Aspergillus tubingensis Pa6 and application thereof in prevention and treatment of fruit tree diseases

Abstract

The invention belongs to the technical field of biology, and discloses Aspergillus tubingensis Pa6 and application of the Aspergillus tubingensis Pa6 in prevention and treatment of fruit tree diseases in order to improve the biological prevention and treatment effect of the fruit tree diseases, the strain number of the Aspergillus tubingensis is Pa6, and the registration number of the Aspergillus tubingensis in the General Microbiological Center of China Committee for Culture Collection of Microorganisms is CGMCC No.41994. The invention further discloses an application of the Aspergillus tubingensis Pa6 in the prevention and treatment of the fruit tree diseases. The Aspergillus tubingensis can prevent and / or treat strawberry gray mold, strawberry black spot or pear tree rot, or can be used for preparing products for preventing and / or treating strawberry gray mold, strawberry black spot or pear tree rot. The bacterial strain also has a relatively good antibacterial effect on fungi such as strawberry botrytis cinerea, strawberry black spot pathogen, apple ring spot pathogen, apple colletotrichum gloeosporioides, pear rot pathogen and the like.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to Aspergillus tabinei Pa6 and its application in the prevention and control of fruit tree diseases. Background Technology

[0002] by Botrytis cinerea ( Botrytis cinerea Gray mold and Alternaria caused by ) Alternaria alternata Gray mold, caused by gray mold, is one of the most common diseases affecting strawberry fruit. The affected fruit is typically covered with a gray mold layer, severely impacting yield and quality. Besides the fruit, gray mold also damages other parts of the strawberry plant, such as flowers, stems, and leaves. Black spot disease primarily affects the strawberry berries, leaves, and stems, with symptoms manifesting as black spots on the surface of the fruit.

[0003] Pear tree rot is caused by pathogenic fungi. Valsa pyri This is a fungal disease that causes browning and rotting of the bark in pear trees. In severe cases, it can lead to necrosis of the bark of the main trunk, causing the entire tree to die and seriously affecting the sustainable development of pears.

[0004] Chemical pesticides are currently the most common and effective means of controlling fungal diseases such as strawberry gray mold, black spot, and pear canker. However, long-term and excessive use of single-target chemical pesticides not only increases the selective pressure on pathogens in the environment but also causes serious environmental pollution and food safety issues. Given these problems, the use of chemical pesticides is facing increasing restrictions. For example, some European countries have banned the use of chemical fungicides in the post-harvest stage. Therefore, there is an urgent need in production to find new methods or means to replace traditional chemical disease control to meet consumers' demands for fruit quality and green safety. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to improve the effectiveness of biological control of fruit tree diseases.

[0006] To solve the above-mentioned technical problems, the present invention first provides a strain of Aspergillus tabineus (… Aspergillus tubingensis )Pa6.

[0007] The Aspergillus tabineus provided by this invention ( Aspergillus tubingensis Aspergillus tabbini Pa6, with the registration number CGMCC No. 41994 at the China General Microbiological Culture Collection Center (CGMCC), was deposited on June 10, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. This strain will be referred to as Aspergillus tabbini Pa6 below.

[0008] When *Aspergillus tabineum* Pa6 was grown on PDA solid medium at 28°C for 3 days, the colonies were round, 3-4 cm in diameter, and white in color with white hairs on the surface. After 10 days, the colonies turned gray, the hyphae were septate, and it produced a large number of oval conidia. *Aspergillus tabineum* strain Pa6 possesses an 18S rDNA containing the sequence shown in SEQ ID No. 1, a tubulin gene containing the sequence shown in SEQ ID No. 2, and a calmodulin gene containing the sequence shown in SEQ ID No. 3.

[0009] Metabolites of Aspergillus tabineus Pa6 and / or cultures of Aspergillus tabineus Pa6 are also within the scope of protection of this invention.

[0010] In the above text, the metabolites of *Aspergillus tabinei* Pa6 can be the fermentation broth of *Aspergillus tabinei* Pa6 or its filtrate. The fermentation broth of *Aspergillus tabinei* Pa6 can be prepared by the following method: *Aspergillus tabinei* Pa6 is cultured in a liquid fermentation medium, and the fermentation broth (containing *Aspergillus tabinei* Pa6 and substances secreted into the liquid medium) is collected. This fermentation broth is the fermentation broth of *Aspergillus tabinei* Pa6. The fermentation broth of *Aspergillus tabinei* Pa6 is then filtered to obtain the filtrate.

