Methods for modulating the transcription level of the vrnl gene of plants of the tribe poeae, biological materials and uses thereof

Abstract

The application provides a method for regulating the transcription level of a VRN1 gene of a plant in the subfamily Pooideae, a biological material and application thereof. The method comprises: editing a target segment in a promoter region upstream of a VRN1 gene of a target plant, the editing comprising deletion, replacement or addition of at least one nucleotide, so as to regulate the transcription level of the VRN1 gene of the target plant; the target segment comprises a nucleotide sequence composed of 14 bp upstream of a VRN1pVRN-box nucleic acid molecule, the VRN1pVRN-box nucleic acid molecule and 18 bp downstream of the VRN1pVRN-box nucleic acid molecule; and the VRN1pVRN-box nucleic acid molecule comprises a polynucleotide containing a nucleotide sequence as shown in SEQ ID NO: 1 or the like. The method can solve the problem of excessively long vernalization time of winter plants in the prior art, and is suitable for the field of biotechnology.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method, biomaterial, and application of regulating the transcription level of the VRN1 gene in plants of the Pooideae subfamily. Background Technology

[0002] Crops of the Pooideae subfamily are often divided into spring and winter crops. Winter crops need to undergo a long vernalization period before they can enter the reproductive growth stage, including wheat, barley, rye, and oats.

[0003] Common wheat (Triticum aestivum L.) is a major food crop for humankind and the world's second-largest crop by yield, playing a vital role in the national economy. Based on the heading rate after spring sowing, wheat can be divided into spring and winter varieties. Spring wheat has a heading rate >30% after spring sowing when the average sowing temperature reaches 7℃, while winter wheat has a heading rate ≤30%. Comparatively, winter wheat varieties have more tillers and ears per plant and higher yield per unit area than spring wheat varieties. Winter wheat also shows a significantly higher yield per unit area. Winter wheat is sown around mid-October, enters the flowering period in late April or early May of the following year, and is harvested around mid-June. However, because the vernalization period, flowering period in May, and harvest period in June occur in major winter wheat-growing areas that are prone to extreme weather events, including extremely low temperatures, heavy rainfall, or hot, dry winds, there have been reports of reduced winter wheat yields due to extreme weather in recent years.

[0004] Although existing technologies often shorten the wheat growth cycle by reducing vernalization and flowering time to avoid yield reduction caused by extreme weather, winter wheat still needs to overwinter to carry out vegetative growth. Therefore, even if existing technologies can shorten the vernalization time to some extent, the reduction is still limited and it is still difficult to guarantee that it can completely avoid the damage caused by extreme weather during overwintering, flowering and harvesting. The effect on shortening the complete growth cycle of wheat or increasing yield is minimal. Summary of the Invention

[0005] The main objective of this invention is to provide a method, biomaterial, and application for regulating the transcription level of the VRN1 gene in Pooideae plants, in order to solve the problem of excessively long vernalization time in existing technologies.

[0006] To achieve the above objectives, according to a first aspect of the present invention, a method for regulating the transcription level of the VRN1 gene in a Pooideae plant is provided. The method comprises: editing a target segment in the promoter region upstream of the VRN1 gene of the Pooideae plant; the editing includes deleting, replacing, or adding at least one nucleotide, thereby regulating the transcription level of the VRN1 gene in the Pooideae plant; the target segment comprises a nucleotide sequence consisting of a 14bp upstream of the VRN1pVRN-box nucleic acid molecule, an VRN1pVRN-box nucleic acid molecule, and an 18bp downstream of the VRN1pVRN-box nucleic acid molecule connected sequentially; the VRN1pVRN-box nucleic acid molecule is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a polynucleotide having more than 70% homology to the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

[0007] Furthermore, the nucleotide sequence of the target region includes: SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0008] Further, editing includes any one or more of the following: a) inserting one or more nucleotides into the target segment; b) replacing one or more nucleotides in the target segment with other nucleotides different from the one or more nucleotides; or c) deleting one or more nucleotides in the target segment; preferably, c) includes deleting at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides in the target segment, the deleted nucleotides including nucleotides in the VRN1pVRN-box nucleic acid molecule; preferably, editing the target segment includes any one of the following: replacing the nucleotide sequence of the target segment shown in SEQ ID NO: 2 with any one of the nucleotide sequences shown in SEQ ID NOs: 5-9; replacing the nucleotide sequence of the target segment shown in SEQ ID NO: 3 with SEQ ID NO: 5-9. NOs: Any of the nucleotide sequences shown in SEQ ID NO: 10-11; replace the target segment shown in SEQ ID NO: 4 with any of the nucleotide sequences shown in SEQ ID NOs: 12-16.

