Application of targeting ZC3H18 / PD-L1 signaling axis in tumor immune escape detection, treatment, and prognosis

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to an application of targeting the ZC3H18 / PD-L1 signaling axis in tumor immune escape detection, treatment, and prognosis. The present invention finds that when ZC3H18 is overexpressed, the body significantly promotes the immunotherapy escape of tumors (such as pancreatic cancer) by recruiting and binding to CSNK2A1 and PRMT5 to enhance the transcriptional activity of PD-L1; the present invention combines the use of reagents that inhibit the expression of CSNK2A1 and PRMT5 to make pancreatic cancer with ZC3H18 overexpression more sensitive to immunotherapy; these results illustrate the important role of ZC3H18 in tumor immunotherapy escape, and can be used as a new treatment strategy for ZC3H18-overexpressing tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to an application of targeting the ZC3H18 / PD-L1 signaling axis in tumor immune escape detection, treatment, and prognosis. Background Art

[0002] Pancreatic cancer is an extremely aggressive malignancy and the fourth most common cause of cancer-related death worldwide, with the highest incidence in Europe, North America, and Australia / New Zealand. Despite advances in the diagnosis and treatment of pancreatic cancer in recent decades, the overall prognosis is extremely poor, with a median survival of 6 months and a 5-year survival of approximately 9%. According to statistics, the incidence of pancreatic cancer will become the third leading cause of cancer death in 2025. The stubbornness of this complex disease stems from several factors, including late diagnosis, lack of sensitive and specific biomarkers, early spread of metastatic lesions, and especially resistance to chemotherapy, radiotherapy, and currently available targeted therapies. Therefore, revealing the molecular mechanisms of the malignant development of pancreatic cancer and finding key molecules that induce tolerance to pancreatic cancer targeted drugs will provide important scientific basis for the prevention and treatment of pancreatic cancer and have important clinical significance for improving the survival prognosis of tumor patients.

[0003] Zinc finger CCCH domain protein 18 (ZC3H18) is a newly discovered gene located on chromosome 16 and is a multidomain protein involved in mRNA biogenesis and transcriptional regulation. It is a trans-acting factor that enhances the transcription of downstream genes. Previous studies have shown that ZC3H18 plays a crucial role in the transformation of blood-type trypanosomes of tsetse fly to the forward ring type. Genome-wide analysis showed that ZC3H18 contributes to the transcription of specific protein-coding genes, which depends on its cbc interaction domain as well as its NEXT- and / or histone interaction domain. In addition, ZC3H18 has been shown to specifically bind to and activate the BRCA1 promoter and promote homologous recombination in high-grade serous ovarian cancers (HGSOCs).

[0004] Immunotherapy has emerged as a very promising cancer treatment that complements traditional therapies such as surgery, radiotherapy, and chemotherapy. It is noteworthy that current immunotherapy strategies include immune checkpoint blockade targeting the programmed cell death 1 (PD-1) / programmed cell death 1 ligand 1 (PD-L1) axis signaling pathway. Preclinical and clinical studies have demonstrated the efficacy of PD-1 / PD-L1 blockade in various cancer types, including melanoma, lung cancer, and renal cancer, with durable antitumor responses achieved in a significant proportion of cases. However, PD-L1 inhibitors alone have limited efficacy in improving the prognosis of pancreatic cancer. For example, a study by Amita Patnaik et al. reported that the partial response rate was only 25.0% in pancreatic cancer patients treated with a combination of PD-L1 inhibitors and melastinib, and the duration of response was relatively short (9.8 months). In addition, there is evidence that although the combination of PD-L1 checkpoint inhibition and chemotherapy has shown promise, PD-L1 inhibitor monotherapy has failed to produce significant efficacy in pancreatic cancer patients. Therefore, a comprehensive understanding of the detailed mechanisms of the PD-1 / PD-L1 axis is crucial for identifying PD-L1-based combination therapies and developing new therapeutic strategies for pancreatic cancer.