[0011] In the above text, the culture of Aspergillus tabinei Pa6 is a substance obtained by culturing Aspergillus tabinei Pa6 in a microbial culture medium (such as fermentation broth containing Aspergillus tabinei Pa6 and substances secreted into the liquid culture medium, or substances containing Aspergillus tabinei Pa6 and substances secreted into the solid culture medium).

[0012] The metabolites of Aspergillus tabineus Pa6 and / or the cultures of Aspergillus tabineus Pa6 have at least one of the following functions: W1-W6 W1, inhibits fungal activity; W2, inhibits gray mold in strawberries Botrytis cinerea The activity; W3, inhibits strawberry black spot disease. Alternaria alternate The activity; W4, inhibits apple ring rot fungus Botryosphaeria dothidea The activity; W5, inhibits apple anthracnose bacteria Colletotrichum gloeosporioides The activity; W6, inhibits pear tree rot pathogens Valsa pyri The activity.

[0013] To address the above technical problems, the present invention also provides a product containing Aspergillus tabineum Pa6 or / and Aspergillus tabineum Pa6 metabolites or / and Aspergillus tabineum Pa6 cultures.

[0014] The product may be a microbial agent or a microecological preparation containing the microbial agent.

[0015] The product may specifically be any of the following products: U1. Products for the prevention and / or treatment of gray mold in strawberries; U2. Products for the prevention and / or treatment of strawberry black spot disease; U3, Products for the prevention and / or treatment of pear tree rot; U4, products that inhibit fungi.

[0016] In the above-mentioned products, the application object of the products is plants, which can be dicotyledonous plants or monocotyledonous plants. The dicotyledonous plants can be plants of the Rosaceae family, specifically plants of the genus Strawberry (e.g., strawberry), Pyrus (e.g., pear), or Malus (e.g., apple).

[0017] The active ingredient of the above products may be Aspergillus tabinei Pa6 or / and Aspergillus tabinei Pa6 metabolites or / and Aspergillus tabinei Pa6 cultures. The active ingredient of the above products may also contain other biological or non-biological components. Other active ingredients of the above products can be determined by those skilled in the art based on the effects of the products.

[0018] The above products can be liquid or solid microbial agents.

[0019] The product may also include a carrier. The carrier may be a solid carrier or a liquid carrier. The solid carrier may be a mineral material or a biological material; the mineral material may be at least one of peat moss, clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the biological material may be at least one of various crop straws, pine shells, rice straw, peanut shells, corn flour, soybean flour, starch, peat moss, and animal manure; the liquid carrier may be water; in the product, Aspergillus tabinei Pa6 or / and Aspergillus tabinei Pa6 metabolites may be present in the form of cultured live cells, fermentation broth of live cells, filtrate of cell culture, or a mixture of cells and filtrate.

[0020] The product can be in various dosage forms, such as liquid, emulsion, suspension, powder, granules, wettable powder or water-dispersible granules.

[0021] Depending on the requirements, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH adjusters, etc. may also be added to the product.

[0022] The use of Aspergillus tabinei Pa6 or / and its metabolites or / and its cultures or / and the products thereof in the prevention and / or treatment of gray mold in strawberries is within the scope of protection of this invention.

[0023] The use of Aspergillus tabinei Pa6 or / and its metabolites or / and its cultures or / and the products thereof in the prevention and / or treatment of strawberry black spot disease is within the scope of protection of this invention.

[0024] The use of Aspergillus tabinei Pa6 or / and its metabolites or / and its culture or / and the product thereof in the prevention and / or treatment of pear tree rot is within the scope of protection of this invention.

[0025] The use of Aspergillus tabinei Pa6 or / and its metabolites or / and its cultures or / and the products thereof in inhibiting fungal activity also falls within the scope of protection of this invention: The method for culturing Aspergillus tabineus Pa6 is also within the scope of protection of this invention.

[0026] The method for culturing Aspergillus tabineus Pa6 provided by the present invention includes the step of culturing Aspergillus tabineus Pa6 in a culture medium.

[0027] The method for preparing the product is also within the scope of protection of this invention.