[0009] Further, the editing method includes: introducing genetic material for expressing nucleases and / or for transcribing guide RNA into cells or tissues of Pooideae plants, editing the target segment; culturing the introduced cells or tissues into complete plants to obtain Pooideae plants with shortened vernalization time; preferably, the genetic material includes a DNA circular plasmid, a linear DNA fragment, or RNA transcribed in vitro; preferably, the genetic material for expressing nucleases and the genetic material for transcribing guide RNA are located in the same or different genetic material; preferably, the nuclease is capable of specifically cleaving functional segments in the target segment; preferably, the genetic material includes a recombinant vector capable of transcribing guide RNA and expressing Cas protein; preferably, the guide RNA is composed of crRNA and trac... rRNA is an RNA with a palindromic structure formed by partial base pairing; preferably, crRNA includes RNA fragments that can bind complementary to functional segments; preferably, the target segment is edited using gene editing tools, including CRISPR / Cas9, CRISPR / Cas12, or the RED recombination system; preferably, the method for introducing genetic material into the cells or tissues of Pooideae plants includes gene gun method, Agrobacterium infection method, PEG-induced protoplast method, electrode method, silicon carbide fiber-mediated method, or vacuum infiltration method; preferably, the cells of Pooideae plants include protoplast cells or suspension cells; preferably, the tissues of Pooideae plants include callus, immature embryo, mature embryo, leaf, shoot tip, young spike, or hypocotyl.

[0010] Further, the Pooideae subfamily includes wheat, oats, rye or barley; preferably, wheat includes diploid wheat, tetraploid wheat or hexaploid wheat; preferably, hexaploid wheat includes common hexaploid wheat; preferably, common hexaploid wheat includes Kenong wheat, more preferably Kenong 9204 wheat, Kenong 1002 wheat or Kenong 8162 wheat.

[0011] To achieve the above objectives, according to a second aspect of the present invention, a biomaterial for regulating the transcription level of the VRN1 gene in Pooideae plants is provided. This biomaterial comprises one or more of DNA, RNA, or protein for editing a target segment. The target segment comprises a nucleotide sequence consisting of a 14bp upstream, an 18bp downstream, and a VRN1pVRN-box nucleic acid molecule connected sequentially. The VRN1pVRN-box nucleic acid molecule is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a polynucleotide having more than 70% homology to the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

[0012] Further, the biological material includes a first DNA capable of expressing a nuclease and / or a second DNA encoding a guide RNA for targeting a target segment; preferably, the second DNA includes a third DNA encoding a crRNA and a fourth DNA encoding a tracrRNA, the crRNA being capable of complementary base pairing with all or part of the bases on the target segment; preferably, the target segment is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0013] Furthermore, the guide RNA comprises a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0014] Further, the Pooideae subfamily includes wheat, oats, rye or barley; preferably, wheat includes diploid wheat, tetraploid wheat or hexaploid wheat; preferably, hexaploid wheat includes common hexaploid wheat; preferably, common hexaploid wheat includes Kenong wheat, more preferably Kenong 9204 wheat, Kenong 1002 wheat or Kenong 8162 wheat.

[0015] To achieve the above objectives, according to a third aspect of the present invention, a method for regulating the transcription level of the VRN1 gene in any of the above-mentioned plants of the Pooideae subfamily or a biological material for regulating the transcription level of the VRN1 gene in any of the above-mentioned plants is provided, for use in shortening the vernalization time, shortening the growth period of plants of the Pooideae subfamily or in the breeding of plants of the Pooideae subfamily.

