Method for enhancing production of ansamitocin by enhancing expression of ansamitocin target protein apasm_1807 in vivo

By enhancing the expression of the in vivo target protein gene of anthracycline in the precious actinomycetes, the problems of intracellular toxicity and feedback inhibition of synthase during anthracycline fermentation were solved, resulting in a significant increase in anthracycline yield.

CN117467688BActive Publication Date: 2026-08-25SHANGHAI JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311414923.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-18
Publication Date
2026-08-25
Estimated Expiration
2041-10-18

AI Technical Summary

Technical Problem

In the existing technology, anserin affects cell growth and physiological activities during the fermentation of precious actinomycetes, leading to intracellular toxicity and feedback inhibition of synthetic enzymes, thus limiting the yield of anserin.

Method used

By enhancing the expression of the in vivo target protein genes APASM_0666, APASM_1807, APASM_5765, and APASM_6307 of anthracycline in *Actinomyces hygroscopicus*, and constructing an integrative plasmid using the strong promoter kasOp*, high-yielding strains HQG-01, HQG-02, HQG-03, and HQG-04 were obtained, thus improving the fermentation level of anthracycline.

Benefits of technology

It significantly increased the yield of anthraquinone, with fermentation levels increasing by 24.1%, 66.5%, 71.5%, and 93.5%, respectively. Laboratory shake-flask fermentation levels reached 57.1 mg/L, 76.6 mg/L, 78.9 mg/L, and 89 mg/L, while reducing intracellular toxicity and relieving feedback inhibition of the synthase.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117467688B_ABST
    Figure CN117467688B_ABST
Patent Text Reader

Abstract

The application discloses a method for enhancing actinomycin production by enhancing expression of an actinomycin in-vivo target protein APASM_1807. The method comprises the following steps: enhancing expression of the actinomycin in-vivo target protein APASM_1807 by using a strong promoter kasOp* in Actinocatenulum ramosum ATCC 31280, and obtaining a high-yield actinomycin mutant strain HQG-02. Compared with a starting strain, the high-yield strain HQG-02 obtained by the method has a fermentation yield increased by 66.5%, and a laboratory shake flask fermentation level reaches 76.6 mg / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention is a divisional application of Chinese invention patent application No. 2021112239259, entitled "A method for high-yield anserine production by enhancing the expression of anserine target protein gene in vivo".

[0002] This invention belongs to the field of biomedical technology and relates to a method for enhancing the expression of the in vivo target protein APASM_1807 of anserine to achieve high anserine production; more particularly, it relates to a method for enhancing the transcriptional level of the in vivo target protein APASM_1807 gene of anserine to improve the fermentation level of anserine; by enhancing the expression of the endogenous in vivo target protein gene APASM_1807 of *Actinomyces argentea* ATCC 31280 using the strong promoter kasOp*, the biomass of *Actinomyces argentea* can be increased, its intracellular toxicity reduced, and feedback inhibition of related synthetic enzymes relieved, ultimately significantly increasing the yield of anserine. Background Technology

[0003] Ansomniacin is a macrolide antibiotic produced by *Actinosynnema pretiosum*. It binds to the β subunit of tubulin, inhibiting microtubule assembly and thus suppressing tumor cell division. Chari et al. from ImmunoGen, Inc. formed the DM1 molecule by linking a disulfide bond to the C-3 ester chain. After DTT reduction, it can be linked to various antibodies to form antibody-drug conjugates (ADCs). Currently, several ADCs derived from ansomniacin have entered different stages of clinical trials, including Trastuzumab Emtansine (T-DM1), developed by Roche for the treatment of human breast cancer, which is already on the market. In addition to its antitumor activity, ansomniacin can also inhibit the growth and reproduction of fungi, yeasts, insects, and other eukaryotes.

