A strain of low-temperature-resistant multifunctional bacteria and its application in soil and water pollution remediation

Abstract

The present invention belongs to the technical field of biological treatment of environmental pollutants, and specifically relates to a strain of low-temperature-resistant multifunctional bacteria and its application in soil and water pollution remediation. The low-temperature-resistant multifunctional bacteria is the strain TLT1 of the genus Tularemia, which was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on August 9, 2023, with the deposit number: CGMCC No: 40754. The bacterial agent of the present invention can be used to stabilize zinc in the soil environment, which helps to enrich the database of bacterial strains that stabilize heavy metals and have the ability to degrade quinolone antibiotics. The present invention prepares the purified strain into a bacterial suspension, which can effectively stabilize zinc in different environmental media such as water and soil under low-temperature conditions, and has the ability to degrade enrofloxacin in different environmental media such as water and soil. Compared with methods such as chemical oxidation, this method is more efficient, less expensive, and has no secondary pollution, providing an effective biological-non-biological combined remediation technology for the remediation of zinc-enrofloxacin complex-contaminated soil and water.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological treatment of environmental pollutants, and particularly relates to a low-temperature-resistant multifunctional bacteria (simultaneously adsorbing heavy metals and degrading antibiotics) and application thereof in soil and water body pollution remediation. BACKGROUND

[0002] As a large country of livestock and poultry breeding, China has large reserves of livestock and poultry, and the generated livestock and poultry manure is gradually accumulated. In the northern region, the livestock and poultry manure cannot be disposed in time in winter due to coldness, and the excessive heavy metals and antibiotics remaining in the manure are continuously accumulated in the soil. After the temperature warms up, the heavy metals and antibiotics in the soil will enter the deep soil and underground water through rainwater leaching and the like. Once the polluted water body and livestock and poultry manure are applied to the farmland soil, they are easily absorbed by crops, transmitted through the food chain, and not only can destroy the microbial community structure, but also can pose a threat to human health through the inhibition of protein, cell wall, folic acid synthesis, and the influence on DNA replication and transcription. At present, the veterinary heavy metals and antibiotics mainly include zinc and enrofloxacin. The dosage of zinc used in pig farms can be as high as 2000 mg / kg, and the dosage of enrofloxacin is more than 2.4 mg / kg, so there is an urgent need for a material that can simultaneously achieve the stabilization of zinc and the degradation of enrofloxacin in the soil and water body.

[0003] At present, the heavy metal stabilization technology mainly relies on physical adsorption and chemical adsorption; in the field application, the methods such as soil deep ploughing and guest soil are mainly used; the methods for remediation of antibiotic contaminated soil mainly include plant remediation, microbial remediation, and photoelectric catalysis. However, the methods such as guest soil and photoelectric catalysis have strong specificity and high cost, and the plant remediation method is slow. Therefore, the biological degradation method has gradually attracted attention. The microbial remediation technology not only has high efficiency and low cost, but also will not cause secondary pollution and has small environmental disturbance to the soil, and is a good means for remediation of the water body and soil containing heavy metals and antibiotics. Since the microorganism is very sensitive to temperature and has strong specificity, it generally only has the treatment capacity for a single heavy metal or a certain antibiotic. Therefore, the microorganism that can simultaneously stabilize the heavy metal and degrade the antibiotic at different temperatures will play an important role in the remediation of the soil and water body in the northern region. The present application provides a low-temperature-resistant microorganism that can simultaneously satisfy the stabilization of zinc and the removal of enrofloxacin at different temperatures, and realizes efficient use of the strain. SUMMARY

[0004] To overcome the deficiencies of the prior art, the primary purpose of the present application is to provide a low-temperature-resistant multifunctional bacteria.

[0005] Another purpose of the present application is to provide the application of the strain in soil remediation.

[0006] Another purpose of the present application is to provide the application of the strain in water body remediation.

[0007] To achieve the above object, the following technical solutions are implemented:

[0008] A low-temperature resistant strain with quinolone antibiotic degradation ability and heavy metal stabilization, the bacterial agent containing the domesticated TLT1 strain of Talaromyces; the strain is TLT1 of Talaromyces, which was preserved in the China General Microbiological Culture Collection Center on August 9, 2023, and the preservation number is CGMCC No: 40754.

[0009] Application of the strain, application of the strain in soil pollution remediation.

[0010] Application of the strain, application of the strain in water pollution remediation.

[0011] Application of the strain in simultaneously stabilizing heavy metals and degrading antibiotics in contaminated soil.