[0016] By applying the technical solution of this invention, it has been found that the promoter region upstream of the VRN1 gene in Pooideae plants plays a role in inhibiting the expression of this gene during vernalization. Therefore, this application edits the VRN1pVRN-box nucleic acid molecule and its upstream 14bp and downstream 18bp nucleotide sequence in the target plant, as shown in SEQ ID NO: 1, to disrupt its integrity, thereby relieving the inhibition of VRN1 gene expression, increasing the transcription level of this gene, and obtaining a winter-growing plant that can quickly enter reproductive growth without vernalization treatment. Attached Figure Description

[0017] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0018] Figure 1 The diagram shows the nucleotide sequences of the pre-translational promoter regions of the wheat TaVRN1A, TaVRN1B, TaVRN1D, barley HvVRN1, rye ScVRN1, oat AsVRN1A, AsVRN1C, and AsVRN1D genes according to embodiments of this application.

[0019] Figure 2 The figure shows the statistical results of heading time of wild-type Kenong 9204 wheat and its edited mutants according to Example 1 of this application.

[0020] Figure 3 The diagram illustrates gene editing of target regions in the promoter regions of the TaVRN1A, TaVRN1B, and TaVRN1D genes in the Kenong 9204 wheat according to Example 2 of this application; wherein, Figure 3 A in the diagram represents the first 240 to the first 1 nucleotide sequence of the translation initiation sites of the TaVRN1A, TaVRN1B, and TaVRN1D genes, as well as the binding of sgRNA1 and sgRNA2 to their gene promoter regions. Figure 3 Figure B is a schematic diagram of the target design using CRISPR / Cas9 technology.

[0021] Figure 4 The figure shows the phenotypic identification results of the target segment editing mutants of the promoter regions of the TaVRN1A, TaVRN1B and TaVRN1D genes in the Kenong 9204 wheat according to Example 2 of this application.

[0022] Figure 5The diagram shows a schematic representation of the nucleotide sequences of target region editing mutants of the promoter regions of the TaVRN1A, TaVRN1B, and TaVRN1D genes in the Kenong 9204 wheat variety according to Example 2 of this application; wherein, Figure 5 China A Figure 5 China B and Figure 5 The diagrams in C represent the edited nucleic acid sequences of the target regions in the promoter regions of the TaVRN1A, TaVRN1B, and TaVRN1D genes, respectively.

[0023] Figure 6 The figure shows a statistical graph of TaVRN1 gene expression during tillering of the wild-type Kenong 9204 wheat edited mutant according to Example 2 of this application. Detailed Implementation

[0024] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0025] Terminology Explanation:

[0026] Spring sowing heading rate: The percentage of the average number of headings of a variety in the same sowing period to the average maximum total number of stems of that variety in spring sowing.

[0027] Promoter: A DNA sequence located upstream of the 5' end of a structural gene that activates RNA polymerase, enabling it to bind accurately to the template DNA and possessing transcription initiation specificity.

[0028] Subgenome: Different chromosomal groups within a polyploid.

[0029] As mentioned in the background art, in the prior art, winter wheat requires a long vernalization period to transition from vegetative growth to reproductive growth, which makes it more susceptible to extreme weather at different growth stages, thus affecting yield. Therefore, in this application, the inventors attempted to explore genes related to the vernalization time of wheat and proposed a series of protection schemes based on the research results.

[0030] In a first typical embodiment of this application, a method for regulating the transcription level of the VRN1 gene in a Pooideae subfamily is provided. The method includes: editing a target segment in the promoter region upstream of the VRN1 gene of the Pooideae subfamily, the editing including deleting, replacing, or adding at least one nucleotide, thereby regulating the transcription level of the VRN1 gene of the Pooideae subfamily; the target segment includes a nucleotide sequence consisting of a 14bp upstream of the VRN1pVRN-box nucleic acid molecule, an VRN1pVRN-box nucleic acid molecule, and an 18bp downstream of the VRN1pVRN-box nucleic acid molecule connected in sequence; the VRN1pVRN-box nucleic acid molecule is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a polynucleotide having more than 70% homology with the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25. The aforementioned regulation involves upregulating the transcriptional level of the VRN1 gene by editing the target region. Specifically, this involves editing the nucleotide sequence of the target region containing the VRN-box nucleic acid molecule in the promoter region upstream of the VRN1 gene in the target plant. This removes the inhibitory effect of the VRN-box nucleic acid molecule on the VRN1 gene, allowing gramineous plants to transition from vegetative to reproductive growth without vernalization. Editing the target region upregulates the transcriptional level of the VRN1 gene.