[0004] During the fermentation of anserin-producing strain ATCC 31280, anserin affects cell growth and physiological activities. In response, the cell's self-protective mechanisms promote further anserin synthesis. Through chemical proteomics, we identified four genes involved in anserin synthesis: APASM_0666, APASM_1807, APASM_5765, and APASM_6307. Enhancing the expression of anserin target protein genes can increase the biomass of the producing strain, reduce the toxicity of anserin to the host, relieve the inhibition of anserin synthesis, and ultimately increase anserin production. Summary of the Invention

[0005] The purpose of this invention is to provide a method for high-yield anserine production by enhancing the expression of the in vivo target protein APASM_1807. This invention improves the fermentation level of anserine by enhancing the expression level of the in vivo target protein gene of anserine, and obtains high-yield anserine mutant strains (HQG-01, HQG-02, HQG-03 and HQG-04). Based on the enhanced expression of the endogenous in vivo target protein genes of anserine, APASM_0666, APASM_1807, APASM_5765 and APASM_6307, the yield of anserine is ultimately increased.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] On one hand, the present invention provides a method for improving the fermentation level of anserine, which enhances the expression of the target protein gene of anserine in *Actinomyces lucida* to obtain a high-yielding strain of anserine, and then ferments to obtain anserine; the target protein gene is one or more of the genes APASM_0666, APASM_1807, APASM_5765, and APASM_6307, and their sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively.

[0008] As one embodiment of the present invention, the precious bundle-filament actinomycetes include Actinosynnemapretiosum subsp. pretiosum ATCC 31280.

[0009] Furthermore, the high-yielding anserine strain was obtained by enhancing the expression of the anserine target protein genes APASM_0666, APASM_1807, APASM_5765 or APASM_6307 from the rare Actinobacterium ATCC 31280.

[0010] As one embodiment of the present invention, enhancing the expression of the in vivo target protein gene of anserine in ATCC 31280 specifically includes the following steps:

[0011] S1, Design and construct integrative plasmid I for enhancing the expression of gene APASM_0666;

[0012] S2, Design and construct integrative plasmid II for enhancing expression of the gene APASM_1807;

[0013] S3, Design and construct integrative plasmid Ш for enhancing the expression of gene APASM_5765;

[0014] S4, Design and construct an integrative plasmid IV for enhancing the expression of the gene APASM_6307;

[0015] S5, through conjugation transfer, integrative plasmids I, II, III, and IV were introduced into the recipient strain, and then the mutant strains were tested for ampicillin resistance. Mycelia were selected and gene expression mutants were screened by the difference in the size of PCR product fragments.

[0016] As one embodiment of the present invention, the specific construction method of the integrative plasmid I is to obtain an 882bp APASM_0666 gene fragment from the ATCC 31280 genome by PCR amplification, and then ligate it into the NdeI / EcoRI site of the integrative plasmid pDR3-K* by enzyme digestion and ligation.

[0017] As one embodiment of the present invention, the APASM_0666 gene is obtained by PCR amplification using primers APASM_0666-F / R.

[0018] As one embodiment of the present invention, the specific construction method of the integrative plasmid II is to obtain an 861bp APASM_1807 gene fragment from the ATCC 31280 genome by PCR amplification, and then ligate it into the NdeI / EcoRI site of the integrative plasmid pDR3-K* by enzyme digestion and ligation.

[0019] As one embodiment of the present invention, the APASM_1807 gene is obtained by PCR amplification using primers APASM_1807-F / R.

[0020] As one embodiment of the present invention, the specific construction method of the integrative plasmid Ш is to obtain a 729bp APASM_5765 gene fragment from the ATCC 31280 genome by PCR amplification, and then ligate it into the NdeI / EcoRI site of the integrative plasmid pDR3-K* by enzyme digestion and ligation.

[0021] As one embodiment of the present invention, the APASM_5765 gene fragment is obtained by PCR amplification using primers APASM_5765-F / R.

[0022] As one embodiment of the present invention, the specific method for constructing the integrative plasmid IV is to obtain a 993bp APASM_6307 gene fragment from the ATCC 31280 genome by PCR amplification, and then ligate it into the NdeI / EcoRI site of the integrative plasmid pDR3-K* by enzyme digestion and ligation.

[0023] As one embodiment of the present invention, the APASM_6307 gene is obtained by PCR amplification using primers APASM_6307-F / R.

[0024] In one embodiment of the present invention, the recipient strain is *Actinosynne mapretiosum* subsp. *pretiosum* ATCC 31280. The gene-enhanced expression mutant strains are sequentially designated as HQG-01, HQG-02, HQG-03, and HQG-04.