[0012] The heavy metal is zinc, and the antibiotic is enrofloxacin.

[0013] The bacterial agent contains the culture solution, culture solution concentrate or culture bacterial suspension of the strain.

[0014] The domestication of the TLT1 strain of Talaromyces is gradient domestication in a solution containing zinc ions and enrofloxacin, and finally the TLT1 strain that can tolerate zinc ions and degrade enrofloxacin is obtained.

[0015] The bacterial agent culture solution is to culture the TLT1 strain of Talaromyces in PDA liquid medium to the logarithmic growth phase, that is, to obtain the culture solution; centrifuge the culture solution to collect the precipitate, and the dry mass of the collected precipitate reaches 4-6 g / L.

[0016] A use method of the bacterial agent, the bacterial agent is applied to the contaminated soil to be treated, and when the dry matter of the bacterial agent reaches 4 g / L, the inoculation amount is 3-5 wt% and is added to the contaminated soil to be treated. Compared with the prior art, the beneficial effects of the present application are:

[0017] The present invention isolates a strain with heavy metal tolerance and enrofloxacin-degrading activity from in-situ livestock and poultry breeding soil contaminated with heavy metals and antibiotics. Molecular identification identifies the strain as TLT1 of the genus Talaromyces. This strain's ability to degrade enrofloxacin contributes to enriching the pool of quinolone antibiotic-degrading bacteria, providing an effective biodegradation method for remediating enrofloxacin-contaminated contamination. Furthermore, this strain can adsorb high concentrations of zinc ions, enriching the pool of zinc- and heavy metal-stabilizing bacteria and providing an effective treatment method for the remediation of zinc- and heavy metal-contaminated soil. This strain exhibits strong adaptability, is cold-resistant, safe, effective, and environmentally friendly, enabling enrofloxacin degradation and zinc stabilization in low-temperature environments to which the microorganism is adapted. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a diagram showing the LC-MS quantitative detection results of the degradation of enrofloxacin in water by the TLT1 strain provided in an embodiment of the present invention.

[0019] Figure 2 This is a graph showing the results of the TLT1 strain stabilizing zinc in soil and removing enrofloxacin at a low temperature (10° C.) using a 3% inoculum dose provided in an embodiment of the present invention.

[0020] Figure 3 This is a graph showing the results of the TLT1 strain stabilizing zinc in soil and removing enrofloxacin at room temperature (20° C.) using a 3% inoculum dose provided in an embodiment of the present invention.

[0021] Figure 4 This is a graph showing the results of the TLT1 strain stabilizing zinc in soil and removing enrofloxacin at room temperature (30° C.) using a 3% inoculum dose provided in an embodiment of the present invention.

[0022] Figure 5 This is a graph showing the results of the TLT1 strain stabilizing zinc in water and removing enrofloxacin at a low temperature (10° C.) using a 5% inoculum dose provided in an embodiment of the present invention.

[0023] Figure 6 This is a graph showing the results of the TLT1 strain stabilizing zinc in water and removing enrofloxacin at room temperature (20° C.) using a 5% inoculum dose provided in an embodiment of the present invention.

[0024] Figure 7 This is the result of the TLT1 strain stabilizing zinc in soil and removing enrofloxacin at room temperature (20° C.) using a 5% inoculum dose in the present invention. DETAILED DESCRIPTION

[0025] The specific embodiments of the present invention are further described below with reference to examples. It should be noted that the specific embodiments described here are only for illustrating and explaining the present invention, and are not intended to limit the present invention.

[0026] The bacterium agent contains a single strain TLT1 of Talaromyces obtained by domestication, which was preserved in the China General Microbiological Culture Collection Center on August 9, 2023, with a preservation number of CGMCC No: 40754. The domestication of the Talaromyces strain TLT1 is carried out in a solution containing zinc ions and enrofloxacin by gradient domestication, and finally a TLT1 stabilized strain that can tolerate zinc ions is obtained. The bacterium agent of the present application can stabilize zinc in the soil environment, help enrich heavy metals and have a bacterium database of quinolone antibiotic degrading bacteria. The purified strain is made into a bacterial suspension, which can effectively stabilize zinc in different environmental media such as water and soil in a low temperature environment, and has the function of degrading enrofloxacin in different environmental media such as water and soil. Compared with chemical oxidation and other methods, this method is more efficient, low in price and without secondary pollution, and provides an effective biological-non-biological combined remediation technology for zinc-enrofloxacin compound contaminated soil and water.