[0031] VRN1pVRN-box (from wheat): SEQ ID NO: 1: TTAAAAACCCCTCCCC.

[0032] HvVRN1pVRN-box (from Damai): SEQ ID NO: 21: TTAAAACCCCCTCCCA.

[0033] ScVRN1pVRN-box (from Rye): SEQ ID NO: 22: TTAAAAACCCTCCCCC.

[0034] AsVRN1ApVRN-box (from oats): SEQ ID NO: 23: CTAAAAACCTCCTCCC.

[0035] AsVRN1CpVRN-box (from oats): SEQ ID NO: 24: TTAAAAACCTCCTCCC.

[0036] AsVRN1DpVRN-box (from oats): SEQ ID NO: 25: TTAAAAACCTCCTCCC.

[0037] The VRN1 gene in Pooideae plants encodes the MADS box transcription factor, which plays a crucial role in their growth and development, flowering time regulation, and fruit ripening. Therefore, the deletion of the VRN1 gene will affect their growth, development, flowering, and fruit setting. Upstream of the VRN1 gene is a promoter region containing the VRN-box nucleic acid sequence, which participates in regulating the transcriptional level of the VRN1 gene, thereby regulating the plant's life cycle.

[0038] For example, the TaVRN1 gene in wheat directly controls flowering and plays a promoting role in wheat flowering transition. During the seedling stage, the region containing the TaVRN1pVRN-box nucleic acid molecule in the promoter upstream of the TaVRN1 gene plays a crucial role in inhibiting TaVRN1 gene expression. The applicant accidentally discovered that when the nucleotide sequence of the TaVRN1 gene promoter region, including the TaVRN1pVRN-box nucleic acid molecule, is edited to be incomplete, the inhibitory effect on the downstream TaVRN1 gene is relieved. The transcriptional level of the TaVRN1 gene is upregulated, enabling winter wheat to possess the characteristic of spring wheat that allows it to quickly enter the reproductive growth stage without vernalization, without affecting the superior quality of winter wheat compared to spring wheat. The life cycle of winter wheat is significantly shortened, avoiding yield reduction caused by extreme weather, thereby further increasing yield.

[0039] In this specification, homology refers to the "homology" between nucleotide sequences, that is, the total ratio of the same type of nucleotides in a nucleotide sequence. The homology of nucleotide sequences can be determined using alignment programs such as BLAST (Basic Local Alignment Search Tool) and FASTA.

[0040] Having more than 70% homology refers to nucleic acid molecules that have 70%, 75%, 80%, 85%, 90%, 95%, or more than 99% homology (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or even more than 99.9%) and have the same function.

[0041] As used in this article, the nucleotide abbreviations are as follows: A (adenine), C (cytosine), G (guanine), and T (thymine).

[0042] In a preferred embodiment, the nucleotide sequence of the target segment includes: SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0043] SEQ ID NO: 2: CGGGGCCAGATCCCTTTAAAAACCCCTCCCCCCCTGCCGGAATCCT CGT.

[0044] SEQ ID NO: 3: CGGGGCCAGATCCCTTTAAAAACCCCTCCCCCACTTGCCGGAAA CCTC.

[0045] SEQ ID NO: 4: CGGGGCCAGATCCCTTTAAAAACCCCTCCCCCCCTGCCGGAACCC TCGT.

[0046] The TaVRN1pVRN-box nucleic acid molecules are derived from wheat and are located upstream of three subgenes: TaVRN1A, TaVRN1B, and TaVRN1D. These three TaVRN1pVRN-box nucleic acid molecules all contain a common nucleotide sequence (SEQ ID NO: 1).