[0025] As one embodiment of the present invention, the fermentation includes the following steps: activating the anthrombin target protein gene enhanced expression mutant strain (HQG-01, HQG-02, HQG-03 or HQG-04) on a solid culture medium, then culturing the activated mycelium in a primary seed culture medium at 30°C and 220 rpm for 24 hours; transferring the mycelium to a secondary seed culture medium at an inoculum rate of 3.3% and culturing it at 30°C and 220 rpm for 24 hours; transferring the mycelium to a fermentation culture medium at an inoculum rate of 10% and fermenting it at 25°C and 220 rpm for 7 days, then collecting the fermentation broth and extracting it. As a specific embodiment, a high-yielding anthracycline strain was activated on a solid culture medium. The activated mycelium was then cultured in a primary seed medium at 30°C and 220 rpm for 24 hours. A 3.3% inoculum was transferred to a secondary seed medium and cultured at 30°C and 220 rpm for 24 hours. Finally, a 10% inoculum was transferred to a fermentation medium and fermented at 25°C and 220 rpm for 7 days. The fermentation broth was then collected and extracted. As a specific comparative example, wild-type ATCC 31280 and a gene-enhanced expression mutant were activated on a solid culture medium. The activated mycelium was then cultured in a primary seed medium at 30°C and 220 rpm for 24 hours. A 3.3% inoculum was transferred to a secondary seed medium and cultured at 30°C and 220 rpm for 24 hours. Finally, a 10% inoculum was transferred to a fermentation medium and fermented at 25°C and 220 rpm for 7 days. The fermentation broth was then collected and extracted.

[0026] As one embodiment of the present invention, the solid culture medium comprises 0.4 w / v% yeast extract, 1 w / v% malt extract, 0.4 w / v% glucose, and 1.6-2% agar powder. As a specific example, the solid culture medium comprises 0.4 w / v% yeast extract, 1 w / v% malt extract, 0.4 w / v% glucose, and 1.6-2% agar powder.

[0027] As one embodiment of the present invention, the primary seed culture medium comprises 3 w / v TSB, 0.5 w / v yeast extract, and 10.3 w / v sucrose. The secondary seed culture medium comprises 3 w / v TSB, 0.8 w / v yeast extract, 10.3 w / v sucrose, 0.05 w / v isobutanol, and 0.05 w / v isopropanol. As a specific example, the primary seed culture medium comprises 3 w / v TSB, 0.5 w / v yeast extract, and 10.3 w / v sucrose; the secondary seed culture medium comprises 3 w / v TSB, 0.8 w / v yeast extract, 10.3 w / v sucrose, 0.05 w / v isobutanol, and 0.05 w / v isopropanol.

[0028] As one embodiment of the present invention, the fermentation medium comprises 1.6 w / v yeast extract, 1 w / v malt extract, 10.3 w / v sucrose, 2.5 w / v starch, 0.5 w / v isobutanol, 1.2 w / v isopropanol, and 2 mmol / L MgCl2. As a specific example, the fermentation medium comprises 1.6 w / v yeast extract, 1 w / v malt extract, 10.3 w / v sucrose, 2.5 w / v starch, 0.5 w / v isobutanol, 1.2 w / v isopropanol, and 2 mmol / L MgCl2.

[0029] This invention also relates to a precious *Actinomyces fasciculata* strain that produces high levels of anthracycline. The expression of the anthracycline target protein gene is enhanced in this precious *Actinomyces fasciculata* strain to obtain a high-yielding anthracycline strain. The target protein gene is defined as genes APASM_0666, APASM_1807, APASM_5765, and APASM_6307, with sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively.

[0030] This invention also relates to mutant strains HQG-01, HQG-02, HQG-03, and HQG-04, which produce high levels of anserine. The key technical point is the enhanced expression of the anserine target protein gene in these strains.

[0031] The present invention also relates to an integrative plasmid vector for enhancing the expression of anserine target protein genes in vivo, the vector containing target protein genes APASM_0666, APASM_1807, APASM_5765 and APASM_6307; their sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1) By enhancing the expression of target protein genes APASM_0666, APASM_1807, APASM_5765 and APASM_6307 in *Actinomyces rubrum*, the biomass of *Actinomyces rubrum* can be increased, its intracellular toxicity reduced, and feedback inhibition of related synthetic enzymes relieved, ultimately significantly increasing the yield of anthromycin.