[0027] Example 1: Isolation and identification of the strain

[0028] In the present application, the Talaromyces TLT1 strain is obtained by screening and domestication from soil contaminated by heavy metal-antibiotic in livestock and poultry breeding sites, and the specific steps are as follows:

[0029] A. Use enrofloxacin and zinc to screen antibiotic-resistant bacteria in contaminated soil in livestock and poultry breeding:

[0030] The domestication process is as follows: collect the contaminated soil samples piled up by animal manure produced by livestock and poultry breeding sites, understand the initial enrofloxacin concentration in the soil samples, then add the samples to the inorganic salt medium containing enrofloxacin for gradient domestication, the concentration of enrofloxacin in the medium is gradually increased, and the concentrations are 50 μg / L, 100 μg / L, 200 μg / L, 500 μg / L, 1 mg / L and 2 mg / L, respectively; at the same time, the concentration of zinc in the inorganic salt culture solution is controlled at 20 mg / L, 50 mg / L, 100 mg / L, 200 mg / L and 300 mg / L, and the samples are cultured in a shaker at 10°C and 150 r / min in the dark for 7 days, the state of the bacterial solution in the medium is observed regularly, the liquid in the medium changes from transparent to turbid, and the OD 600 is higher than 1, which indicates that the microorganism that can tolerate 2 mg / L enrofloxacin and 300 mg / L zinc has been normally activated, and further enrichment can be carried out under this condition. At this time, the concentrations of enrofloxacin and zinc have reached the pollution concentration of soil / water.

[0031] The mixed bacteria resistant to enrofloxacin and zinc screened at the concentration of 2 mg / L enrofloxacin and 300 mg / L zinc in the above gradient acclimation were transferred to a solid inorganic salt medium containing 2 mg / L enrofloxacin and cultured at 10°C in the dark for a total of 6 transfers; so as to make enrofloxacin-degrading bacteria dominant.

[0032] The mixed bacteria obtained above were inoculated into an inorganic salt medium containing 2 mg / L enrofloxacin and cultured at 10°C, 150 r / min in the dark, and sampled through a 0.22 μm filter membrane at 0 day and 3 days for LC-MS determination of the degradation effect; it can be known from the degradation experiment that the removal efficiency of enrofloxacin can reach 54.89% after 3 days, and the stabilization of zinc reaches 76.2%. The obtained mixed bacteria were inoculated into a liquid inorganic salt medium containing 2 mg / L, and cultured to a dry matter mass of 4 g / L, resuspended with sterile physiological saline, and finally obtained a mixed microbial bacteria suspension resistant to and capable of degrading enrofloxacin.

[0033] B, the mixed microbial bacteria suspension obtained after acclimation was inoculated with an inoculation loop on a solid LB medium, a solid inorganic salt medium and a solid potato medium for streak culture; the above three media were ensured to contain 2 mg / L enrofloxacin and 300 mg / L zinc when used; the microorganisms grown in different media were transferred every seven days at 10°C in the dark, and repeated for six times, so that the strains in each medium were separated and purified, and finally a single strain was obtained;

[0034] C, each single strain separated and purified was inoculated into a medium containing 2 mg / L enrofloxacin antibiotic and 300 mg / L zinc ion for enrofloxacin degradation experiment and zinc ion adsorption experiment, to investigate the degradation ability of single strain to enrofloxacin in PDA medium and the adsorption ability of zinc, and finally, the microorganism TLT1 with the highest enrofloxacin degradation effect was selected from the single strains.

[0035] The obtained purified single strain is Talaromyces, named TLT1, and was preserved in the China General Microbiological Culture Collection Center on August 9, 2023. The preservation number is: CGMCC No:40754.

[0036] The above obtained strain was subjected to DNA extraction, PCR amplification, sequence sequencing and sequence alignment, the 16s rDNA sequence of the strain TLT1 has a homology of more than 99.9% with Talaromyces, has the closest genetic relationship, is identified as Talaromyces, and is simply referred to as TLT1. Its morphology is shown in Figure 1 .

[0037] The screening uses the following medium components:

[0038] Inorganic salt liquid medium (g / L): ((NH4)2SO4 1.2, KH2PO4 1.2, K2HPO4 1.2, NaCl 0.5, FeCl3 6H2O 0.1, CaCl2 0.05, anhydrous glucose 15, pH 7.0), water to 1 L.

[0039] Basic medium (g / L): yeast powder 5, peptone 10, NaCl 10; the medium is sterilized at 121°C for 20 min before use.

