three phosphate buffer solutions with pH = 5.0, pH = 7.0, and pH = 8.0, ultrasonically dispersed evenly and stored at room temperature. The fluorescence spectra of the test samples are measured at specific time points within 0 - 12 hours under the excitation of 980 nm near-infrared light. The samples need to be irradiated with a 365 nm ultraviolet lamp for 2 minutes before each test to be fully activated. The fluorescence intensity values are statistically analyzed and the variation law with time is depicted. For comparison, SrS:Pr,Sm,Mn fluorescent nanocrystals prepared by the reported high-temperature thermal decomposition method are used, and the variation law of their fluorescence intensity with time in three phosphate buffer solutions with pH = 5.0, pH = 7.0, and pH = 8.0 is tested in the same way.
[0055] Refer to Figure 5, the mesoporous silica fluorescence probe activated by the dual-input logic AND gate prepared in Example 1 of the present invention and the SrS:Pr,Sm,Mn fluorescent nanocrystals as a control. The graph shows the variation trend of the near-infrared excited fluorescence intensity with time in three different pH phosphate buffer dispersion media. It can be seen from the graph that for the mesoporous silica fluorescence probe activated by the dual-input logic AND gate, the fluorescence intensity can remain at a relatively constant level in the dispersion media with pH ranging from 5 to 8. Especially in neutral and weakly alkaline environments, it has good stability. While for the SrS:Pr,Sm,Mn fluorescent nanocrystals as a control, in the aqueous dispersion medium, the sulfide matrix undergoes hydrolysis reaction, resulting in a rapid decay of the fluorescence intensity within a short time. The comparison results show that the coating of mesoporous silica significantly improves the stability of SrS:Pr,Sm,Mn fluorescent nanocrystals to meet the requirements of nucleic acid detection applications in aqueous phase.
[0056] Example 3
[0057] Feasibility study on the analysis of specific target nucleic acids by a mesoporous silica fluorescence probe activated by a dual-input logic AND gate provided in this example, including the following steps: The principle is:
[0058] Under the photothermal effect induced by near-infrared light irradiation, the hyaluronic acid and polydopamine shells of the mesoporous silica fluorescent probe dissolve and expose the inner mesoporous silica and DNAzyme nanocomposite structure. The near-infrared light then induces ultraviolet light generated by the mesoporous silica core loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals, activating the o-nitrobenzyl photosensitive site on the surface-modified DNAzyme-1 and cleaving the blocked nucleic acid strand. When a specific target nucleic acid sequence exists (taking miRNA-224 as an example: UCAAGUCACUAGUGGUUCCGUUUAG), the activated DNAzyme-1 and DNAzyme-2 hybridize complementarily with the target nucleic acid sequence and trigger the DNAzyme activity, thereby cleaving the substrate strand, resulting in the detachment of DNAzyme-2 labeled with FD-1080 from the mesoporous silica surface; due to the broadband excitation absorption of SrS:Pr,Sm,Mn fluorescent nanocrystals in the shallow traps in the near-infrared region, energy transfer occurs to FD-1080 immobilized on the surface of the mesoporous silica loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals, quenching its fluorescence emission near 1100 nm; thus, the cleavage of the substrate strand leading to the detachment of FD-1080-labeled DNAzyme-2 from the mesoporous silica surface will restore the fluorescence of FD-1080, and the analysis of the target nucleic acid can be achieved by monitoring the fluorescence emission signal of FD-1080. When only the target sequence exists without near-infrared light irradiation, the shell of the mesoporous silica fluorescent probe will not dissolve, hindering the contact between the target sequence and the core. At the same time, the blocked DNAzyme-1 also limits the cleavage of the substrate strand. Therefore, only when both near-infrared light irradiation and the target sequence exist can a responsive fluorescence signal occur, thus realizing the activation analysis of the logic AND gate with dual inputs of light and molecular signals.
[0059] Refer to Figure 6 , which is the near-infrared excitation fluorescence spectrum of the mesoporous silica fluorescent probe activated by the dual-input logic AND gate prepared in the present invention under different conditions. It can be seen from the figure that compared with the free DNAzyme-2 labeled with FD-1080, the fluorescence emission peak near 1130 nm of the DNAzyme-2 labeled with FD-1080 modified on the surface of the mesoporous silica loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals decreases significantly under near-infrared light irradiation, indicating that energy transfer occurs between FD-1080 and the mesoporous silica loaded with SrS:Pr,Sm,Mn fluorescent nanocrystals, quenching the fluorescence of FD-1080; when the target nucleic acid miRNA-224 is added to the reaction system and irradiated with near-infrared light, a significant increase in the fluorescence emission peak near 1130 nm can be observed, while when only irradiated with near-infrared light or only miRNA-224 is added, there is no obvious enhancement of the fluorescence signal, proving that the mesoporous silica fluorescent probe has the activation performance of the logic AND gate with dual inputs of light and molecular signals.