[0047] Crops in the Pooideae subfamily exhibit spring-winter characteristics, requiring a vernalization period before entering their reproductive growth stage. These crops include wheat, oats, rye, and barley. Their VRN1 gene upstream promoter regions all possess a similar VRN-box region, as shown in SEQ ID NO: 1. This nucleotide sequence, exhibiting 70% homology and possessing the same inhibitory effect on the TaVRN1 gene as the TaVRN1pVRN-box nucleic acid molecule, includes: SEQ ID NO: 1. SEQ ID NOs: 21–25 show the nucleotide sequences of HvVRN1pVRN-box (barley), ScVRN1pVRN-box (rye), AsVRN1ApVRN-box (oats), AsVRN1CpVRN-box (oats), and AsVRN1DpVRN-box (oats). AsVRN1A, AsVRN1B, and AsVRN1C are three subgenomes of the oat AsVRN1 gene. The nucleotide sequence regions of the promoter region before the translation initiation site of the VRN1 gene (“Promoter” indicates promoter, SEQ ID NOs: 32–36) are as follows. Figure 1 as shown

[0048] KNWT promoter VRN1A: SEQ ID NO: 26: GTATTGCATACCGCGCTCGGGGCCAGATC CCTTTAAAAACCCCTCCCCCCCTGCCGGAATCCTCGTTTTGGCCTGGCCATCCTCCCTCTCCTCCCCTCTCTTCCACCTCACGTCCTCACCCAACCACCTGATAGCCATGGCTCCGCCGCCTCGCCTCCGCCTGCGCCAGTCGGAGTAGCCGTCGCGGTCTGCCGGTGTTGGAGGGTAGGGGCGTAGGGTTGGCCCGGTTCTCGAGCGGAG。

[0049] KNWT promoter VRN1B: SEQ ID NO: 27: CAGCCCGGTATTGCATACCGCGCTCGGGG CCAGATCCCTTTAAAAACCCCTCCCCCCACTTGCCGGAAACCTCGTTTTGGCCTGGCCATCCTCCCTCTCCTCCCTCTCTTCCGCCTCACCCAACCACCTGACAGCCATGGCTCCGCCCCCCCGCCCCCGCCTGCGCCTGTCGGAGTAGCCGTCGCGGTCTGCCGGTGTTGGAGGCTTGGGGTGTAGGGTTGGCCCCGTTCTCCAGCGGAG。

[0050] KNWT promoter VRN1D:: SEQ ID NO: 28: GCTCCAGACCAGCCCGGTATTGCATAC CGCGCTCGGGGCCAGATCCCTTTAAAAACCCCTCCCCCCCTGCCGGAACCCTCGTTTTGGCCTGGCCATCCTCCCTCTCCTCCCCCTCTCTTCCAACCACCTGACAGCCATGGCTCCGCCCCCTCGCCTCCGCCTGCGCCTGTCGGAGTAGCCGTCGCGGTCTGCCGGTGTTGGAGGGTAGGGGCGTAGGGTTGGCCCGGTTCTCGAGCGGAG。

[0051] HvpromoterVRN1:SEQ ID NO:32:ACATGCCCCAGACCAGCCCGGTATTGCATACC GCGCTCGGGGCCAGATCCCTTTAAAACCCCCTCCCATCGCCCTGCCGGAACCCTCATTTGGCTATCCCCTCTCCCCTCCCACTTCACCCAACCACCTGACAGCCATGGCTCCGCCACCTCGCCTCCGCCCGCGCCTCTGGGAGTAGCCGTCGCGGTCGCTCGCTCGCTCGCTCGCTGCTGCCGGTGTTGGCCCGGTCCTCGAGCGGAG。

[0052] ScpromoterVRN1:SEQ ID NO:33:GCCCGGTATTGCATACCGCGCTCCGGGCCAGAT CCCTTTAAAAACCCCCTCCCCCCCCCTGCCGGAACCCTCGTTTTGGCCTGGCCATCCTCCCTCTCCTCCCCTCTCTTCCAACTCACCCAACCACCTGACAGCCATGGCTCCGCTCCCTCGCCTCCGCCTGCGCCTGTCGGAGTAGCCGTCGCGGTCTGCCGGTGCTGGCGGGTAGGGGCGTAGGGTTCGCCCGGTTCTCCAGTAGAG。