[0040] Potato medium: 200 g of fresh potato cut into pieces is boiled on a heating furnace for 20 min, then the potato pieces are filtered out, 20 g of glucose is added to the supernatant, and the volume is made up to 1 L.

[0041] Inorganic salt solid medium (g / L): ((NH4)2SO4 1.2, KH2PO4 1.2, K2HPO4 1.2, NaCl 0.5, FeCl3 6H2O 0.1, CaCl2 0.05, anhydrous glucose 15, pH 7.0), 20 g of agar powder is boiled.

[0042] LB medium (g / L): yeast powder 5, peptone 10, NaCl 10; 20 g of agar powder is boiled.

[0043] Potato solid medium: 200 g of fresh potato cut into pieces is boiled on a heating furnace for 20 min, then the potato pieces are filtered out, 20 g of glucose is added to the supernatant, and the volume is made up to 1 L. 20 g of agar powder is boiled. The medium is sterilized at 115°C (with glucose) / 121°C (without glucose) for 30 min before use. The 16s rDNA sequence is:

[0044] CCCTTGTCTCCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGAC

[0045] GCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCGCTGTGAACCCTGATGAAGATGGGCTGTCTG

[0046] AGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAAC

[0047] GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCA

[0048] CATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACG

[0049] GCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTG

[0050] GTCCTCGAGCGTATGGAGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACC

[0051] ACATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATC

[0052] Preparation of the bacterial agent: the single strain TLT1 obtained above was activated in a sterile inorganic salt liquid medium, after activation, inoculated in a liquid PDA medium at a inoculation amount of 3wt%, and placed in a 10℃ constant temperature incubator for culture to logarithmic phase, then the strain was washed with sterile normal saline to prepare a bacterial suspension with a dry matter quality of 4g / L, which was the bacterial agent.

[0053] Using the degradation bacterial agent obtained above, enrofloxacin and zinc ion treatment test in low temperature soil environment (10℃):

[0054] The test soil was taken from a pollution soil of a livestock and poultry breeding farm in Shenyang, Liaoning Province, with sandy loam texture, pH 7.35, and the content of available enrofloxacin and zinc was 428μg / kg and 228mg / kg respectively, and was passed through a 2mm sieve; 100g soil was inoculated with 3wt% of the above bacterial agent, and cultured for one month outdoors (8-10℃). Enrofloxacin and zinc pollution soil remediation test was set up with two treatments:

[0055] Treatment 1: control treatment: control treatment 1 original soil (without bacteria) 0 days; control treatment 2 original soil (without bacteria) standing for 30 days;

[0056] Treatment 2: bacterial agent treatment (bacterial agent inoculation amount accounted for 3% (w:w) of soil).

[0057] Each treatment was set three times in parallel, and the soil samples were taken at 0 days and 30 days for analysis of enrofloxacin and available zinc. The soil moisture content was maintained at 16-22% during the whole experiment. The results showed that the TLT1 strain could tolerate enrofloxacin and zinc, and had a certain degradation effect on enrofloxacin in soil and could reduce the available state of zinc. The degradation effect of the bacterial suspension on enrofloxacin and the effect on the available state of zinc at 30 days were 36.8% and 68.5% lower than at 0 days, respectively. The results are shown in Table 2. Figure 2 .

[0058] Example 3

[0059] Using the above-obtained degradation agent, enrofloxacin and zinc ion treatment tests were carried out in a normal temperature soil environment (20°C):

[0060] The test soil was taken from a polluted soil at a livestock and poultry breeding site in Shenyang, Liaoning Province, and had a sandy loam texture and a pH of 7.35. The content of enrofloxacin and available zinc was 428 μg / kg and 228 mg / kg, respectively, and the soil was sieved through a 2 mm sieve. 100 g of soil was inoculated with 3% microbial inoculum, and incubated in a normal temperature room (20°C) for one month. Enrofloxacin and zinc contaminated soil remediation tests were set up in two treatments:

[0061] Treatment 1: control treatment: control treatment 1 original soil (without bacteria) 0 days; control treatment 2 original soil (without bacteria) standing for 30 days;

[0062] Treatment 2: bacterial agent treatment (bacterial agent as described in Example 2) (bacterial agent inoculation amount accounting for 3% (w:w) of the soil). Each treatment was set three times in parallel, and the soil samples were taken at 0 days and 30 days for analysis of enrofloxacin and available zinc. The soil moisture content was maintained at 20% during the whole experiment. The results showed that the soil moisture content was maintained at 16-22% during the whole experiment. The results showed that the TLT1 strain could tolerate enrofloxacin and zinc, and had a certain degradation effect on enrofloxacin in soil and could reduce the available state of zinc. The degradation effect of the bacterial suspension on enrofloxacin and the effect on the available state of zinc at 30 days were 44.5% and 65.8% lower than at 0 days, respectively. The results are shown in Table 2. Figure 3 .

