An SNP marker related to the bark thickness of rubber trees and its application
By constructing SNP markers and their primer pairs related to bark thickness of rubber tree, the problem of bark thickness detection in rubber tree breeding is solved, and fast and accurate bark thickness detection and germplasm resource identification are achieved, which shortens the breeding cycle.
Patent Information
- Application Number
- CN202311509059.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-13
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2043-11-13
AI Technical Summary
The lack of effective bark thickness molecular markers in existing rubber tree breeding leads to a long breeding cycle and it is difficult to quickly screen excellent germplasm resources.
SNP markers and their primer pairs related to bark thickness of rubber trees were developed. By constructing genetic maps and screening for significant differences, SPH12, an SNP molecular marker suitable for rapid detection of bark thickness, was selected, and corresponding primer pairs were designed, and typing was performed using fluorescence quantitative PCR.
It realizes rapid and accurate detection of rubber tree bark thickness in conventional laboratories, shortens breeding time, provides technical support for germplasm resource identification and molecular assisted breeding, and saves manpower and material resources.
Smart Images

Figure CN117512169B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology breeding. More specifically, it relates to an SNP marker related to the bark thickness of rubber trees and its application. Background Art
[0002] The rubber tree (Hevea brasiliensis) is a perennial tropical rainforest tree species in the genus Hevea of the Euphorbiaceae family. It is native to the Amazon River Basin in Brazil, South America. Its secretion is natural rubber, which, together with petroleum, coal, and iron ore, is known as the world's four major industrial raw materials. It is widely used in agriculture, national defense, transportation, etc., and plays an irreplaceable role in the national economy. The natural rubber yield is mainly related to the number of latex vessels, and the latex vessels are mainly located in the bark. According to the color and texture of different parts of the rubber tree bark, the bark can be divided into 5 layers, from the outside to the inside are: rough bark, outer sand bark, inner sand bark, yellow bark, and water sac bark (including functional secondary phloem and cambium). The latex vessels are mainly concentrated in the inner sand bark and yellow bark. It can be said that the bark is the main part for storing latex vessels and producing rubber. The thicker the bark, the larger the storage space and the greater the possibility of high yield. At the same time, relevant research shows that the bark thickness is closely related to the cold resistance and wind resistance of rubber trees. Therefore, cultivating strains with thicker bark can provide more possibilities for the breeding of high-yield and high-resistant (cold-resistant and wind-resistant) strains.
[0003] The traditional breeding method of rubber trees is cross-breeding, but its breeding cycle is relatively long. On average, it takes 30 years to breed a strain, which severely restricts the development of the rubber industry. With the progress of modern molecular biotechnology, molecular marker-assisted selection breeding can promote the rubber tree breeding process to a certain extent. Single nucleotide polymorphism (SNP) markers are densely distributed on chromosomes and have advantages such as rich polymorphism and good genetic stability. They are mostly used in research such as species genetic diversity analysis, construction of core germplasm banks, construction of genetic maps, and variety identification, and are important markers for molecular breeding applications. At present, the existing technology only has research on SNP markers related to the dry rubber yield of rubber trees, SNP markers related to the number of latex vessels of rubber trees, etc. There are few reports on SNP marker research related to the bark thickness of rubber trees. In order to improve the efficiency of molecular marker-assisted breeding of rubber trees and expand the breeding trait indicators of rubber trees, it is necessary to carry out the development work of molecular markers related to the bark thickness of rubber trees to provide technical support and more means for germplasm identification and strain breeding. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the deficiencies of the existing molecular markers for the bark thickness of rubber trees, and provide an SNP marker related to the bark thickness of rubber trees and its application.
[0005] The object of the present invention is to provide an SNP marker related to the bark thickness of rubber trees.
[0006] Another object of the present invention is to provide a primer pair for detecting SNP markers related to the bark thickness of rubber trees.
[0007] Still another object of the present invention is to provide the application of the SNP marker or the primer pair.