[0005] Aberrant expression of PD-L1 is a common phenomenon in various malignancies, leading to immune evasion and poor clinical outcomes. Dysregulation of PD-L1 expression in cancer can be caused by both exogenous and intrinsic oncogenic changes. For example, Qin et al. have shown that the transcriptional activator NPM1 specifically binds to the PD-L1 promoter in TNBC cells, thereby activating PD-L1 transcription. In addition, β-catenin promotes PD-L1 expression in glioblastoma by binding the β-catenin / TCF / LEF complex to the promoter region of the PD-L1 gene, thereby promoting immune evasion of glioblastoma and promoting the expansion of cancer stem cells. In pancreatic cancer, elevated PD-L1 expression is associated with poor overall survival, positive lymph node involvement, advanced tumor stage, and poor differentiation. Other studies have shown that NEK2 can inhibit the degradation of PD-L1 in pancreatic cancer, while HDAC5 can regulate PD-L1 expression through p65 deacetylation. In addition, C-FOXP3 directly binds to the promoter region of PD-L1 and induces the expression of PD-L1. However, the precise transcriptional regulation of PD-L1 in pancreatic cancer remains largely unknown, and there is an urgent need to elucidate the key regulators of PD-L1. Summary of the invention

[0006] The purpose of the present invention is to address the problems existing in the prior art. The present invention provides an application of targeting the ZC3H18 / PD-L1 signaling axis in tumor immune escape detection, treatment and prognosis.

[0007] To achieve the above-mentioned purpose, the present invention provides the following technical solutions:

[0008] The application of ZC3H18 as an early warning target molecule in immune escape in tumor treatment and a detection target for predicting immune escape in tumor immunotherapy.

[0009] A reagent for quantitatively detecting ZC3H18 is used as an early warning target molecule in the preparation of tumor treatment immune escape and a detection target for predicting immune escape in tumor immunotherapy. The reagent for quantitatively detecting ZC3H18 is selected from at least one of a reagent for detecting whether the ZC3H18 gene is overexpressed, a reagent for quantitatively detecting the RNA transcription level of ZC3H18, and a reagent for quantitatively detecting the protein expression level of ZC3H18.

[0010] Application of a substance that inhibits the expression of ZC3H18 protein in the preparation of a drug for improving the efficacy of tumors against PD-L1 monoclonal antibodies.

[0011] A reagent for inhibiting the expression of CSNK2A1 and PRMT5 is used in the preparation of a drug for treating ZC3H18 overexpressed tumors.

[0012] The invention discloses an application of a reagent for inhibiting the expression of CSNK2A1 and PRMT5 in the preparation of a drug for improving the immunotherapy effect of ZC3H18 overexpressed tumors. The reagent for inhibiting the expression of CSNK2A1 and PRMT5 is the chemical drugs GSK3326595 and CX-4945.

[0013] A reagent for detecting the expression of CSNK2A1, PRMT5, and PD-L1 is used in the preparation of a detection kit for a therapeutic target molecule in tumor immunotherapy or in a detection kit for predicting the effect of tumor immunotherapy.

[0014] A detection kit for tumor immunotherapy, tumor prognosis, or / and prediction of tumor immunotherapy effect, the kit containing a reagent for detecting ZC3H18, or / and a reagent for detecting the expression amount of CSNK2A1, PRMT5, and PD-L1.

[0015] Preferably, the reagents in the kit are selected from at least one of a reagent for detecting whether the ZC3H18 gene is overexpressed, a reagent for quantitatively detecting the RNA transcription level of ZC3H18, and a reagent for quantitatively detecting the protein expression level of ZC3H18.

[0016] A medicament for improving the efficacy of tumor immunotherapy, the medicament containing at least one of a substance that inhibits the expression of ZC3H18 protein and an agent that inhibits the expression of CSNK2A1 and PRMT5.

[0017] A medicament for inhibiting the immunotherapy efficacy of a ZC3H18 overexpressing tumor, the medicament comprising at least one of a substance for inhibiting the expression of ZC3H18 protein and an agent for inhibiting the expression of CSNK2A1 and PRMT5.