[0028] The method for preparing the product provided by the present invention includes the step of using Aspergillus tabineum Pa6 or / and a culture of Aspergillus tabineum Pa6 or / and a metabolite of Aspergillus tabineum Pa6 as components of the product to obtain the product, wherein the product is a liquid inoculant or a solid inoculant.

[0029] In the above method, the product can be a liquid bacterial agent.

[0030] In the above method, Aspergillus tabineis Pa6 can be cultured in a fermentation medium to obtain a fermentation broth. The fermentation broth is then mixed with a carrier to obtain the liquid inoculum. The fermentation medium can consist of: 200 g of potato, 20 g of D+ anhydrous glucose, 15 g of agar, and distilled water to a final volume of 1000 mL.

[0031] Experiments have shown that *Aspergillus tabineus* Pa6 of this invention has good antibacterial activity and can inhibit fungal activity. *Aspergillus tabineus* Pa6 of this invention has excellent biological control effects against strawberry gray mold, strawberry black spot, and pear canker. *Aspergillus tabineus* Pa6 does not cause environmental pollution, has simple cultivation conditions, is easy to store, and is convenient to process, making it suitable for development and application.

[0032] Preservation Instructions Classification and nomenclature of biological materials: Aspergillus tabineum Latin scientific name of biological material: Aspergillus tubingensis Strain number of the biological material: Pa6 Full name of the depository: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee Abbreviation of depositary institution: CGMCC Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Postcode: 100101 Deposit date: June 10, 2025 Accession number: CGMCC No. 41994 Attached Figure Description Figure 1 This is a phylogenetic tree constructed based on the 18S rDNA, tubulin gene, and calmodulin gene sequences of strain Pa6 in Example 1 of the present invention.

[0033] Figure 2 This illustrates the inhibitory effect of strain Pa6 in Example 2 of the present invention on different fruit tree pathogenic fungi.

[0034] Figure 3 This figure illustrates the control efficacy of strain Pa6 filtrate against strawberry gray mold and black spot in Example 2 of this invention. In the figure, CK represents spraying with sterile PDB liquid culture medium, 10% Pa6 represents spraying with 10% strain Pa6 filtrate, and 20% Pa6 represents spraying with 20% strain Pa6 filtrate. Different lowercase letters represent significant differences between treatments, with p < 0.05.

[0035] Figure 4 The figure shows the effect of strain Pa6 filtrate on the inhibition of pear tree canker disease. In the figure, CK is the control group, the treatment group is the strain Pa6 filtrate treatment group, and the treatment group is the flusilazole treatment group. Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, all quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Experimental data were statistically analyzed using Excel and SPSS software.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are conventional biochemical reagents and are commercially available.

[0039] The pathogens used in the following examples are as follows: PDA liquid medium: 200 g potato, 20 g D+ anhydrous glucose, 15 g agar, and distilled water to a final volume of 1000 mL.

[0040] Pear tree rot pathogens Valsa pyri Preserved in this laboratory, and recorded in the non-patent literature "Yuan Hongbo, Hou Hui, Zhou Zengqiang, Wang Li, Tu Hongtao. Isolation and identification of JK2, an antagonistic fungus against pear canker. Journal of Fruit Science. https: / / doi.org / 10.13925 / j.cnki.gsxb.20200141", the public can obtain it from the applicant to repeat the experiments of this invention.

[0041] Apple ring rot fungus Botryosphaeria dothidea Preserved by this laboratory, it is recorded in the non-patent document "Isolation and Characterization of Bacillus velezensis Strain P2-1 for Biocontrol of Apple Postharvest Decay Caused by Botryosphaeria dothidea", the name in that document is Botryosphaeria dothidea The public can obtain the materials from the applicant to repeat the experiments of this invention.

[0042] Apple anthracnose bacteria Colletotrichum gloeosporioides Preserved by this laboratory, it is recorded in the non-patent document "Isolation and Characterization of Bacillus velezensis Strain P2-1 for Biocontrol of Apple Postharvest Decay Caused by Botryosphaeria dothidea", the name in that document is Colletotrichum gloeosporioides The public can obtain the materials from the applicant to repeat the experiments of this invention.