[0063] Example 4

[0064] Using the above-obtained degradation agent, enrofloxacin and zinc ion treatment tests were carried out in a normal temperature soil environment (30°C):

[0065] The test soil was obtained from a livestock and poultry breeding site in Shenyang, Liaoning Province, and was a sandy loam soil with a pH of 7.35, an enrofloxacin content of 428 μg / kg, and a zinc content of 228 mg / kg. The soil was passed through a 2 mm sieve. 100 g of the soil was inoculated with 3% of the microbial inoculant and incubated in a normal temperature room (20°C) for one month. Two treatments were set up for the enrofloxacin and zinc contaminated soil remediation experiment:

[0066] Treatment 1: Control treatment: Control treatment 1 original soil (without bacteria) 0 days; control treatment 2 original soil (without bacteria) standing for 30 days;

[0067] Treatment 2: Inoculant treatment (the inoculant described in Example 2) (the inoculant inoculation amount was 3% (w:w) of the soil). Three parallel samples were set up for each treatment, and the enrofloxacin residue and available zinc were analyzed at 0 days and 30 days. The soil moisture content was maintained at 20% during the experiment. The results showed that the soil moisture content was maintained at 16-22% during the experiment. The results showed that the TLT1 strain could tolerate enrofloxacin and zinc, and had a certain degradation effect on enrofloxacin and could reduce the available state of zinc. The degradation effect of the bacterial suspension on enrofloxacin and the effect on the available state of zinc at 30 days were 49.7% and 62.4% lower than at 0 days, respectively. The results are shown in Table 1. Figure 4 .

[0068] Example 5:

[0069] Preparation of the inoculant: The single strain TLT1 obtained above was activated in a sterile inorganic salt liquid medium, and after activation, it was inoculated into a liquid PDA culture medium at a inoculation amount of 5 wt% and incubated in a 10°C constant temperature incubator to the logarithmic phase. Then the strain was washed with sterile physiological saline to prepare a bacterial suspension with a dry matter content of 4 g / L, which was the inoculant.

[0070] Enrofloxacin degradation and zinc stabilization experiments in low-temperature water environments (10°C) using the above-obtained degradation inoculant:

[0071] The test water body was a simulated contaminated water body in the laboratory, with a pH of 6.8, an enrofloxacin content of 1000 μg / kg, and a total zinc content of 300 mg / L. 100 mL of the compound contaminated water body was inoculated with 5 wt% of the microbial inoculant and incubated in a 10°C constant temperature environment for three days. Two treatments were set up for the contaminated water body remediation:

[0072] Treatment 2: Inoculant treatment (the inoculant inoculation amount was 5% (w:w) of the soil).

[0073] Each treatment was set three times in parallel, and the water samples were taken at 0 days and 3 days to determine the enrofloxacin residue and total zinc content. The results are shown in Table 2 Figure 5 The experimental results show that the TLT1 strain can tolerate enrofloxacin and has a certain degradation capacity for enrofloxacin and a good adsorption capacity for zinc. The degradation effect of the bacterial suspension on enrofloxacin reaches 43.8% in 3 days, and the stable adsorption capacity for zinc reaches 75.2%.

[0074] Example 6

[0075] The TLT1 bacterial agent was used for the repair experiment of enrofloxacin-zinc compound pollution water body at room temperature (20°C):

[0076] The test water body was a simulated pollution water body in the laboratory, the pH was 6.8, the enrofloxacin content was 1000 μg / kg, and the total zinc content was 300 mg / L; 100 mL of the compound pollution water body was inoculated with 5 wt% microbial bacterial agent, and was placed in a 20°C constant temperature environment for culture for three days. The pollution water body repair was set up two kinds of treatment: treatment 1: control treatment: control treatment 1 original pollution water body (without bacteria) 0 days; control treatment 2 original pollution water body (without bacteria) standing for 3 days;

[0077] Treatment 2: bacterial agent treatment (bacterial agent inoculation amount accounts for 5% (w:w) of soil).