[0018] The beneficial effects of the present invention include at least:

[0019] 1) The present invention found that when ZC3H18 is overexpressed, the body significantly promotes the escape of tumors (such as pancreatic cancer) from immunotherapy by recruiting and binding CSNK2A1 and PRMT5 to enhance the transcriptional activity of PD-L1. The present invention uses a combination of agents that inhibit the expression of CSNK2A1 and PRMT5 to make pancreatic cancer with ZC3H18 overexpression more sensitive to immunotherapy. These results illustrate the important role of ZC3H18 in tumor immunotherapy escape and can be used as a new treatment strategy for ZC3H18 overexpressing tumors;

[0020] 2) The present invention discovered the application of the ZC3H18 gene in the diagnosis, treatment and prognosis of pancreatic cancer that escapes tumor immunotherapy. The present invention successfully constructed a pancreatic cancer cell model that stably overexpressed ZC3H18 and interfered with the expression of ZC3H18, successfully established a mouse pancreatic cancer tumor model, and found through cell co-culture technology, flow cytometry and other experimental analyses that inhibition of ZC3H18 can enhance anti-tumor immunity in vivo and in vitro. The present invention used gene ontology (GO) enrichment analysis, PPI network analysis, Western Blot and TCGA database analysis to find that upregulated ZC3H18 protein expression is closely related to pancreatic cancer tumor immunotherapy escape. Therefore, the research results will provide a new mechanism for ZC3H18 to regulate tumor immunotherapy escape;

[0021] 3) At the mechanism level, the present invention uses ZC3H18 antibody and performs Tag-seq detection. Through CHIP-PCR, luciferase reporter gene experiments, etc., it is revealed that ZC3H18 binds to the PD-L1 promoter and increases the transcriptional activity of PD-L1. Through mass spectrometry experiments, immunoprecipitation technology and ChIP experiments, it is found that ZC3H18 increases the expression of PD-L1 in pancreatic cancer and promotes tumor immunotherapy escape. The role of transcription factor ZC3H18 in recruiting human casein kinase CSNK2A1 and protein arginase methyltransferase PRMT5 protein to promote PD-L1 expression is deeply explored, and the specific binding area of ​​ZC3H18 / CSNK2A1 / PRMT5 axis and downstream gene PD-L1 promoter is analyzed, which provides a new molecular regulatory mechanism for oncogene ZC3H18 to regulate target genes. Finally, the present invention uses collected pancreatic cancer clinical samples to perform immunohistochemistry and other experiments and analyzes them. It is found that the combined use of CSNK2A1 and PRMT5 inhibitors greatly reduces the expression of PD-L1 protein in tumors. This suggests that the ZC3H18 gene can be used as an important target molecule to promote the escape of tumor immunotherapy in patients. In summary, this study found that ZC3H18 is an important promoter of pancreatic cancer cell immune escape, which is of great significance in the development of cancer. This will provide a new treatment direction for clinical tumor immunotherapy. The present invention provides a new diagnosis, treatment method and drug screening platform for tumor diseases.

[0022] The features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Flowchart for screening and analyzing candidate protein factors that specifically target the PD-L1 promoter.

[0024] Figure 2 Schematic diagram of the effect of silencing different genes on PD-L1 expression.

[0025] Figure 3 Schematic diagram of protein bands in western blot of pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line).

[0026] Figure 4 Schematic diagram of PD-L1 protein expression levels in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) by flow cytometry.

[0027] Figure 5The distribution of ZC3H18 Cuttool Peaks (a) is used to obtain the distribution of ZC3H18; the schematic diagram of ZC3H18Cuttag-seq (b) is used to detect and analyze the expression of ZC3H18 gene; the schematic diagram of gene spacing (c) shows the interaction and regulatory relationship between genes; the schematic diagram of ZC3H18Cuttag-Seq analyses (d) shows the relationship between ZC3H18 gene and PD-L1 gene in the control group and ZC3H18 gene overexpression group.

[0028] Figure 6 The enrichment degree of ZC3H18 and IgG on the PD-L1 gene in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) (a), where GADPH is used as an internal reference protein to correct the error in the experiment; the luciferase activity of ZC3H8 in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) and the control group (b).

[0029] Figure 7 It is the enrichment degree of different proteins in the PD-L1 promoter region, where GAPDH is the internal reference protein, and P1, P2, etc. represent different proteins.

[0030] Figure 8 This is the mass spectrometry analysis result of PRMT5 (A). The vertical axis is a marker to correct the error in the experiment; the enrichment degree of ZC3H18 in the PD-L1 promoter region of pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) (B).

[0031] Fig. 9 Schematic diagram of the interaction between ZC3H18-Flag fusion protein and PRMT5 in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) (C), the relationship between PD-L1 promoter and H3R2me1, H3R2me2s, and ZC3H18 (D), the expression levels of H3K4me3, poll and lgG in input and the relationship between them (E), the effect of ZC3H18 and PRMT5-si on the expression level of PD-L1 mRNA in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) (F); the difference in fluorescence intensity between ZC3H18 and vector in control and silencing PRMT5, respectively (G).