[0008] Another object of the present invention is to provide a rubber tree bark thickness genotyping product.
[0009] Still another object of the present invention is to provide a method for rubber tree bark thickness genotyping or rubber tree germplasm resource identification.
[0010] The above objects of the present invention are achieved by the following technical solutions:
[0011] The present invention provides an SNP marker related to the bark thickness of rubber trees. The SNP marker is SPH12, and the base at the 1,151,972nd bp from the 5' end of chromosome CM021237.1 of rubber tree No. 12 is T / G.
[0012] The present invention constructs a genetic map of different rubber tree bark thicknesses, locates the QTL interval related to bark thickness, screens the sites with significant differences within the interval, develops SNP molecular markers related to rubber tree bark thickness, and screens out 3 bark thickness SNP molecular markers SPH01, SPH11, and SPH12 with better genotyping effects; and further uses 2 batches of rubber tree germplasms planted in different years to genotype and verify the relevant SNP molecular markers, thereby screening out an SNP molecular marker SPH12 with better genotyping, which can more quickly and effectively detect the bark thickness trait of rubber trees, greatly shortening the breeding time, and being able to genotype and identify rubber trees with different bark thickness traits in a short time, providing technical support for rubber tree germplasm resource identification and molecular assisted breeding.
[0013] Therefore, the present invention provides a primer pair for detecting SNP markers related to the bark thickness of rubber trees. The primer pair includes primer 1 with the sequence shown in SEQ ID NO: 1: GAAGGTGACCAAGTTCATGCTGCGATAGAATATCCAAGCAAACGT, primer 2 with the sequence shown in SEQ ID NO: 2: GAAGGTCGGAGTCAACGGATTGCGATAGAATATCCAAGCAAACGG, and primer 3 with the sequence shown in SEQ ID NO: 3: TTTCTTTTTCCCAGTCCTTCCCTT.
[0014] The present invention also provides the use of the SNP markers or the primer pairs in detecting the bark thickness of different rubber trees, in typing the bark thickness of rubber trees, or in identifying rubber tree germplasm resources, and in preparing products for typing the bark thickness of rubber trees.
[0015] In addition, the present invention also provides a product for typing the bark thickness of rubber trees, comprising the primer pairs for detecting the SNP markers related to the bark thickness of rubber trees as described above.
[0016] Furthermore, the product is a kit, and further comprises reagents for extracting sample DNA.
[0017] Preferably, the kit further comprises reagents for performing fluorescence quantitative PCR detection.
[0018] The present invention also provides the use of the product for typing the bark thickness of rubber trees in breeding rubber tree varieties with relatively thick bark.
[0019] The present invention provides a method for typing the bark thickness of rubber trees or identifying rubber tree germplasm resources, comprising the following steps:
[0020] S1. Extracting the genomic DNA of the rubber tree to be tested;
[0021] S2. Using the primer pairs for detecting the SNP markers related to the bark thickness of rubber trees as described above, performing PCR amplification on the genomic DNA of the rubber tree to be tested in a fluorescence quantitative PCR instrument;
[0022] S3. Analyzing according to the results of the FAM fluorescence values of the PCR amplification to determine the bark thickness trait of the rubber tree to be tested.
[0023] Furthermore, the method for determining the bark thickness trait of the rubber tree to be tested in step S3 is as follows: if the FAM fluorescence value of the SPH12 allele locus is close to the abscissa, its genotype is TT, marked as X; if the FAM fluorescence value of the allele locus is in the middle position between the abscissa and the ordinate, its genotype is TG, marked as XY; if the FAM fluorescence value of the allele locus is close to the ordinate, its genotype is GG, marked as Y; the bark thickness of the rubber tree with the identification result of XY at the SPH12 locus is greater than that of the rubber trees with the results of X and Y.