[0053] AspromoterVRN1A:SEQ ID NO:34:GATATGCCCCAGACCAGCCCGGTATCGACAT ACCGCGATCGGGCCTCAGATCTAAAAACCTCCTCCCCCCTTGCCGGAACCCTCGTTGTTCGGCCATCCTCTCTTGTTCCCACTTTCCTCCCCCAGTCCACCAAACCCGCCATGGCACCGCCCCCTCGCCTGCGCGCGCACCAATGGGAGTAGCCGTCGCGGTCGCTGCTCGCTAGCGGTTAGGGTTCGGATTGAGTCCGGAGGGAGGAG。

[0054] AspromoterVRN1C:SEQ ID NO:35:GCTCCAGACCAGCCCGGTATCGCCATACCGC GATCGGGCCTCAGATCCCTTAAAAACCTCCTCCCCCCTTGCCGGAACCCTCGTTGTTCGGCCATCCTCTTGTTCCCACTTTCCTCCCCCCCCCACACCTACCGGGCGCCCATGGCACCGCCCCCTCGCCTGCGCGCGCACCACTGGGAGTAGCCGTCGCGGTCGCTGCTGGCTAGCGGTTAGGGTTCGGATTAGTTCTGGAGGGAGGAG。

[0055] AspromoterVRN1D:SEQ ID NO:36:ATGCCCCAGACCAGCCCGGTATCGACATACC GCGATCGGGCTTCAGATCCCTTAAAAACCTCCTCCCCCCTTGCCGGAACCCTCGTTGTTCGGCCATCCTCTCTTGTTCCCACTTTCCTCCCCCAGTCCACCAAACCCGCCATGGCACCGCCCCCTCGCCTGCGCGCGCACCAATGGGAGTAGCCGTCGCGGTCGCTGCTCGCTAGCGGTTAGGGTTCGGATTGAGTCCGGAGGGACGAG。

[0056] In a preferred embodiment, editing includes any one or more of the following: a) inserting one or more nucleotides into the target segment; or b) replacing one or more nucleotides in the target segment with other nucleotides; or c) deleting one or more nucleotides in the target segment; preferably, c) includes deleting at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides in the target segment, the deleted nucleotides including nucleotides in the VRN1pVR N-box nucleic acid molecule; preferably, editing the target segment includes any one of the following: replacing the nucleotide sequence of the target segment shown in SEQ ID NO: 2 with any one of the nucleotide sequences shown in SEQ ID NOs: 5-9; replacing the nucleotide sequence of the target segment shown in SEQ ID NO: 3 with SEQ ID NO: 5-9. NOs: Any of the nucleotide sequences shown in SEQ ID NO: 10-11; replace the target segment shown in SEQ ID NO: 4 with any of the nucleotide sequences shown in SEQ ID NOs: 12-16.

[0057] SEQ ID NO: 5: CGGGGCCAGATCCCTTTAAAAACCCTGCCGGAATCCTCGT.

[0058] SEQ ID NO: 6: CGGGGCCAGATCCCTTTAAAAACCCCTTGCCGGAATCCTCGT.

[0059] SEQ ID NO: 7: CGGGGCCAGATCCCTTTCCCCCCCTGCCGGAATCCTCGT.

[0060] SEQ ID NO: 8: CGGGGCCAGATCCCTTTCCTCCCCCCTGCCGGAATCCTCGT.

[0061] SEQ ID NO: 9: CGGGGCCAGATCCCTCCTCCCCCCCTGCCGGAATCCTCGT.

[0062] SEQ ID NO: 10: CGGGGCCAGATCCCTTTCCTCCCCCCACTTGCCGGAAACCTC.

[0063] SEQ ID NO: 11: CCCTCCCCCCCTGCCGGAACCCTCGT.

[0064] SEQ ID NO: 12: CGGGGCCAGATCCCTTTAAAAACCTGCCGGAACCCTCGT.

[0065] SEQ ID NO: 13: CGGGGCCAGATCCCTTTAAAAACCCCT.

[0066] SEQ ID NO: 14: CGGGGCCAGATCCCTTTAAACCGGAACCCTCGT.

[0067] SEQ ID NO: 15: CGGGGCCAGATCCCTTTCCCCCCCTGCCGGAACCCTCGT.

[0068] SEQ ID NO: 16: CGGGGCCAGATCCCTTTAACCCCTCCCCCCCTGCCGGAACCCTCG T.