[0032] Fig.10is the mass spectrum of CSNK2A1 (A); schematic diagram of western blot bands of pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line), showing the relative expression levels of ZC3H18 and CSNK2A1, where input and IgG were used as internal reference proteins to correct the experimental results (B); schematic diagram of protein immunoblotting experiment, showing the relative expression levels of Flag-ZC3H18 and GST-CSNK2A1, where GST was used as an internal reference protein to correct the experimental results (C); enrichment level of ZC3H8 and CSNK2A1 in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) in immunoprecipitation experiment (D).

[0033] Fig.11 Schematic diagram of protein bands showing the effects of different concentrations of CX-4945 on the expression of CSNK2A1, H2A, and p-Y57 H2A proteins (E); Schematic diagram of protein bands showing the effects of CX-4945, Flag-H2A (Y57F), Flag-H2A (WT), ZC3H18, and vector on the protein expression levels of H2A, H3, and H3K4me3 (F).

[0034] Fig.12 Schematic diagram of the effect of shRNA, Control, ZC3H18 and vector on the expression of ZC3H18 protein in cells on tumor cell size (A); Schematic diagram of the effect of Vector, ZC3H18, shRNA and Control on tumor volume (B), Schematic diagram of the effect of Vector, ZC3H18, shRNA and Control on tumor weight (C), the effect of Vector, ZC3H18, shRNA and Control on CD8 and CD3 (D), the effect of Vector, ZC3H18, shRNA and Control on IFN-r, TNF-a, GzmB and serum evel (E).

[0035] Fig.13 The effects of Vector, ZC3H18, shRNA and Control on CD8 and CD3 (A), and the schematic diagram of the relative protein expression levels of IFN-r, TNF-a, GzmB and serum evel in pancreatic cancer cell lines (Panc02 cell line and MiaPaCa-2 cell line) (B).

[0036] Fig.14Yes; Schematic diagram of drug administration for different treatment methods (A); Schematic diagram of tumor cell size for different treatment methods (B); Schematic diagram of the effect of different treatment methods on tumor volume (C); Schematic diagram of the effect of different treatment methods on tumor weight (D); Schematic diagram of the effect of different treatment methods on PD-L1 expression in tumor cells (E); Among them, the treatment methods are control group, PD-L1 monotherapy group, CX-4945 monotherapy group, GSK3326595 monotherapy group and combination treatment group. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and beneficial effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, and are intended to be used to explain the present invention, but do not constitute a limitation of the present invention.

[0038] The endpoints of the scope disclosed in this article and any value are not limited to this accurate scope or value, and these scopes or values ​​should be understood as comprising values ​​close to these scopes or values.For numerical range, between the endpoint values ​​of each scope, between the endpoint values ​​of each scope and a separate point value, and between separate point values, one or more new numerical ranges can be combined with each other, and these numerical ranges should be considered as specifically disclosed in this article.In the description of the application, unless otherwise stated, the meaning of similar words such as "one / a kind", "multiple / multiple" is two / kinds or more than two / kinds.

[0039] Example 1: ZC3H18 can increase the expression of PD-L1 in pancreatic cancer

[0040] (1) Screening and analysis of candidate protein factors that specifically target the PD-L1 promoter: Design sgRNA that specifically targets the PD-L1 promoter, use the biotin-coupled inactivated Caspase9 system for capture analysis and LC-MS / MS to screen candidate protein factors that specifically target the PD-L1 promoter, use STRING to screen 14 proteins through the PPI network, and then use IP / MS for identification and analysis. At the same time, further interaction analysis of key genes involved in the transcriptional regulation of PD-L1 was performed, and the top 15 genes with strong interactions (based on protein abundance) were selected. After the expression of the 15 genes was inhibited separately using small RNA interference technology, the mRNA expression level of PD-L1 was detected. (e.g. Figure 1 , 2)

[0041] Results: Among the screened effective PD-L1 promoter-related proteins, only silencing ZC3H18, CSNK2A1 or PRMT5 alone could reduce the mRNA level of PD-L1, and ZC3H18 was the most significant gene in reducing PD-L1.

[0042] Conclusion: ZC3H18 is the gene that most significantly reduces the expression level of PD-L1.