[0024] The present invention has the following beneficial effects:
[0025] Through the construction of a genetic map related to the bark thickness of rubber trees and the development of SNP molecular marker primers, the present invention has obtained an SNP molecular marker and its primers suitable for detecting and typing the bark thickness of rubber trees. Using this marker and its primers can be used for the bark thickness typing of rubber trees and the identification of germplasm resources, and can accurately distinguish rubber trees with the largest bark thickness. When the typing result is "XY", the rubber tree has the largest bark thickness and can be used as an excellent rubber tree germplasm resource. The typing and identification method provided by the present invention can be carried out in a conventional laboratory. The method is simple, feasible and easy to operate, without sequencing, without field planting, and can be completed at the seedling stage. It is used for the identification of rubber tree germplasm resources and molecular assisted breeding, greatly shortening the screening cycle of excellent rubber tree germplasm resources, saving a large amount of manpower and material resources, and providing technical support for germplasm identification and strain breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 It is a graph showing the frequency distribution of bark thickness of the hybrid offspring population of 93-114 and PR107.
[0027] Figure 2 It is a graph showing the frequency distribution of bark thickness of 193 natural populations.
[0028] Figure 3 It is a genetic linkage map.
[0029] Figure 4 It is a graph showing the localization result by the interval mapping method.
[0030] Figure 5 It is a graph showing the localization result by the composite interval mapping method.
[0031] Figure 6 It is a graph showing the result of SNP molecular markers with better typing results.
[0032] Figure 7 It is a graph showing the typing result of SPH12 (the first graph from left to right in the figure is the amplification result of 70 germplasms, the second graph is the amplification result of 55 germplasms, and the third graph is the amplification result of 68 germplasms).
[0033] Figure 8 It is a graph showing the comparison result of different phenotypes of SPH12 (the left is the germplasm in 2016, and the right is the germplasm in 2015). DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention will be further described below with reference to the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.
[0035] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0036] The rubber tree test materials used in the present invention were all collected from rubber tree varieties planted in the base of the Zhanjiang Experimental Station of the Chinese Academy of Tropical Agricultural Sciences, including PR107 (male parent), 93-114 (female parent), 140 hybrid offspring populations obtained by crossing the two, and 193 natural populations collected and preserved (12 germplasms were randomly selected for primer screening): including 66 natural populations planted in 2015 and 127 natural populations planted in 2016.
[0037] Example 1 Determination of rubber tree bark thickness phenotype and construction of genetic linkage map
[0038] 1. Phenotype determination
[0039] At a height of 1 m from the ground, insert a bark thickness measuring instrument from the outside to the inside. When the front end touches the xylem, measure the bark thickness of the rubber trees in 140 offspring populations obtained by crossing 93-114 and PR107 and 193 natural populations and record it.
[0040] 2. DNA extraction
[0041] Take the young leaves of the above rubber tree samples respectively, cut them into pieces and put them into 1.5 mL centrifuge tubes. Use the CTAB method to extract the genomic leaf DNA of rubber trees. Detect the purity and concentration by 1% agarose gel electrophoresis, and then take 10 μL and dilute it uniformly to 100 ng / μL to make a working solution, and store the stock solution at -20 °C for later use.
[0042] 3. Reduced-representation genome sequencing
[0043] Use the second-generation illumina sequencing platform to perform reduced-representation genome sequencing on 140 hybrid offspring populations.
[0044] 4. Genetic map construction
[0045] After sequencing, perform quality control on the data, and check, genotype, and filter the variant sites. Finally, calculate and form a genetic map according to the physical map and map distance.
[0046] 5. QTL mapping analysis
[0047] (1) Phenotype analysis: After obtaining the rubber tree bark thickness phenotype data, perform basic visualization, descriptive analysis, etc.
[0048] (2) Genotype and map filtering: For projects with a large number of markers, the markers can be screened according to the marker missing ratio, minimum genetic distance, and minimum physical distance.
[0049] (3) Perform QTL scanning: Use the R / qtl software (for usage reference: Broman K W, Wu H, Sen etal.R / qtl: QTL mapping in experimental crosses[J]. Bioinformatics, 2003, 19(7): 889 - 890.), according to the selected model, QTL scanning was performed at a specified step size, and permutation was performed a specified number of times for each trait.