[0043] strawberry gray mold Botrytis cinerea Preserved by this laboratory and recorded in non-patent literature (the name in that literature is Botrytis cinerea ( Botrytiscinerea “Wang Zhuoni, Qin Genhong, Wang Li, Hou Hui, Yuan Hongbo, Zhou Houcheng, Gong Wenfeng, Tu Hongtao. Screening of antagonistic bacteria against strawberry diseases and their control effect on strawberry brown leaf spot [J]. China Vegetables, 2023(02):63-71.DOI:10.19928 / j.cnki.1000-6346.2023.5012.” The public can obtain the experimental data from the applicant to repeat the present invention.

[0044] Strawberry black spot disease Alternaria alternata This is preserved in our laboratory and recorded in the non-patent literature "Analysis of the inhibitory activity of Fusarium oxysporum strain Pa2 against strawberry black spot pathogen [J]. Journal of Fruit Science, 2024, 41 (2): 314-324. DOI:10.13925 / j.cnki.gsxb.20230358.", in which the pathogen is named strawberry black spot pathogen (… Alternaria alternata The public can obtain the materials from the applicant to repeat the experiments of this invention.

[0045] Example 1: Isolation and Screening of Strains 1. Isolation and purification of bacterial strains In June 2021, Yuan Hongbo (contact number: 13301129979, email: yuanhongbo@caas.cn) isolated endophytic fungi from the phloem of apple tree branches in Zhengzhou, Henan Province. One strain was identified morphologically and molecularly as *Aspergillus tabinei*. Aspergillus tubingensis It was named Pa6. Its separation method is as follows: A 5×5 mm apple tree branch tissue block was selected, disinfected with 75% ethanol for 1 min, and then surface-sterilized with 1% NaClO for 5 min. It was then rinsed three times with sterile water, and the surface water was blotted dry with sterile filter paper. The tissue block was placed on PDA medium containing 100 mg / L kanamycin sulfate and incubated at 25°C, with observations every 24 h. After colony formation, strains with different colony morphologies were picked, inoculated onto fresh PDA medium, and purified to obtain single-colony pure strains for later use. One of these strains was named Pa6.

[0046] When strain Pa6 was grown on PDA solid medium at 28℃ for 3 days, the colonies were round, 3-4 cm in diameter, and white in color with white hairs growing on the surface. After 10 days, the colonies turned gray, the hyphae were septate, and a large number of conidia were produced, which were oval in shape.

[0047] Single colonies of strain Pa6 were picked and cultured in PDB liquid medium to obtain a fresh culture of Pa6. 10 mL of the fresh culture was centrifuged at 4°C and 10,000 rpm for 5 minutes to collect the bacterial cells. DNA was extracted using a DNA extraction kit. After electrophoresis, the 18S rDNA sequence of strain Pa6 was amplified using primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'), yielding a 591 bp fragment (SEQ ID No. 1 in the sequence listing). A partial coding sequence of the tubulin gene of strain Pa6 was amplified using primers Bt2a (5′-GGTAACCAAATCGGTGCTGCTTTC-3′) and Bt2b (5′-ACCCTCAGTGTAGTGACCCTTGGC-3′), yielding a 530 bp fragment (SEQ ID No. 2 in the sequence listing). Strain Pa6 was amplified using primers CMD5 (5′-CCGAGTACAAGGAGGCCTTC-3′) and CMD6 (5′-CCGATAGAGGTCATAACGTGG-3′). A partial coding sequence of the calmodulin gene (CAL) was obtained, yielding a 585 bp fragment (SEQ ID No. 3 in the sequence listing). SEQ ID No. 1: CTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGCGGGGAGAGAAAA SEQ ID NO.2: GTGCTGCTTTCTGGTACGTATTCACTGCCACTGGATTGGGGATGGAACATCATCTCTCAAGCTATCTTAGCTTGAGTTCAGATGTTATCCATCGGGTATATAGCTATCGGGTTAAGAACACGTCTAACAACTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTACAACTTTTTCACACCTCTCAATTGGTCAACAATGTGGAAAGGATTGGGTTTCCTGACGCGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTTAGATCACACCGTCCCTGAGTTTTTTCACGACAATATCATCAATGTCCTGACCACTTCAGCAGGCTAGCGGTAACAAGTATGTCCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCA SEQ ID NO.3: TCCGAGTACAAGGAGGCCTTCTCCCTCTTTGTGAGTGCTCCCTGAATGAACCCCCGATCACTCAAATTGATGTCCTATCTTAACCGGCTCATAATGCTAATGTATTTTCAAACTCAATAGGACAAGGATGGCGATGGTGGGTGGAA TTCTGTCCCCTTCACGTTTTACCTGTAGCGCCCGATCCGACCGCGGGATTTCGACAGCTATTTCCCCCTTCGATCTGAATCATAATACTGATGTAATCTGGAAATAGGCCAGATCACCACCAAGGAGCTCGGCACTGTGATGCGCT CCCTCGGCCAGAACCCCTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGAACGATCGACTTCCCCGGTATGTGATAGATCTACGCCTGTAAGGCGGGAATGCCTATGGATTGTGATTGACTTTT GCCGCCAGAATTCCTTACCATGATGGCTCGTAAGATGAAGGACACCGACTCCGAGGAGGAAATCCGCGAGGCTTTCAAGGTCTTCGACCGCGACAACAATGGTTTCATCTCCGCCGCGGAGTTGCGCCACGTTATGACCTCTATCGG A phylogenetic tree was constructed by combining the 18S rDNA, tubulin gene, and calmodulin gene sequences of strain Pa6. Figure 1 The results showed that strain Pa6 was similar to Aspergillus tabingensis. Aspergillus tubingensis They are clustered together.