[0078] Each treatment was set three times in parallel, and the water samples were taken at 0 days and 3 days to determine the enrofloxacin residue and total zinc content. The results are shown in Table 2 Figure 6 The experimental results show that the TLT1 strain can tolerate enrofloxacin and has a certain degradation capacity for enrofloxacin and a good adsorption capacity for zinc. The degradation effect of the bacterial suspension on enrofloxacin reaches 43.8% in 3 days, and the stable adsorption capacity for zinc reaches 75.2%.

[0079] Example 7

[0080] The above obtained degradation bacterial agent was used for the repair experiment of enrofloxacin and zinc ions in soil environment at room temperature (20°C):

[0081] The test soil was taken from a pollution soil of a livestock and poultry breeding farm in Shenyang City, Liaoning Province, the texture was sandy loam, the pH was 7.35, the effective content of enrofloxacin and zinc was 428 μg / kg and 228 mg / kg respectively, and was passed through a 2 mm sieve; 100 g of soil was inoculated with 5% microbial bacterial agent, and was cultured in a room temperature (20°C) for one month. The enrofloxacin and zinc pollution soil repair experiment was set up two kinds of treatment:

[0082] Treatment 1: control treatment: control treatment 1 original soil (without bacteria) 0 days; control treatment 2 original soil (without bacteria) standing for 30 days;

[0083] Treatment 2: inoculation of bacterial agent (bacterial agent is described in Example 2) (inoculation amount of bacterial agent accounts for 5% (w:w) of soil). Three parallel samples are set for each treatment, and the residual amount of enrofloxacin and available zinc is analyzed at 0 day and 30 days. The moisture content of soil is maintained at 20% during the whole experiment. The results are shown in Table 2. Figure 7 The experimental results show that the moisture content of soil is maintained at 16-22% during the whole experiment. The experimental results show that the TLT1 strain can tolerate enrofloxacin and zinc, and has a certain degradation effect on enrofloxacin and can reduce the available state of zinc. The degradation effect of bacterial suspension on enrofloxacin and the influence on the available state of zinc are decreased by 66.5% and 77.1%, respectively, compared with those at 0 day.

[0084] In conclusion, the bacterial suspension provided by the application has good antibiotic resistance and degradation potential. The free single bacteria screened by the application can grow rapidly to the logarithmic phase within half a day, has high reproduction speed and strong adaptability, can simultaneously achieve the degradation of enrofloxacin and the stabilization of heavy metals, has low toxicity of biodegradation product, fast speed, and will not cause secondary pollution, is low in price, and is worth popularizing.

Claims

1. A cold-resistant multifunctional bacterium, characterized by: The low-temperature-resistant multifunctional bacteria is strain TLT1 of the genus Tularemia, which was deposited in the General Microbiology Center of the China Culture Collection Administration on August 9, 2023, with the deposit number: CGMCC No: 40754.

2. A use of the low-temperature-resistant multifunctional bacteria according to claim 1, characterized in that: The strain is used to degrade antibiotics in a polluted environment; wherein the antibiotic is enrofloxacin.

3. The use according to claim 2, characterized in that: The strain is used in degrading antibiotics in contaminated soil or water at low temperature; wherein the antibiotic is enrofloxacin.

4. A use of the low-temperature-resistant multifunctional bacteria according to claim 1, characterized in that: The strain is used to stabilize heavy metals in an environment; wherein the heavy metal is zinc.

5. The use according to claim 2, characterized in that: The strain is used to stabilize heavy metals in soil or water at low temperatures; wherein the heavy metal is zinc.

6. A low-temperature resistant multifunctional bacterial agent, characterized in that: The bacterial agent contains the strain according to claim 1.

7. The low-temperature-resistant multifunctional bacterial agent according to claim 6, characterized in that: The bacterial agent is a culture or culture suspension containing the strain according to claim 1.

8. The low-temperature-resistant multifunctional bacterial agent according to claim 7, characterized in that: The bacterial agent culture solution is obtained by placing the Talfrezia strain TLT1 in a 10-15° C. PDA liquid culture medium and culturing it to the logarithmic growth phase; the culture solution is centrifuged to collect the precipitate with a dry mass of 4-6 g / L and then resuspending it to obtain a culture suspension.

9. A use of the low-temperature-resistant multifunctional bacterial agent according to claim 1, characterized in that: Application of the strain in degrading antibiotics in polluted environments; Or; application of the strain in a stable environment for heavy metals; wherein the antibiotic is enrofloxacin and the heavy metal is zinc.

Images