[0043] (2) Establishment of Panc02 cell line stably expressing ZC3H18 cDNA and ZC3H18 RNAi(s) Methods: The coding sequences of human ZC3H18 and mouse ZC3H18 genes were cloned into the pCDH-CMV-MCS-3Flag-EF1-CopGFP-T2A-Puro vector by multisite cloning. ZC3H18-RNAi(s) were generated using the PLKO-U6-EGFP-P2A-PURO vector. ZC3H18 plasmid or shRNA was transfected using Lipofectamine3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Western blot was subsequently performed (e.g. Figure 3 ) and flow cytometry experiments (e.g. Figure 4 ) for further verification.

[0044] The RNA sequence for silencing ZC3H18 is:

[0045] CCGGCCAGCACGGTTCTCATGTAAACTCGAGTTTACATGAGAACCGTG CTGGTTTTTG(SEQ IDNO:1)

[0046] Results: Pancreatic cancer cell lines with ZC3H18 overexpression, ZC3H18 silencing and blank control were obtained, and it was found that compared with the control group, overexpression of ZC3H18 caused a continuous upregulation of PD-L1 protein level, while silencing of ZC3H18 caused a downregulation of PD-L1 protein level.

[0047] Conclusion: Pancreatic cancer cell lines stably expressing ZC3H18 and silencing ZC3H18 were established. At the same time, it was found that ZC3H18 increased the expression of PD-L1 in pancreatic cancer cells.

[0048] Example 2: ZC3H18 binds to the PD-L1 promoter and increases the transcriptional activity of PD-L1.

[0049] (1) To investigate the molecular mechanism by which ZC3H8 upregulates PD-L1 protein levels in pancreatic cancer.

[0050] Methods: CUT&Tag-seq was performed using the ZC3H18 antibody (e.g. Figure 5), and then the correlation between ZC3H18 and PD-L1 promoter was detected by CHIP-PCR (such as Figure 6 -a). Luciferase reporter gene was used to detect the luciferase activity of the PD-L1 promoter (e.g. Figure 6 -b).

[0051] Results: Sequencing analysis indicated that PD-L1 might be an effective target of ZC3H18. CHIP-PCR results showed that ZC3H18 was significantly associated with the PD-L1 promoter. Luciferase reporter gene assay showed that overexpression of ZC3H18 could enhance the luciferase activity of the PD-L1 promoter, while knockdown of ZC3H18 reduced the luciferase activity of the PD-L1 promoter.

[0052] Conclusion: ZC3H18 is significantly associated with the PD-L1 promoter. Overexpression of ZC3H18 can reduce the luciferase activity of the PD-L1 promoter, while knockdown of ZC3H18 can reduce the luciferase activity of the PD-L1 promoter. (2) Study whether ZC3H18 is involved in the transcriptional regulation of PD-L1 Method: The PD-L1 promoter (-2500 bp) was segmented (e.g. Figure 7 ).

[0053] Results: ZC3H18 was found to bind to region 3 within the PD-L1 promoter region.

[0054] Conclusion: ZC3H18 binds to region 3 within the PD-L1 promoter region.

[0055] Example 3: PRMT5 is required for ZC3H18-induced PD-L1 upregulation

[0056] (1) To explore the mechanism by which ZC3H18 upregulates PD-L1 transcription: IP / MS was used to analyze the interacting proteins of ZC3H18 (such as Figure 8 -A), and combined with CHIP-PCR detection for analysis (such as Figure 8 -B).

[0057] Results: IP / MS analysis revealed that PRMT5 might be an effective interacting protein of ZC3H18. CHIP-PCR assay revealed that inhibiting the expression of PRMT5 significantly reduced the transcriptional activity level of PD-L1 in ZC3H18 overexpressing cells.

[0058] Conclusion: PRMT5 is an effective interacting protein of ZC3H18 and is involved in the transcriptional regulation of ZC3H18 on PD-L1.

[0059] (2) Detection of whether PRMT5 is involved in ZC3H18-induced PD-L1 upregulation

[0060] Methods: Co-immunoprecipitation (co-IP) was used to analyze the interaction between ZC3H18 and PRMT5 (e.g. Fig. 9 ), and in pancreatic cancer cells, CHIP-qPCR analysis was performed after enrichment of histone translation modification on the PD-L1 promoter. In addition, the cells were analyzed by flow cytometry for the mean fluorescence intensity (MFI) of PD-L1.