[0048] Based on the physiological and biochemical characteristics of strain Pa6, a preliminary classification was made according to the "Handbook of Fungal Identification," and then combined with... Figure 1 Phylogenetic tree clustering results constructed by combining the 18S rDNA, tubulin gene, and calmodulin gene sequences confirmed that strain Pa6 belongs to Aspergillus tabineus (Aspergillus). Aspergillus tubingensis ).

[0049] Based on the above morphological analysis, 18S rDNA, and microtubule and calmodulin gene sequence analysis results, strain Pa6 was identified as Aspergillus tabinei. Aspergillus tubingensis .

[0050] strain Pa6 is Aspergillus tabinei (Aspergillus tubingensis This strain was deposited on June 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Its registration number at CGMCC is CGMCC No. 41994. It will be referred to as *Aspergillus tabinei* Pa6 below.

[0051] Example 2: Biocontrol effect of Aspergillus tabine Pa6 The inhibitory effect of isolated and purified endophytic fungal strains on fruit tree pathogens was detected using a plate confrontation experiment.

[0052] The pathogen was inoculated onto PDA plates and incubated at 25°C for 4 days. Uniformly grown bacterial colonies were then punched out using a 5mm diameter punch and inoculated into the center of the PDA plate. Strain Pa6 was inoculated 2cm above, below, to the left, and to the right of the pathogen. A control group containing only the pathogen was used. Ten plates were inoculated for each treatment, and all plates were incubated at 25°C. Three replicates were performed. After the pathogen in the control group had completely covered the entire culture dish, its inhibition rate was calculated.

[0053] The pathogens used were *Botrytis cinerea*, the causal agent of strawberry mold. Botrytis cinerea Strawberry black spot fungus Alternaria alternate Apple ring rot fungus Botryosphaeria dothidea Apple anthracnose bacteria Colletotrichum gloeosporioides Pear tree rot pathogens Valsa pyri .

[0054] Inhibition rate (%) = (Control colony diameter - Treatment colony diameter) / Control plate colony diameter × 100%.

[0055] The results showed that the endophytic fungus Pa6 exhibited a strong inhibitory effect on *Botrytis cinerea*, *Botrytis cinerea*, *Botrytis cinerea*, *Botrytis cinerea*, and *Botrytis cinerea* (see [link to study]). Figure 2 The inhibition rates were 81.51%, 77.37%, 81.28%, 73.85%, and 73.30%, respectively.

[0056] 2. Inhibitory effect of strain Pa6 filtrate on gray mold and black spot fungus of strawberry. Five mycelial discs were taken from the edge of a Pa6 colony cultured on a PDA for 3 days using a 5 mm diameter punch. These discs were inoculated into 100 mL of PDB liquid medium and cultured at 25°C and 180 r / min for 6 days. After centrifugation at 4000 r / min for 20 min, the supernatant of strain Pa6 was collected and filtered through a 0.22 μm filter membrane to obtain the sterile supernatant of Pa6, i.e., strain Pa6 filtrate.

