Molecular marker for identifying cms lines and maintainer lines of capsicum and application thereof
By sequencing the mitochondrial genomes and developing molecular markers for the CMS and maintainer lines of pepper, and using the orf115c-Indel marker for PCR amplification and electrophoresis detection, the problem of identifying the CMS and maintainer lines of pepper was solved, improving breeding efficiency and reducing costs.
Patent Information
- Application Number
- CN202311533268.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-16
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2043-11-16
AI Technical Summary
Existing technologies are insufficient for efficiently identifying CMS lines and maintainer lines in chili peppers, making manual emasculation time-consuming and labor-intensive, and making it difficult to guarantee the purity of hybrids, thus increasing breeding costs.
By sequencing, assembling, and annotating the mitochondrial genomes of the pepper CMS line 'BA3' and its maintainer line 'BB3', three candidate genes, orf115c, orf249, and orf314, were screened out. A specific molecular marker, orf115c-Indel, was developed. PCR amplification and gel electrophoresis were performed using the specific molecular marker orf115c-Indel to distinguish between the CMS line and the maintainer line.
This technology enables rapid identification of CMS lines and maintainer lines in chili peppers, improving breeding efficiency and reducing the cost of breeding and hybrid seed production.
Smart Images

Figure CN117487953B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of vegetable molecular breeding, and particularly relates to a molecular marker for identifying pepper CMS lines and maintainer lines and application thereof. BACKGROUND
[0002] Pepper (Capsicum spp.) is also called sea pepper, hot pepper, etc., belongs to Solanaceae, originated in Central and South America, and has become one of the important economic crops in the world. The annual sowing area of pepper in China is more than 30 million mu, accounting for 8-10% of the total sowing area of vegetables in China, and the agricultural output value is about 250 billion yuan, ranking first in sowing area and output value of vegetable crops in China. Pepper has obvious heterosis, and the hybrid generation varieties are mainly used in the market. Because pepper is self-compatible and the anther is small, artificial detasseling is time-consuming and laborious, and cannot guarantee the purity of hybrid seeds. The use of pepper CMS (cytoplasmic male sterility) lines, maintainer lines and restorer lines for three-line hybrid seed production can effectively solve the above problems.
[0003] Molecular marker-assisted selection breeding is an important technical means to improve the genetic improvement efficiency of crop traits. The development of specific molecular markers for identifying pepper CMS lines and maintainer lines can identify pepper CMS lines and maintainer lines at an early stage of growth and development, thereby improving the efficiency of pepper CMS line breeding and reducing breeding costs, which has important production application value. SUMMARY
[0004] The purpose of the present application is to provide a molecular marker for identifying pepper CMS lines and maintainer lines and application thereof. The use of the molecular marker of the present application in breeding can help breeders quickly and efficiently screen out pepper plants with CMS genes, thereby improving the efficiency of pepper CMS line breeding and reducing the cost of breeding and hybrid seed production.
[0005] The present application obtains three pepper CMS candidate genes, orf115c, orf249 and orf314, by sequencing, assembling and annotating the mitochondrial genomes of pepper CMS line 'BA3' and its maintainer line 'BB3', and further screening. The molecular marker orf115c-Indel based on orf115c can accurately distinguish 100% between pepper CMS lines and maintainer lines. The molecular marker orf115c-Indel is a fragment deletion of "TTATAATAATG" (as shown in SEQ ID NO. 10) between the 175th and 176th bases of the nucleotide sequence as shown in SEQ ID NO. 1, and the molecular marker is located at 120,582 bp of the mitochondrial genome of pepper CMS line 'BA3'.
[0006] Therefore, the first object of the present application is to provide the application of molecular marker orf115c-Indel in identifying CMS line and maintainer line of pepper, wherein the molecular marker orf115c-Indel is a deletion of a fragment as shown in SEQ ID NO. 10 (TTATAATAATG) between the 175th and 176th bases of the nucleotide sequence as shown in SEQ ID NO. 1.
[0007] The second object of the present application is to provide a primer for identifying CMS line and maintainer line of pepper, wherein the primer specifically amplifies the molecular marker orf115c-Indel.
[0008] Preferably, the nucleotide sequence of the upstream primer of the primer for identifying CMS line and maintainer line of pepper is as shown in SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 5.
[0009] The third object of the present application is to provide a kit for identifying CMS line and maintainer line of pepper, which contains the primer for identifying CMS line and maintainer line of pepper.
[0010] The fourth object of the present application is to provide the application of the primer or kit for identifying CMS line and maintainer line of pepper in identifying CMS line and maintainer line of pepper.