[0060] Example 4
[0061] Application of a dual-input logic AND gate-activated mesoporous silica fluorescent probe provided by this embodiment in quantitative analysis of specific target nucleic acids, comprising the following steps: Equal amounts of the vacuum-dried dual-input logic AND gate-activated mesoporous silica fluorescent probe are dispersed in a phosphate buffer solution with pH = 7.0, evenly divided into 6 portions, and the fluorescence intensity F0 at 1130 nm of each dispersion is detected under 980 nm near-infrared light excitation; Solutions of target nucleic acid miRNA-224 with concentrations of 0.1, 0.2, 0.5, 0.8, and 1.0 nM are respectively added to the 6 dispersions, irradiated with 980 nm near-infrared light for 15 minutes, then incubated for 30 minutes, and subsequently the fluorescence spectrum and near-infrared second-region imaging effect at 1130 nm of each dispersion under 980 nm near-infrared light irradiation are tested. The fluorescence intensity F of the emission peak of the fluorescence spectrum at 1130 nm must be statistically analyzed. Using F - F0 as the y-axis and the corresponding target nucleic acid miRNA-224 concentration as the x-axis, linear fitting is performed to obtain a standard curve, and the quantification of the target nucleic acid miRNA-224 is achieved through the standard curve.
[0062] Refer to Figure 7 , which is the near-infrared light-excited fluorescence spectrum of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared by the present invention incubated with solutions of target nucleic acid miRNA-224 at different concentrations. It can be seen from the figure that with the increase in the concentration of target nucleic acid miRNA-224, the fluorescence recovery of FD-1080 is enhanced; Refer to Figure 8 , which is the linear fitting relationship between the near-infrared light-excited fluorescence intensity of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared by the present invention incubated with solutions of target nucleic acid miRNA-224 at different concentrations and the miRNA-224 concentration. It can be seen from the figure that the fluorescence intensity at 1130 nm increases with the increase in the concentration of target nucleic acid miRNA-224, and there is a good linear correlation between the miRNA-224 concentration and the fluorescence intensity. The correlation coefficient R 2 reaches 0.990, indicating that the fluorescence intensity of the dual-input logic AND gate-activated mesoporous silica fluorescent probe can be used for quantitative analysis of the target nucleic acid concentration; Refer to Figure 9 , which is the near-infrared second-region imaging map of the dual-input logic AND gate-activated mesoporous silica fluorescent probe prepared by the present invention incubated with solutions of target nucleic acid miRNA-224 at different concentrations. It can be seen from the figure that the intensity of the fluorescence signal gradually increases with the increase in the concentration of target nucleic acid miRNA-224, which is consistent with the test results of the near-infrared light-excited fluorescence spectrum.
[0063] Example 5
[0064] Selectivity study of a dual-input logic AND-gate activated mesoporous silica fluorescent probe for specific nucleic acid analysis provided by this embodiment includes the following steps: Select common nucleic acid and protein substances in actual biological samples for selectivity study. Disperse equal amounts of the vacuum-dried dual-input logic AND-gate activated mesoporous silica fluorescent probe in phosphate buffer with pH = 7.0, divide it into 8 equal parts, and detect the fluorescence intensity F0 at 1130 nm of each dispersion under 980 nm near-infrared light excitation; Add a solution of target nucleic acid miRNA-224 with a concentration of 0.2 nM to 1 part of the dispersion, and add solutions of interfering nucleic acids miRNA-16, miRNA-138, miRNA-155, miRNA-339, miRNA-375, bovine serum albumin, and immunoglobulin G with a concentration of 1 nM to the other 7 parts of the dispersion respectively. After irradiating each dispersion with 980 nm near-infrared light for 15 minutes, incubate for another 30 minutes, and then test the fluorescence spectrum and fluorescence intensity F at 1130 nm of each dispersion under 980 nm near-infrared light irradiation; Use F - F0 as the y-axis to statistically analyze the fluorescence intensities of different samples.
[0065] Referring to Figure 10 , it is the fluorescence intensity after the reaction of the dual-input logic AND-gate activated mesoporous silica fluorescent probe prepared by the present invention with different analytes. It can be seen from the figure that only after incubation with the target nucleic acid miRNA-224, the fluorescence intensity under near-infrared light irradiation is significantly higher than that of other interfering nucleic acid fragments and proteins, indicating that the dual-input logic AND-gate activated mesoporous silica fluorescent probe is specific for the detection of the target nucleic acid. Therefore, the detection method has excellent selectivity and can be applied to the detection and analysis of target nucleic acids in biological samples.