[0057] 2.1 Inhibitory effect of strain Pa6 filtrate on strawberry gray mold The filtrate of strain Pa6 was mixed with PDA liquid medium cooled to about 50°C to prepare supernatant media with final concentrations of 5%, 10%, and 20% of strain Pa6 filtrate, respectively, according to a volume ratio. After the medium solidified, strawberry gray mold mycelium (5 mm in diameter) was inoculated in the center of the plate. PDA plates without supernatant were used as controls. Three replicates were set, and the plates were incubated in the dark at 25°C for 3 days. The inhibition rate at different concentrations was calculated.

[0058] The results showed that the sterile filtrate of Pa6 had a significant inhibitory effect on gray mold of strawberry (see Table 1).

[0059] Table 1. Inhibition rate of strain Pa6 filtrate against *Botrytis cinerea*, the causal agent of gray mold on strawberries.

[0060] 2.2 Inhibitory effect of strain Pa6 filtrate on strawberry black spot fungus The supernatant was mixed with PDA liquid medium cooled to about 50°C at a volume ratio to prepare supernatant media with final concentrations of 5%, 10%, and 20% for strain Pa6. After the media solidified, strawberry black spot fungus cakes (5 mm in diameter) were inoculated in the center of the plates. PDA plates without supernatant were used as controls. Three replicates were set, and the plates were incubated in the dark at 25°C for 3 days. The inhibition rate at different concentrations was calculated.

[0061] The results showed that the sterile filtrate of Pa6 also had a significant inhibitory effect on strawberry black spot fungus (Table 2).

[0062] Table 2. Inhibition rate of strain Pa6 filtrate against strawberry black spot fungus.

[0063] 3. The control effect of strain Pa6 filtrate on gray mold and black spot diseases in strawberries. Five mycelial discs were taken from the edge of a Pa6 colony cultured on a PDA for 3 days using a 5 mm diameter punch. These discs were inoculated into 100 mL of PDB liquid medium and cultured at 25°C and 180 r / min for 6 days. After centrifugation at 4000 r / min for 20 min, the supernatant of strain Pa6 was collected and filtered through a 0.22 μm filter to obtain a sterile supernatant of Pa6, i.e., strain Pa6 filtrate. The strain Pa6 filtrate was then mixed with PDB liquid medium at a volume ratio to prepare liquids with final concentrations of 10% and 20% strain Pa6 filtrate, respectively designated as 10% strain Pa6 filtrate and 20% strain Pa6 filtrate.

[0064] Select uniform and healthy strawberry fruits. After surface disinfection, spray the strawberries with 10% and 20% strain Pa6 filtrate, respectively. Then, inoculate with strawberry gray mold or strawberry black spot fungal cakes (0.5 cm in diameter). Six fruits are inoculated for each treatment. Spraying with sterile PDB liquid medium serves as the control (CK). Place the treated fruits in 2L plastic boxes and incubate them in a 25℃ light incubator. Observe the disease development after 3 days and measure the diameter of the lesions.

[0065] The results showed that the filtrate of strain Pa6 had significant control effects on both gray mold and black spot diseases in strawberries. Figure 3 Statistical results showed that when the diameter of the lesions on the control strawberry fruit inoculated with gray mold was 2.21 cm, the lesions on the strawberry fruit treated with 10% strain Pa6 filtrate and 20% strain Pa6 filtrate were 1.63 cm and 1.22 cm, respectively; when the diameter of the lesions on the control strawberry fruit inoculated with black spot was 2.51 cm, the lesions on the strawberry fruit treated with 10% strain Pa6 filtrate and 20% strain Pa6 filtrate were 2.09 cm and 1.68 cm, respectively. Figure 3 These results indicate that the filtrate of strain Pa6 has significant control effects on both gray mold and black spot diseases in strawberries.

[0066] 4. The inhibitory effect of strain Pa6 filtrate on the incidence of pear tree canker pathogen. Five mycelial discs were taken from the edge of a Pa6 colony cultured on a PDA for 3 days using a 5 mm diameter punch. These discs were inoculated into 100 mL of PDB liquid medium and cultured at 25°C and 180 r / min for 6 days. After centrifugation at 4000 r / min for 20 min, the supernatant of strain Pa6 was collected and filtered through a 0.22 μm filter membrane to obtain the sterile supernatant of Pa6, i.e., strain Pa6 filtrate.