[0011] Preferably, the application comprises the following steps:
[0012] S1. extracting DNA of the pepper sample to be identified;
[0013] S2. performing PCR amplification using the primer for identifying CMS line and maintainer line of pepper and taking the DNA of the pepper to be identified as template;
[0014] S3. performing gel electrophoresis detection on the PCR amplification product, and determining the result according to the size of the product band:
[0015] If the size of the band is 137 bp, the pepper sample to be identified is CMS line;
[0016] If the size of the band is 148 bp, the pepper sample to be identified is maintainer line.
[0017] Preferably, the CMS line is pepper CMS line ‘BA3’, and the maintainer line is pepper maintainer line ‘BB3’.
[0018] The application provides a molecular marker for identifying pepper CMS lines and maintainer lines, and also provides sequences of upstream and downstream primers of the molecular marker. The mitochondrial genome of pepper can be amplified by PCR using the upstream and downstream primers, so that the pepper CMS gene can be rapidly identified, and the pepper CMS lines and the maintainer lines can be distinguished. The application can provide a reference for identifying the cytoplasmic type of pepper, identifying the male sterile type, and efficiently selecting and utilizing the pepper CMS lines, and has a wide application prospect in pepper breeding practice. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is a comparison result of orf115c sequences of 'BA3' and 'BB3'.
[0020] Figure 2 is a comparison result of orf249 sequences of 'BA3' and 'BB3'.
[0021] Figure 3 is a comparison result of orf314 sequences of 'BA3' and 'BB3'.
[0022] Figure 4 is a genotyping result of 30 groups of pepper CMS lines and maintainer lines by three molecular markers; wherein, S represents a CMS line; and F represents a maintainer line. DETAILED DESCRIPTION
[0023] The following examples are further illustrations of the application, and are not intended to limit the application.
[0024] Example 1
[0025] (I) Assembly of mitochondrial genomes of 'BA3' and 'BB3'
[0026] The mitochondrial genomes of a pepper CMS line 'BA3' and its maintainer line 'BB3' preserved by the research group are sequenced by using the second-generation Illumina Hi-seq and the third-generation PacBio sequencing technology. The complete mitochondrial genome maps of 'BA3' and 'BB3' are obtained by de novo assembly, wherein the mitochondrial genome size of 'BA3' is 606,838 bp, and the mitochondrial genome size of 'BB3' is 509,172 bp.
[0027] (II) Annotation of mitochondrial genomes of 'BA3' and 'BB3'
[0028] By homologous alignment and de novo prediction, a total of 263 protein-coding genes and 45 non-coding RNAs were annotated in the ‘BA3’ mitochondrial genome. Among them, 263 protein-coding genes contain 30 known function genes and 233 new open reading frames (orfs) with unknown function. The ‘BB3’ mitochondrial genome contains a total of 211 protein-coding genes and 31 non-coding RNAs. Among them, 211 protein-coding genes contain 31 known function genes and 180 new open reading frames (orfs) with unknown function.
[0029] (III) Pepper CMS candidate gene identification
[0030] Previous studies have found that all known plant CMS-related genes are close to the edge of the genomic collinear region. According to this, we first compared the collinearity of ‘BA3’ and ‘BB3’ mitochondrial genomes. The results showed that there were a total of 59 collinear segments between ‘BA3’ and ‘BB3’, accounting for 74.81% and 88.7% of the respective mitochondrial genome sequences. Through gene position analysis, it was found that a total of 82 genes were located within 2kb of the edge of the collinear region (similarity>95%). On the other hand, most of the reported plant CMS genes have chimeric structures and transmembrane domains. Therefore, we analyzed the chimeric structure and transmembrane domain of all genes annotated in the ‘BA3’ mitochondrial genome. The results showed that a total of 57 genes contained chimeric structures, and another 74 genes had transmembrane domains. Finally, we compared the sequences of the 263 genes annotated in the ‘BA3’ mitochondrial genome with the sequences of ‘BB3’ and the other two published maintainer lines ‘138B’ and ‘Jeju’ respectively. The results showed that there were 52, 54 and 94 genes with differences between ‘BA3’ and ‘BB3’, ‘138B’ and ‘Jeju’ respectively, among which there were 44 genes with common differences. The intersection of the candidate genes obtained by mitochondrial gene sequence alignment, collinear region edge, chimeric structure and transmembrane domain analysis obtained 3 pepper CMS candidate genes, namely orf115c, orf249 and orf314.