[0034] 2) In this invention, high-yielding strains were obtained by enhancing the expression of target protein genes APASM_0666, APASM_1807, APASM_5765 and APASM_6307 in precious actinomycetes. Compared with the starting strains, the fermentation yields of the high-yielding strains HQG-01, HQG-02, HQG-03 and HQG-04 obtained in this invention were increased by 24.1%, 66.5%, 71.5% and 93.5%, respectively, and the laboratory shake-flask fermentation levels reached 57.1 mg / L, 76.6 mg / L, 78.9 mg / L and 89 mg / L, respectively. Attached Figure Description

[0035] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0036] Figure 1 A schematic diagram illustrating the plasmid construction for enhancing the expression of the gene APASM_0666;

[0037] Figure 2 A schematic diagram illustrating the construction of a plasmid to enhance the expression of the APASM_1807 gene;

[0038] Figure 3 A schematic diagram illustrating the plasmid construction for enhancing the expression of the gene APASM_5765;

[0039] Figure 4 A schematic diagram illustrating the construction of a plasmid to enhance the expression of the gene APASM_6307;

[0040] Figure 5 A schematic diagram showing the fermentation yield of anthraquinone from the target protein gene-enhanced mutant strain and the wild-type ATCC 31280. Detailed Implementation

[0041] The present invention will be further illustrated below through embodiments. These embodiments are implemented based on the technical solution of the present invention and provide detailed implementation methods and processes; however, the scope of protection of the present invention is not limited to the following embodiments. Experimental methods in the following embodiments that do not specify specific conditions are performed under conventional conditions or manufacturer's recommended conditions.

[0042] The plasmid pDR3-K* involved in this invention has been described in the SCI database article "Xinjuan Ning, Xinran Wang, Yuanting Wu, Qianjin Kang* and Linquan Bai*: Identification and engineering of post-PKS modification bottlenecks for ansamitocin P-3titer improvement in Actinosynnema pretiosum subsp. pretiosum ATCC 31280. Biotechnology Journal 2017, 12, 1700484".

[0043] The strain ATCC 31280 involved in this invention has been described in the literature "Wenqin Pan, Qianjin Kang, LeiWang, Linquan Bai* & Zixin Deng: Asm8, a specific LAL-type activator of 3-amino-5-hydroxybenzoate biosynthesis in ansamitocin production. Science China LifeSciences 2013(7):601-608".

[0044] Example

[0045] This embodiment describes the specific process for obtaining enhanced expression mutants of the anserin target protein genes APASM_0666, APASM_1807, APASM_5765, and APASM_6307 in vivo, namely HQG-01, HQG-02, HQG-03, and HQG-04. The specific steps are as follows:

[0046] Step 1: Construction of plasmid pLQ-1556

[0047] Using the genomic DNA of the precious *Actinomyces ATCC* 31280 (GenBank assembly accession: GCA_018139085.1) as a template, the APASM_0666 gene fragment (882 bp) was amplified by PCR using primers APASM_0666-F / R with NdeI / EcoRI restriction sites introduced at both ends. The amplified fragment (NdeI / EcoRI) was then inserted into the NdeI / EcoRI site of plasmid pDR3-K* (the strong promoter kasOp* is contained within plasmid pDR3-K*), resulting in plasmid pLQ-1556.

[0048] Step 2: Construction of plasmid pLQ-1562

[0049] Using the genomic DNA of the precious *Actinomyces ATCC* 31280 as a template, the APASM_1807 gene fragment (861 bp) was amplified by PCR using primers APASM_1807-F / R with NdeI / EcoRI restriction sites introduced at both ends. The amplified fragment (NdeI / EcoRI) was then inserted into the NdeI / EcoRI site of plasmid pDR3-K* to obtain plasmid pLQ-1562.

[0050] Step 3: Construction of plasmid pLQ-1554

[0051] Using the genomic DNA of the precious *Actinomyces ATCC* 31280 as a template, the APASM_5765 gene fragment (729 bp) was amplified by PCR using primers APASM_5765-F / R with NdeI / EcoRI restriction sites introduced at both ends. The amplified fragment (NdeI / EcoRI) was then inserted into the NdeI / EcoRI site of plasmid pDR3-K* to obtain plasmid pLQ-1554.

[0052] Step 4: Construction of plasmid pLQ-1553

[0053] Using the genomic DNA of the precious *Actinomyces ATCC* 31280 as a template, the APASM_6307-F / R primer with NdeI / EcoRI restriction sites at both ends was used to amplify the APASM_6307 gene fragment (993 bp) by PCR. The amplified fragment (NdeI / EcoRI) was then inserted into the NdeI / EcoRI site of plasmid pDR3-K* to obtain plasmid pLQ-1553.