[0067] One-year-old healthy pear tree branches were selected and subjected to three treatments: Treatment group with strain Pa6 filtrate: The branches were sprayed evenly with strain Pa6 filtrate.

[0068] Control group: The branches were sprayed with sterile PDB medium.

[0069] Positive control group treated with flusilazole: Flusilazole (BASF Plant Protection (Jiangsu) Co., Ltd., Pesticide Registration Certificate No.: PD20151919, Production License No.: Pesticide Production Permit (Su) 0002, Product Quality Standard No.: Q / 320623 BCPJ05-2021, Active ingredient content: 125g / ) was diluted 1000 times and sprayed on the branches.

[0070] After spraying, fungal blocks were extracted from the edge of pear tree rot pathogens that had grown on PDA plates for 4 days using a 5mm diameter punch. These blocks were then inoculated onto pear branches in both the treatment and control groups, with 10 branches in each group. The length of the lesions was assessed 7 days after inoculation.

[0071] The results showed that treatment with the filtrate of strain Pa6 significantly inhibited the incidence of pear canker pathogens (Table 3). Figure 4 The diameter of canker lesions on pear branches in the treatment group was significantly smaller than that in the control group (p<0.01), while the positive control, flusilazole treatment, showed no symptoms. Therefore, the severity of canker pathogens on pear branches in the treatment group was significantly lower than that on the control group.

[0072] Table 3. Effects of strain Pa6 filtrate on the severity of pear canker disease.

[0073] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Aspergillus tabineensis, characterized by: The Aspergillus tubingensis mentioned is strain number Pa6, and its registration number at the China General Microbiological Culture Collection Center is CGMCC No. 41994.

2. Metabolites or cultures of Aspergillus tabineus Pa6, characterized in that: The metabolite is the fermentation broth of Aspergillus tabinei Pa6 as described in claim 1; the culture is the substance obtained by culturing Aspergillus tabinei Pa6 as described in claim 1 in a microbial culture medium.

3. The metabolites or cultures of Aspergillus tabinea Pa6 as described in claim 2, characterized in that: It has at least one of the following functions: W1-W6 W1, inhibits fungal activity; W2, inhibits gray mold in strawberries Botrytis cinerea The activity; W3, inhibits strawberry black spot disease. Alternaria alternate The activity; W4, inhibits apple ring rot fungus Botryosphaeria dothidea The activity; W5, inhibits apple anthracnose bacteria Colletotrichum gloeosporioides The activity; W6, inhibits pear tree rot pathogens Valsa pyri The activity.

4. A product, characterized in that: Metabolites or cultures containing Aspergillus tabineum Pa6 as described in claim 1 or / and Aspergillus tabineum Pa6 as described in any of claims 2-3.

5. The product according to claim 4, characterized in that: For any of the following products: U1. Products for the prevention and / or treatment of gray mold in strawberries; U2. Products for the prevention and / or treatment of strawberry black spot disease; U3, Products for the prevention and / or treatment of pear tree rot; U4, products that inhibit fungi.

6. The use of Aspergillus tabineum Pa6 of claim 1 or / and the metabolites or cultures of Aspergillus tabineum Pa6 of any one of claims 2-3 or / and the product of claim 4 or 5 in the prevention and / or treatment of gray mold in strawberries.

7. The use of Aspergillus tabineum Pa6 of claim 1 or / and the metabolites or cultures of Aspergillus tabineum Pa6 of any one of claims 2-3 or / and the product of claim 4 or 5 in the prevention and / or treatment of strawberry black spot disease.

8. The use of Aspergillus tabineum Pa6 as described in claim 1 or / and the metabolites or cultures of Aspergillus tabineum Pa6 as described in any one of claims 2-3 or / and the products described in claims 4 or 5 in the prevention and / or treatment of pear tree rot.

9. The use of Aspergillus tabineum Pa6 of claim 1 or / and the metabolites or cultures of Aspergillus tabineum Pa6 of any one of claims 2-3 or / and the products of claim 4 or 5 in inhibiting fungal activity.

10. The method for culturing Aspergillus tabineum Pa6 as described in claim 1, characterized in that: The step includes culturing Aspergillus tabinei Pa6 as described in claim 1 in a culture medium.

Images