[0031] (IV) Development of molecular markers for pepper CMS candidate genes
[0032] Using ‘BA3’ and ‘BB3’ mitochondrial DNA as templates, orf115c, orf249 and orf314 were amplified by PCR. After sequencing the amplification products, sequence alignment was performed. The results showed that orf115c, orf249 and orf314 all had differences between ‘BA3’ and ‘BB3’. Figures 1-3) ; wherein, the nucleotide sequence of orfl 15c of 'BA3' is shown as SEQ ID NO. 1, the nucleotide sequence of orf249 of 'BA3' is shown as SEQ ID NO. 2, and the nucleotide sequence of orf314 of 'BA3' is shown as SEQ ID NO. 3. Since the molecular marker atp6-2-SCAR has been developed for orf314 by the previous researchers, in this example, we only developed molecular markers for the sequence differences of orfl 15c and orf249, i.e. orfl 15c-Indel and orf249-CAPS, and the corresponding primer sequences are shown in Table 1.
[0033] Table 1. Primer sequences of molecular markers.
[0034] Molecular marker name Primer sequence (5'→ 3') Sequence number orf 115c-Indel-F AGAATTCGGCCTTTCAACGG SEQ ID NO. 4 orf 115c-Indel-R AGAAGGTTTAGTTCCGAGGGA SEQ ID NO. 5 orf 249-CAPS-F GGTTTGAAAGTGCGACCGAC SEQ ID NO. 6 orf 249-CAPS-R CTACCTGCGCCTTTTACCTT SEQ ID NO. 7 atp6-2-SCAR-F AGTCCACTTGAACAATTTGAAATAATC SEQ ID NO. 8 atp6-2-SCAR-R GTTCCGTACTTTACTTACGAGC SEQ ID NO. 9 Figure 4
[0035] (V) Verification of molecular markers for CMS candidate genes of pepper
[0036] The 30 groups of CMS lines and maintainer lines with different genetic backgrounds collected and preserved by the research group were genotyped using the three molecular marker primers described above. The PCR amplification system was as follows: template DNA 50 ng, PCR Mix 5 μL, and upper and lower primers 0.5 μL (concentration 10 uM) respectively, and water was added to make up the total volume to 10 μL. The PCR reaction program was as follows: (1) 95 °C pre-denaturation for 3 min; (2) 95 °C denaturation for 30 s, (3) 55 °C annealing for 30 s, (4) 72 °C extension for 1 min, repeating steps (2) to (4) for 34 cycles, and finally 72 °C extension for 5 min.
[0037] The genotyping results are shown in Table 2. As shown, the amplification band size of orf115c-Indel, a specific molecular marker developed based on orf115c, was 137 bp for CMS line 'BA3' and 148 bp for maintainer line 'BB3', and orf115c-Indel marker could accurately distinguish pepper CMS lines from maintainer lines at 100%; the amplification band size of orf249-CAPS, a specific molecular marker developed based on orf249, was 173 bp for both CMS line 'BA3' and maintainer line 'BB3', and the amplification product was digested by Aci I, and the amplification product of CMS line 'BA3' could be digested into two bands, while that of maintainer line could not be digested, and the accuracy of orf249-CAPS marker in distinguishing CMS lines from maintainer lines was 53%; the amplification band size of atp6-2-SCAR molecular marker primer pair was 607 bp for CMS line 'BA3', while no band was amplified for maintainer line, and the accuracy of atp6-2-SCAR marker in distinguishing pepper CMS lines from maintainer lines was 37%; the above results showed that orf115c-Indel marker and its primer could be used for identification of pepper CMS lines and maintainer lines.
Claims
1. Use of a primer in the identification of CMS lines and maintainer lines of Capsicum, characterized in that, The primer-specific amplification molecular marker orf115c-Indel The molecular marker orf115c-Indel The fragment deletion between the 175th and 176th bases of the nucleotide sequence shown in SEQ ID NO. 1 is a fragment shown in SEQ ID NO. 10; the nucleotide sequence of the upstream primer of the primer is shown in SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.
5.
2. The use of a reagent for detecting a molecular marker orf115c-Indel characterized in that, The kit contains the primer for identifying the CMS line and the maintainer line of pepper according to claim 1; the molecular marker orf115c-Indel There is a fragment deletion between the 175th and 176th bases of the nucleotide sequence shown in SEQ ID NO. 1, as shown in SEQ ID NO.
10.
3. Use according to claim 1 or 2, characterized in that, comprising the following steps: S1. Extracting DNA of the pepper sample to be identified; S2. Using the primer for identifying CMS line and maintainer line of pepper according to claim 1 or 2, taking the DNA of the pepper to be identified as template to perform PCR amplification; S3. Detecting the PCR amplification product by gel electrophoresis, and judging the result according to the size of the product band: If the band size is 137 bp, the pepper sample to be identified is a CMS line; If the band size is 148 bp, the pepper sample to be identified is a maintainer line.
4. Use according to claim 3, characterized in that, The CMS line is pepper CMS line 'BA3', and the maintainer line is pepper maintainer line 'BB3'.