[0054] Figure 1This illustrates the process of inserting the target gene APASM_0666 into pDR3-K*. The specific steps are as follows: The constructed gene-enhancing plasmid pLQ-1556 was transformed into the host E. coli ET12567 (containing the pUZ8002 plasmid). E. coli ET12567 (pUZ8002) was cultured overnight at 37°C in LB medium containing 30 μg / mL apramycin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol. Using the same medium, the overnight culture was subcultured once at a 1% ratio and cultured for 4-5 hours until OD (dose retardation). 600 The culture concentration was brought to 0.6-0.8, and then the bacterial cells were rinsed with fresh LB solution to remove antibiotics. Simultaneously, fresh ATCC 31280 mycelium (approximately 16 hours of culture) was prepared, rinsed 2-3 times with LB solution, and then mixed with the previously prepared host bacterium ET12567 (pUZ8002) (recipient cells to donor bacteria ratio approximately 1:10). The mixture was then spread evenly on YMG solid medium containing 10 mM magnesium ions and incubated upside down at 37°C. After 12 hours, the plates were removed, and apramycin (final concentration 100 μg / mL) and nalidixic acid (final concentration 100 μg / mL) were added to 1.5 mL of sterile water, mixed thoroughly, and then spread onto the YMG solid medium. The solid medium was then dried and transferred to a 30°C incubator for upside-down incubation. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. The conjugates are then transferred to YMG solid medium containing two antibiotics, apramycin and nalidixic acid, for further culture. Mycelia are picked, and the correct gene overexpression mutant strain HQG-01 is verified by PCR and resistance verification using kasOp-F and APASM_0666-R primers.

[0055] Figure 2 This illustrates the process of inserting the target gene APASM_1807 into pDR3-K*. The specific steps are as follows: The constructed gene-enhancing plasmid pLQ1652 was transformed into the host E. coli ET12567 (containing plasmid pUZ8002). E. coli ET12567 (pUZ8002) was cultured overnight at 37°C in LB medium containing 30 μg / mL apramycin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol. Using the same medium, the overnight culture was subcultured once at a 1% ratio and cultured for 4-5 hours until OD (Organic Dysfunction Syndrome). 600The culture concentration was brought to 0.6-0.8, and then the bacterial cells were rinsed with fresh LB solution to remove antibiotics. Simultaneously, fresh ATCC 31280 mycelium (approximately 16 hours of culture) was prepared, rinsed 2-3 times with LB solution, and then mixed with the previously prepared host bacterium ET12567 (pUZ8002) (recipient cells to donor bacteria ratio approximately 1:10). The mixture was then spread evenly on YMG solid medium containing 10 mM magnesium ions and incubated upside down at 37°C. After 12 hours, the plates were removed, and apramycin (final concentration 100 μg / mL) and nalidixic acid (final concentration 100 μg / mL) were added to 1.5 mL of sterile water, mixed thoroughly, and then spread onto the YMG solid medium. The solid medium was then dried and transferred to a 30°C incubator for upside-down incubation. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. The conjugates are then transferred to YMG solid medium containing two antibiotics, apramycin and nalidixic acid, for further culture. Mycelia are picked, and the correct gene overexpression mutant strain HQG-02 is verified by PCR and resistance verification using kasOp-F and APASM_1807-R primers.

[0056] Figure 3 This illustrates the process of inserting the target gene APASM_5765 into pDR3-K*. The specific steps are as follows: The constructed gene-enhancing plasmid pLQ1653 was transformed into the host E. coli ET12567 (containing the pUZ8002 plasmid). E. coli ET12567 (pUZ8002) was cultured overnight at 37°C in LB medium containing 30 μg / mL apramycin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol. Using the same medium, the overnight culture was subcultured once at a 1% ratio and cultured for 4-5 hours until OD (Organic Growth Rate). 600The culture concentration was brought to 0.6-0.8, and then the bacterial cells were rinsed with fresh LB solution to remove antibiotics. Simultaneously, fresh ATCC 31280 mycelium (approximately 16 hours of culture) was prepared, rinsed 2-3 times with LB solution, and then mixed with the previously prepared host bacterium ET12567 (pUZ8002) (recipient cells to donor bacteria ratio approximately 1:10). The mixture was then spread evenly on YMG solid medium containing 10 mM magnesium ions and incubated upside down at 37°C. After 12 hours, the plates were removed, and apramycin (final concentration 100 μg / mL) and nalidixic acid (final concentration 100 μg / mL) were added to 1.5 mL of sterile water, mixed thoroughly, and then spread onto the YMG solid medium. The solid medium was then dried and transferred to a 30°C incubator for upside-down incubation. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. The conjugates are then transferred to YMG solid medium containing two antibiotics, apramycin and nalidixic acid, for further culture. Mycelia are picked, and the correct gene overexpression mutant strain HQG-03 is verified by PCR and resistance verification using kasOp-F and APASM_5765-R primers.