[0050] (4) Interval mapping method: According to the given threshold and confidence interval determination method, determine the position of the QTL and its confidence interval. This method refers to the define.peak() function of the eqtl software package (reference software: https: / / cran.r-project.org / web / packages / eqtl / index.html). Points with LOD exceeding the threshold are significant points, and continuous significant points form a significant interval. The position of the point with the highest LOD value in the interval is used as the peak of the interval. Based on the LOD value of the peak point, the interval that can be covered after decreasing by a specified LOD value (such as 1.5) is used as the confidence interval of the QTL. If the distance between two peaks does not exceed a given length (such as 10 cM), they are merged into one significant interval.
[0051] (5) Composite interval mapping: Use the cim() function of R / qtl to perform composite interval mapping for each trait. The scanning step size is 1 cM, and each trait is permuted 1000 times. After determining the threshold, the corresponding threshold is used to screen QTL for each trait.
[0052] 6. Results
[0053] The frequency distribution of bark thickness in different materials shows that the frequency of bark thickness between 0.8 - 1.2 cm is relatively high, conforming to the normal distribution. The phenotypic determination results of bark thickness in a population of 140 hybrid offspring are as Figure 1 shown, showing that its minimum value is 0.45 cm, the maximum value is 1.65 cm, and the mean value is 0.98 cm; the frequency distribution of bark thickness in a natural population of 193 is as Figure 2 shown, showing that the minimum value is 0.27 cm, the maximum value is 0.64 cm, and the mean value is 0.51 cm, conforming to the normal distribution.
[0054] Genotyping - by - sequencing (GBS) analysis was carried out on 140 materials to construct a genetic linkage map, as Figure 3 shown, showing a total of 18 pairs of chromosomes, with a total length of 1528 cM, an average of 1.356 cM, and a total number of mapped markers of 1127.
[0055] According to the phenotypic determination results of bark thickness and combined with the genetic linkage map for QTL mapping, the mapping results by the interval mapping method are asFigure 4 As shown, it shows that two chromosomes, CM021230.1 and CM021237.1, are located; the localization results by the composite interval mapping method are as Figure 5 shown, showing that no interval is located, but there are two relatively obvious peaks on chromosomes CM021230.1 and CM021237.1; combining the two localization methods, significant difference markers on these two chromosomes, CM021230.1 and CM021237.1, are finally selected for subsequent verification.
[0056] Example 2 Screening of SNP Molecular Markers
[0057] 1. Screening of SNP Molecular Markers
[0058] Based on the intervals (chromosomes CM021230.1 and CM021237.1) located in Example 1, phenotypic significant difference markers are screened, and the screening method is as follows: First, all SNP sites within the located intervals are determined according to the sequencing results, the SNP site information of each germplasm is counted, and various SNP types are genotyped (for example, there are 75 copies of the AA type, 59 copies of the AG type, and 59 copies of the GG type), then the average bark thickness data of each type is calculated (for example, the average bark thickness of the AA type is 0.49 cm, the average bark thickness of the AG type is 0.53 cm, and the average bark thickness of the GG type is 0.50 cm), and finally, analysis of variance is performed according to the average bark thickness results of each type. The results of the analysis of variance show extremely significant (P value less than 0.01), and the intervals (chromosomes CM021230.1 and CM021237.1) for the localization of significant difference SNP markers are determined. A total of 18 groups of significantly different SNP sites are screened out.
[0059] 2. SNP Primer Design
[0060] Based on the above 18 groups of significantly different SNP sites screened, referring to the rubber tree genome (cultivar GT1, https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_010458925.1 / ), 100 bp base sequences before and after the SNP sites are extracted using TBtools, and a total of 18 groups of primers are designed using the website http: / / www.snpway.com / . Then, the designed primers are sent to Shanghai Sangon Biotech Co., Ltd. for synthesis. The specific primer sequences synthesized are shown in Table 1 below.