[0061] Results: Co-immunoprecipitation (co-IP) analysis revealed that ZC3H18 interacted with PRMT5 both in vitro and in vivo. The enrichment level of H3R2me1 on the PD-L1 promoter was significantly increased in ZC3H18-overexpressing pancreatic cancer cells, whereas it was reduced in ZC3H18-silenced cells. However, we found that silencing PRMT5 using siRNA or inhibiting PRMT5 activity using EPZ015866 significantly reduced the levels of H3R2me1 and H3R2me2s on the PD-L1 promoter in ZC3H18-overexpressing pancreatic cancer cells. It was also found that inhibition of PRMT5 or WDR5 significantly reduced the abundance of H3K4me3 and polymerase II on the PD-L1 promoter in pancreatic cancer cells. Importantly, silencing PRMT5 reduced the mRNA and protein levels of PD-L1 in ZC3H18-overexpressing pancreatic cancer cells.

[0062] Conclusion: PRMT5-mediated H3R2me1 and H3R2me2s modifications are involved in the upregulation of PD-L1 expression by ZC3H18. ZC3H18 methylates H3R through PRMT5, thereby methylating H3K4 in the PD-L1 promoter, thereby increasing the transcription level of ZC3H18.

[0063] Example 4: CSNK2A1 regulates H2A tyrosine phosphorylation and increases ZC3H18-induced transcriptional activation of PD-L1

[0064] (1) Explore other factors involved in the transcriptional activation of PD-L1 in pancreatic cancer

[0065] Methods: LC-MS / MS was also used to screen candidate protein factors that specifically target the PD-L1 promoter, and affinity purification / mass spectrometry (IP / MS) was used to identify their relationship with ZC3H18 and analyzed by co-IP and western blotting (e.g. Fig.10 ).

[0066] Results: CSNK2A1 is also one of the regulatory proteins of PD-L1 promoter, and IP / MS identification revealed that CSNK2A is one of the proteins interacting with ZC3H18. The results of Co-IP and western blotting showed that CSNK2A1 directly interacted with ZC3H18.

[0067] Conclusion: CSKN2A1 and ZC3H18 are interacting proteins.

[0068] (2) Analysis of the effects of other factors on ZC3H18-induced PD-L1 transcription

[0069] Methods: CHIP-PCR was used to detect the effect of CSNK2A1 expression on the transcription level of PD-L1 in ZC3H18 overexpressing cells. Western blotting was used to detect whether CX-4945, a small molecule inhibitor of CSNK2A1, affects the tyrosine phosphorylation level on H2A by affecting the activity of CSNK2A1 (e.g. Fig.11 ).

[0070] Results: CHIP-PCR assay revealed that inhibition of CSNK2A1 expression significantly reduced the transcription level of PD-L1 in ZC3H18 overexpressing cells. Western blotting revealed that inhibition of CSNK2A1 activity using CX-4945 significantly reduced the level of tyrosine phosphorylation on H2A in pancreatic cancer cells overexpressing ZC3H18. Western blotting also revealed that Y57 mutation or use of CX-4945 would lead to loss of H3K4me3 protein, but would not lead to loss of H3K4me2 in pancreatic cancer cells overexpressing ZC3H18.

[0071] Conclusion: CSNK2A1-regulated H2A tyrosine phosphorylation increases ZC3H18-induced PD-L1 transcriptional activation.

[0072] Example 5: Inhibition of ZC3H18 can enhance anti-tumor immunity in vivo

[0073] Methods: Tumor cell subcutaneous implantation mouse model: C57BL / 6 mice were randomly divided into two groups (n=5 / group). Cell lines (Panc02 / Vector, Panc02 / ZC3H18, Panc02 / Control, Panc02 / ZC3H18-shRNA) were injected subcutaneously into the left dorsal flank of C57BL / 6 mice. Tumors and mouse body weights were checked twice a week. The length and width of the tumor were measured with a caliper, and the tumor volume was calculated using the formula (L*W2) / 2. On day 28, the animals were euthanized and the tumors were removed for flow cytometry detection (such as Fig.12 ).