[0057] Figure 4 This illustrates the process of inserting the target gene APASM_6307 into pDR3-K*. The specific steps are as follows: The constructed gene-enhancing plasmid pLQ1654 was transformed into the host E. coli ET12567 (containing the pUZ8002 plasmid). E. coli ET12567 (pUZ8002) was cultured overnight at 37°C in LB medium containing 30 μg / mL apramycin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol. Using the same medium, the overnight culture was subcultured once at a 1% ratio and cultured for 4-5 hours until OD (dose retardation). 600The culture concentration was brought to 0.6-0.8, and then the bacterial cells were rinsed with fresh LB solution to remove antibiotics. Simultaneously, fresh ATCC 31280 mycelium (approximately 16 hours of culture) was prepared, rinsed 2-3 times with LB solution, and then mixed with the previously prepared host bacterium ET12567 (pUZ8002) (recipient cells to donor bacteria ratio approximately 1:10). The mixture was then spread evenly on YMG solid medium containing 10 mM magnesium ions and incubated upside down at 37°C. After 12 hours, the plates were removed, and apramycin (final concentration 100 μg / mL) and nalidixic acid (final concentration 100 μg / mL) were added to 1.5 mL of sterile water, mixed thoroughly, and then spread onto the YMG solid medium. The solid medium was then dried and transferred to a 30°C incubator for upside-down incubation. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. The conjugates are then transferred to YMG solid medium containing two antibiotics, apramycin and nalidixic acid, to expand the culture. Mycelia are picked, and the correct gene overexpression mutant strain HQG-04 is verified by PCR and resistance verification using kasOp-F and APASM_6307-R primers.

[0058] The endonuclease recognition sites (cleavage sites) involved in steps one, two, three, and four above are as follows:

[0059]

[0060] The primer sequences used in steps one, two, three, and four above are shown in Table 1:

[0061] Table 1

[0062] APASM_0666-F <![CDATA[GGAATTC CATATG ATGGGTGAGAAGCTGCGG SEQ ID NO.5]]> APASM_0666-R <![CDATA[CCG GAATTC TCACACCGTCACCCTCTC SEQ ID NO.6]]> APASM_1807-F <![CDATA[GGAATTC CATATG GTGCTGGAACGGCTCAAC SEQ ID NO.7]]> APASM_1807-R <![CDATA[CCG GAATTC CTACTCCTTCTCCACAGG SEQ ID NO.8]]> APASM_5765-F <![CDATA[GGAATTC CATATG GTGCAGTTGATCGCGAAG SEQ ID NO.9]]> APASM_5765-R <![CDATA[CCG GAATTC TCCAGCCCGCTGGTGGCG SEQ ID NO.10]]> APASM_6307-F <![CDATA[GGAATTC CATATG ATGCGGGTGCTGGTTACA SEQ ID NO.11]]> APASM_6307-R <![CDATA[CCG GAATTC TCAGCGGGCCAGGGAGGC SEQ ID NO.12]]> kasOp-F GTGCGGTGTTGTAAAGTCGT SEQ ID NO.13

[0063] The PCR system and conditions used in steps one, two, three, and four above for gene fragment preparation are as follows:

[0064] PCR reaction system: DNA template 30 ng, primers 30 pmol, 50% DMSO 3 μL, 25 mM Mg 2+ 2 μL, 3 μL buffer, 1 unit of KOD polymerase, add pure water to make up to 30 μL;

[0065] PCR conditions: 95℃ for 5 min; 95℃ for 30 s; 60℃ for 30 s; 68℃ for 1-2 min; 30 cycles; 68℃ for 10 min.

[0066] Step 5: HPLC was used to determine the fermentation yield of anserine.

[0067] Chromatographic analysis was performed using an Agilent 1200 series HPLC system from Agilent Technologies, and the chromatographic absorption peak at 254 nm was determined using a DAD ultraviolet absorption detector.