[0061] Table 1 18 groups of significantly different SNP sites
[0062]
[0063]
[0064]
[0065]
[0066] We randomly selected 12 germplasms from the 193 germplasms previously stored by our research group as materials and used the primers listed in Table 1 to 480II fluorescence quantitative PCR instrument was used for detection and analysis. Fluorescence quantitative reaction system: 5μL mix reagent (PCR reaction premix solution, purchased from Wuhan Jingpeptide Biotechnology Co., Ltd.); a set of three PARMS primer working solutions, each with a concentration of 100ng / μL, to which 0.15μL of primer 1 (Primer1) and primer 2 (Primer2) were added, as well as 0.4μL of primer 3 (PrimerCommon); 2μL of DNA extraction solution; and finally, 2.3μL of ddH2O was added to make up the reaction system to 10μL. The reaction procedure was: 94℃ pre-denaturation for 15min, 94℃ denaturation for 20s, 65℃ annealing extension (gradient decrease of 0.7℃ per cycle) for 1min, amplification for 10 cycles; 94℃ denaturation for 20s, 57℃ annealing extension for 1min, and amplification for 30 cycles.
[0067] After the amplification reaction is completed, The PCR product typing results calculated by the SNP typing software of the 480II instrument are used to screen out primers with better typing effects for PCR products.
[0068] according to The typing results of the PCR products calculated by the SNP typing software of the 480II instrument are as follows: Figure 6 As shown in the figure, 12 germplasms were randomly selected to screen the SNP markers, which can be basically divided into three categories: one is that they cannot be amplified at all or the amplified amount is small; the second is that they can be amplified but cannot be typed; the third is that they can be amplified well and can be typed, with a total of 3 markers, accounting for 16.66% of all markers. Finally, the three bark thickness SNP molecular markers with good typing effects were screened out, namely SPH01, SPH11, and SPH12.
[0069] Example 3 Verification of SNP Molecular Markers
[0070] In order to verify the accuracy of the SNP molecular marker for thick bark of rubber trees, 67 natural populations planted in 2015 and 127 natural populations planted in 2016 were selected as rubber tree germplasms for testing. DNA of different rubber tree germplasms was extracted, and the SNP molecular markers SPH01, SPH11, and SPH12 in Table 1 were used as primers to perform fluorescence quantitative PCR amplification using the method described in Example 2, and then according to The analysis results of the 480II's built-in SNP typing software (expressed as X close to the horizontal axis, Y close to the vertical axis, and XY between the two) are matched one by one with the bark thickness phenotypic data and classified. When there are large differences in different categories of phenotypic data, the rubber tree bark thickness SNP molecular marker is successfully verified.
[0071] The amplification results are as follows Figure 7 As shown, three typable SNP molecular markers were verified through 193 natural populations, of which only one SNP typing result was ideal; the results amplified by marker SPH12 were matched one by one with the bark thickness phenotype data of 127 germplasms planted in 2016 and 66 germplasms planted in 2015. Among them, the average bark thickness of the germplasm typing results "X", "XY" and "Y" in 2016 were 0.49cm, 0.51cm and 0.49cm respectively The average bark thickness of the "X" and "XY" groups differed by 0.02 cm, and the average bark thickness of the "XY" and "Y" groups differed by 0.02 cm; the average bark thickness of the germplasm typing results in 2015 was 0.53 cm, 0.55 cm and 0.53 cm respectively, the average bark thickness of the "X" and "XY" groups differed by 0.02 cm, and the average bark thickness of the "XY" and "Y" groups differed by 0.02 cm. The statistical results of different germplasms are as follows Figure 8 As shown, it was finally determined that the SPH12 primer was suitable for the detection of rubber tree bark thickness, and when the typing result was "XY", the bark thickness was the largest.
[0072] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.