[0074] Results: In vivo experiments in mice showed that mice injected with Panc02 / ZC3H18 cells formed larger tumors, while mice injected with Panc02 / ZC3H18-shRNA cells formed smaller tumors in size and weight than the control group. Analysis of tumor-infiltrating lymphocytes by flow cytometry revealed that the number of CD3+CD8+T cells increased significantly in ZC3H18-silenced tumors, while it decreased significantly in ZC3H18-overexpressing tumors. In addition, serum levels of various immune-related cytokines produced by CD8+T cells, including IFN-γ, TNF-a, and GzmB, were significantly increased in ZC3H18-silenced tumors, while they were significantly decreased in ZC3H18-overexpressing tumors.

[0075] Conclusion: Inhibition of ZC3H18 expression can inhibit pancreatic cancer tumor growth and enhance anti-tumor immunity.

[0076] Example 6: Inhibition of ZC3H18 can enhance anti-tumor immunity in vitro

[0077] Methods: CD8+T cells were obtained from the spleen of C57BL / 6 mice, cultured in RPMI-1640 medium containing 10% fetal bovine serum, 1% glutamine, 1% β-mercaptoethanol and 1% penicillin-streptomycin, and placed in a cell culture incubator. After 24 hours, the above CD8+T cells were co-cultured with Panc02 cell lines (Panc02 / Vector, Panc02 / ZC3H18, Panc02 / Control, Panc02 / ZC3H18 shRNA) for 48 hours, and after treatment with stimulators (BioLegend), flow cytometry was used to analyze the cells. At the same time, human jurkat T cells were co-cultured with Miapaca-2 cells and analyzed by flow cytometry. The results were analyzed using FlowJo X (as shown in Figure 2). Fig.13 ).

[0078] Results: Flow cytometry analysis showed that overexpression of ZC3H18 significantly reduced the level of CD3+CD8+T cells, while ZC3H18 deficiency significantly increased the number of CD3+CD8+T cells. Human jurkat T cells were co-cultured with Miapaca-2 cells, and it was found that the number of D3+CD8+T cells was significantly reduced in ZC3H18 overexpression, while ZC3H18 deficiency significantly increased the number of CD3+CD8+T cells. Importantly, immune-related cytokines such as IFN-γ, TNF-a, and GzmB were significantly increased in ZC3H18-silenced cells, while significantly decreased in ZC3H18-overexpressing cells.

[0079] Conclusion: Inhibition of ZC3H18 can enhance the anti-tumor immunity of pancreatic cancer in vitro.

[0080] Example 7: GSK3326595 and CX-4945 combined with anti-PD-L1 treatment has a better effect

[0081] Methods: Panc02 / ZC3H18 cell line was first injected subcutaneously into the left dorsal flank of C57BL / 6 mice. The control group was treated with IgG and DMSO; the GSK3326595 monotherapy group was treated with IgG and GSK3326595; and the CX-4945 monotherapy group was given IgG and CX-4945, respectively. The anti-PD-L1 monotherapy group was given DMSO and anti-PD-L1 daily; once every 4 days. The combination treatment group was treated with GSK3326595, CX-4945 and anti-PD-L1. Tumor size was checked twice a week. The length and width of the tumor were measured with a caliper, and the tumor volume was calculated using the formula (L*W2) / 2. At the end of the treatment, the mice were killed, the tumors were removed, part of which was used for paraffin embedding and IHC analysis; part of which was used for flow cytometry detection (such as Fig.14 ).

[0082] Results: The results of in vivo experiments in mice showed that the combined treatment of GSK3326595, CX-4945 and α-PD-L1 most significantly reduced tumor size and weight. Immunohistochemistry experiments showed that the combined treatment of GSK3326595, CX-4945 and α-PD-L1 significantly reduced the PD-L1 positive rate compared with single treatment and the control group.

[0083] Conclusions: These data suggest that both PRMT5 and CSNK2A1 are involved in the epigenetic upregulation of PD-L1 induced by ZC3H18, and that α-PD-L1 has a better therapeutic effect with GSK3326595 and CX-4945 on pancreatic cancer with ZC3H18 overexpression.

Claims

1. Application of ZC3H18-RNAi shown in SEQ ID NO: 1 in the preparation of drugs for treating pancreatic cancer.

2. Application of GSK3326595, CX-4945 and PD-L1 antibody in the preparation of drugs for the treatment of pancreatic cancer.

3. A drug for improving the efficacy of immunotherapy for pancreatic cancer, characterized in that: The agent consists of GSK3326595, CX-4945 and PD-L1 antibody.

Images