[0068] The HPLC parameters are as follows:

[0069] Column: Agilent ZORBAX SB-C18, 2.1×150mm, 3.5μm;

[0070] Mobile phase flow rate: 1 mL / min;

[0071] Mobile phase: gradient elution of aqueous solution and HPLC grade methanol.

[0072] Column temperature: room temperature.

[0073] Figure 5 To enhance the fermentation level of anserine after expressing the target protein genes APASM_0666, APASM_1807, APASM_5765, and APASM_6307, the results showed that enhanced expression of these genes significantly improved the fermentation level of anserine. Compared with wild-type ATCC 31280, the high-yielding strains HQG-01, HQG-02, HQG-03, and HQG-04 obtained in this invention showed increased fermentation yields of 24.1%, 66.5%, 71.5%, and 93.5%, respectively, with laboratory shake-flask fermentation levels reaching 57.1 mg / L, 76.6 mg / L, 78.9 mg / L, and 89 mg / L, respectively.

[0074] In summary, this invention utilizes the strong promoter kasOp* to enhance the expression of the in vivo target proteins APASM_0666, APASM_1807, APASM_5765, and APASM_6307 of anserin in the precious *Actinomyces argentea* ATCC 31280, resulting in high-yielding anserin-producing mutant strains HQG-01, HQG-02, HQG-03, and HQG-04. Enhancing the transcriptional level of the anserin target protein genes can increase the biomass of *Actinomyces argentea*, reduce its intracellular toxicity, and relieve feedback inhibition of related synthetic enzymes, ultimately significantly increasing anserin production.

[0075] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for improving the fermentation level of anthracycline, characterized in that, In the precious bundle of actinomycetes ( Actinosynnema pretiosum The expression of the in vivo target protein gene of anserine was enhanced in the cell to obtain an anserine-producing strain, and anserine was obtained by fermentation. The target protein gene is a gene. APASM_1807 Its sequence is shown in SEQ ID NO.

2.

2. The method for improving the fermentation level of anthracycline as described in claim 1, characterized in that, Enhancing the in vivo target protein gene of anthracycline in the precious actinomycete ATCC 31280 specifically includes the following steps: S1, Design and construct genes for enhancing expression APASM_1807 Integrative plasmid II; The specific method for constructing the integrative plasmid II is as follows: 861 bp plasmids are obtained from the ATCC 31280 genome via PCR amplification. APASM_1807 Gene fragments were ligated into the integrative plasmid pDR3-K* via enzyme digestion and ligation. Nde I / Eco RI site; S2, the integrative plasmid II was introduced into the recipient strain via conjugation transfer, and then the mutant strain was tested for apramycin resistance. Mycelia were selected and the gene-enhanced expression mutant strain was screened by the difference in the size of the PCR product fragments.

3. The method for improving the fermentation level of anthracycline as described in claim 1, characterized in that, The fermentation process includes the following steps: inoculating the mycelium of the activated anthromycin in vivo target protein gene-enhanced mutant strain into a primary seed medium and culturing it at 30°C and 220 rpm for 24 hours; transferring it to a secondary seed medium at an inoculum of 3.3% and culturing it at 30°C and 220 rpm for 24 hours; transferring it to a fermentation medium at an inoculum of 10% and fermenting it at 25°C and 220 rpm for 7 days, then collecting the fermentation broth and extracting it.

4. The method for improving the fermentation level of anthracycline as described in claim 3, characterized in that, The primary seed culture medium comprises 3 w / v TSB, 0.5 w / v yeast extract, and 10.3 w / v sucrose. The secondary seed culture medium comprises 3 w / v TSB, 0.8 w / v yeast extract, 10.3 w / v sucrose, 0.05 v / v isobutanol, and 0.05 v / v isopropanol. The fermentation medium comprises 1.6 w / v yeast extract, 1 w / v malt extract, 10.3 w / v sucrose, 2.5 w / v starch, 0.5 v / v isobutanol, 1.2 v / v isopropanol, and 2 mmol / L MgCl2.

5. A precious bundle-filament actinomycete producing anthracycline, characterized in that, An anserin-producing strain was obtained by enhancing the expression of the in vivo target protein gene of the rare actinomycete *Actinomyces ATCC* 31280; the target protein gene is a gene... APASM_1807 Its sequence is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Methods for the production of ansamitocins

    CN101103120A

  • Design method for synthetic genes

    US20160076052A1