Claims
1. Use of a primer pair in detecting bark thickness of different rubber trees, characterized in that, The primer pair includes Primer 1 with the sequence shown in SEQ ID NO: 1, Primer 2 with the sequence shown in SEQ ID NO: 2, and Primer 3 with the sequence shown in SEQ ID NO: 3; the primer pair is used to detect the SNP marker SPH12 of rubber tree, and the SNP marker SPH12 is that the base at the 1151972bp site from the 5' end of chromosome CM021237.1 of rubber tree 12 is T / G; the bark thickness of the genotype TG detected by the primer pair is greater than that of TT or GG.
2. Use of a primer pair in the typing of rubber tree bark thickness, characterized in that, The primer pair includes Primer 1 with the sequence shown in SEQ ID NO: 1, Primer 2 with the sequence shown in SEQ ID NO: 2, and Primer 3 with the sequence shown in SEQ ID NO: 3; the primer pair is used to detect the SNP marker SPH12 of rubber tree, and the SNP marker SPH12 is that the base at the 1151972bp site from the 5' end of chromosome CM021237.1 of rubber tree 12 is T / G; the primer pair can genotype the genotypes TG, TT, and GG with different bark thicknesses.
3. Application of a primer pair in identification of thick-bark germplasm resources of rubber trees, characterized in that, The primer pair includes Primer 1 with the sequence shown in SEQ ID NO: 1, Primer 2 with the sequence shown in SEQ ID NO: 2, and Primer 3 with the sequence shown in SEQ ID NO: 3; the primer pair is used to detect the SNP marker SPH12 of rubber tree, and the SNP marker SPH12 is that the base at the 1151972bp site from the 5' end of chromosome CM021237.1 of rubber tree 12 is T / G; the bark thickness of the genotype TG detected by the primer pair is greater than that of TT or GG.
4. Use of a primer pair in the preparation of a rubber tree bark thickness typing product, characterized in that, The primer pair includes Primer 1 with the sequence shown in SEQ ID NO: 1, Primer 2 with the sequence shown in SEQ ID NO: 2, and Primer 3 with the sequence shown in SEQ ID NO: 3; the primer pair is used to detect the SNP marker SPH12 of rubber tree, and the SNP marker SPH12 is that the base at the 1151972bp site from the 5' end of chromosome CM021237.1 of rubber tree 12 is T / G; the primer pair can genotype the genotypes TG, TT, and GG with different bark thicknesses.
5. Use of a product containing a primer pair in breeding a variety of rubber tree with thick bark, characterized in that, The primer pair includes Primer 1 with the sequence shown in SEQ ID NO: 1, Primer 2 with the sequence shown in SEQ ID NO: 2, and Primer 3 with the sequence shown in SEQ ID NO: 3; the primer pair is used to detect the SNP marker SPH12 of rubber tree, and the SNP marker SPH12 is that the base at the 1151972bp site from the 5' end of chromosome CM021237.1 of rubber tree 12 is T / G; the bark thickness of the genotype TG detected by the primer pair is greater than that of TT or GG 6. The application according to claim 5, characterized in that, The product is a kit, and also includes reagents for extracting sample DNA.
7. A method for classifying the bark thickness of rubber trees or identifying germplasm resources of rubber trees with thick bark, characterized in that, It includes the following steps: S1. Extract the genomic DNA of the rubber tree to be tested; S2. Use the primer pair described in claim 2 to perform PCR amplification on the genomic DNA of the rubber tree to be tested in a fluorescence quantitative PCR instrument; S3. Analyze according to the FAM fluorescence value results of PCR amplification to determine the bark thickness trait of the rubber tree to be tested: If the FAM fluorescence value of the SPH12 allele locus is close to the abscissa, its genotype is TT, marked as X; if the FAM fluorescence value of the allele locus is in the middle position between the abscissa and the ordinate, its genotype is TG, marked as XY; if the FAM fluorescence value of the allele locus is close to the ordinate, its genotype is GG, marked as Y; the bark thickness with the locus identification result of XY at SPH12 is greater than that with the results of X and Y.