[0066] Those of ordinary skill in the art should understand that: The discussion of any above embodiment is only exemplary and is not intended to imply that the protection scope of this application is limited to these examples; Under the concept of this application, the technical features in the above embodiments or different embodiments can also be combined, and the steps can be implemented in any order, and there are many other variations in different aspects of one or more embodiments in this application as described above, which are not provided in detail for the sake of brevity.
[0067] One or more embodiments in this application are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omission, modification, equivalent substitution, improvement, etc. made within the spirit and principle of one or more embodiments in this application shall be included within the protection scope of this application.
Claims
1. A fluorescent probe, characterized in that, It includes mesoporous silica loaded with fluorescent nanoparticles, a DNAzyme complex coupled to the surface of the mesoporous silica, and a shell located on the outer layer of the DNAzyme complex; the DNAzyme complex includes a substrate strand, a photosensitizer group-modified DNAzyme-1 linked to the substrate strand, and a fluorophore group-modified DNAzyme-2 linked to the substrate strand, and a part of each of the DNAzyme-1 and DNAzyme-2 is complementary paired with the sequence of the target nucleic acid; the shell includes hyaluronic acid and a polydopamine shell, and the fluorescent nanoparticles are Pr, Sm, and Mn-doped SrS nanoparticles.
2. The fluorescent probe according to claim 1, wherein The molar amounts of Pr, Sm, and Mn are respectively 0.08% - 0.12%, 0.10% - 0.35%, 0.50 - 0.80% of the molar amount of SrS.
3. A fluorescent probe as claimed in claim 1 or 2, wherein the preparation method of the fluorescent nanoparticles is to mix strontium oleate, praseodymium acetate, samarium acetate, manganese acetate, and a solvent, the solvent is a mixture of oleic acid, oleylamine, and octadecene, perform degassing treatment, then heat and stir, then cool, and then add a methanol solution containing a sulfur source, heat and stir, calcine, cool, centrifuge, and wash to obtain the fluorescent nanoparticles.
4. The fluorescent probe according to claim 3, wherein, The volume ratio of the oleic acid, oleylamine, and octadecene is 1:5 - 6:4 - 8; the sulfur source is one or more of tetrabutylthiuram disulfide, tetramethylthiuram disulfide, bis(1,5-pentamethylene)tetrasulfide.
5. The fluorescent probe according to claim 3, wherein, Strontium oleate, praseodymium acetate, samarium acetate, manganese acetate, and a solvent are mixed, degassed at 70 - 90 °C, then heated to 105 °C and stirred, then cooled, and then add a methanol solution containing a sulfur source, heated to 70 - 90 °C and stirred, heated to 310 - 330 °C for calcination, cooled, centrifuged, and washed to obtain the fluorescent nanoparticles.
6. The fluorescent probe according to claim 1, wherein The sequence of the substrate strand is SEQ ID NO.1, the sequence of DNAzyme-1 is SEQ ID NO.2, the sequence of DNAzyme-2 is SEQ ID NO.3, and the fluorophore group is FD-1080; SEQ ID NO.1 is CTCGAGCGACTCACTATAGGAAGAGATGCAA, SEQ ID NO.2 is TCAAGTCAACGTAGTTCAGTCGGTCGAAAAGTGAGTCGCTCGAG, SEQ ID NO.3 is TTGCATCTCTGATCACCAAGGCAAATC.
7. A method for preparing a fluorescent probe according to any one of claims 1-6, characterized in that, Mix mesoporous silica, strontium oleate, praseodymium acetate, samarium acetate, manganese acetate and a solvent. The solvent is a mixture of oleic acid, oleylamine and octadecene. Perform degassing treatment, then heat and stir, then cool, and then add a methanol solution containing a sulfur source. Heat and stir, calcine, cool, centrifuge, wash to obtain mesoporous silica loaded with fluorescent nanoparticles; then anneal under a reducing atmosphere, disperse the annealed product in a solvent, add a silane coupling agent and mix, centrifuge, add glutaraldehyde, mix, disperse in a buffer solution, add an avidin phosphate buffer solution, react, centrifuge and wash, disperse the precipitate in a tris(hydroxymethyl)aminomethane hydrochloride buffer solution, add a biotin-modified substrate strand, a photosensitive group-modified DNAzyme-1, and a fluorescent group-modified DNAzyme-2 for hybridization, incubate, centrifuge and wash; then disperse the product in a tris(hydroxymethyl)aminomethane hydrochloride buffer solution, add dopamine hydrochloride and hyaluronic acid, mix, centrifuge to collect the precipitate, wash to obtain a fluorescent probe.
8. Use of a fluorescent probe according to any one of claims 1 - 6, characterized in that, The fluorescent probe is used for preparing a nucleic acid detection substance.
Citation Information
Patent Citations
Construction method and detection method of near-infrared fluorescence biosensor
CN111175266A
Composite material based on mesoporous copper sulfide, and preparation method and detection method of composite material
CN113376132A