[0069] In wheat, the TaVRN1pVRN-box nucleic acid molecule can affect the expression of the TaVRN1 gene, thereby further affecting the vernalization time of wheat. This application addresses this by disrupting the integrity of the target segment containing the TaVRN1pVRN-box nucleic acid molecule in the promoter region of the TaVRN1 gene in wheat, thus relieving its inhibitory effect on the TaVRN1 gene and increasing the transcription level of the TaVRN1 gene. This allows winter wheat to be grown without vernalization, significantly shortening its entire growth cycle. Winter wheat treated with the method described in this application, which increases the transcription level of the TaVRN1 gene, retains the advantages of winter wheat varieties, such as higher tillering and ear count and higher yield per plant compared to spring wheat varieties. It also possesses the characteristic of spring wheat, which does not require overwintering vernalization, overcoming the defect of spring wheat requiring vernalization to enter reproductive growth. This avoids the excessively long growth cycle caused by prolonged vernalization, making it susceptible to extreme weather conditions, thus protecting wheat yield from weather-related reductions.

[0070] The TaVRN1pVRN-box nucleic acid molecule in wheat is located in the promoter upstream of the TaVRN1 gene, and it has an inhibitory effect on the expression of the TaVRN1 gene. Preferably, the subgenome of the wheat TaVRN1 gene includes three subgenes: TaVRN1A, TaVRN1B, and TaVRN1D. Preferably, the promoter upstream of the TaVRN1A gene contains the TaVRN1pAVRN-box nucleic acid molecule; preferably, the promoter upstream of the TaVRN1B gene contains the TaVRN1pBVRN-box nucleic acid molecule; preferably, the promoter upstream of the TaVRN1D gene contains the TaVRN1pDVRN-box nucleic acid molecule; preferably, the TaVRN1pAVRN-box, TaVRN1pBVRN-box, and TaVRN1pDVRN-box nucleic acid molecules have 100% homology with SEQ ID NO: 1, i.e., their nucleotide sequences are all the same as those shown in SEQ ID NO: 1.

[0071] In a preferred embodiment, the editing method includes: introducing genetic material for expressing nucleases and / or for transcribing guide RNA into cells or tissues of a Pooideae plant, editing a target segment; culturing the introduced cells or tissues into complete plants to obtain a Pooideae plant with shortened vernalization time; preferably, the genetic material includes a DNA circular plasmid, a linear DNA fragment, or RNA transcribed in vitro; preferably, the genetic material for expressing nucleases and the genetic material for transcribing guide RNA are located in the same or different genetic materials; preferably, the nuclease is capable of specifically cleaving functional segments in the target segment; preferably, the genetic material includes a recombinant vector capable of transcribing guide RNA and expressing Cas proteins; preferably, the guide RNA is an RNA with a palindromic structure formed by partial base pairing of crRNA and tracrRNA; preferably, the crRNA includes an RNA fragment capable of complementary binding to the functional segment; preferably, the target segment is edited using a gene editing tool, including CRISPR / Cas9, CRISPR / Cas12, or the RED recombination system.

[0072] Preferably, the method for introducing genetic material into the cells or tissues of *Pooideae* plants includes gene gun method, *Agrobacterium* infection method, PEG-induced protoplast method, electrode method, silicon carbide fiber-mediated method, or vacuum infiltration method; preferably, the cells of *Pooideae* plants include protoplast cells or suspension cells; preferably, the tissues of *Pooideae* plants include callus tissue, immature embryo, mature embryo, leaf, shoot tip, young spike, or hypocotyl. Preferably, the cells of *Pooideae* plants include all cells that can serve as recipients and can regenerate into complete plants through tissue culture; the tissue is any tissue that can serve as a recipient and can regenerate into a complete plant through tissue culture.

[0073] Preferably, the shortened vernalization time includes reducing the vernalization time to 0 days, so that the edited Kentucky Pooideae winter plants can carry out reproductive growth without undergoing a long vernalization treatment. In this application, the CRISPR method was used to edit the nucleotide sequence of the target region containing the TaVRN1pVRN-box nucleic acid molecule in Kenong wheat 9204, causing the deletion of one or more nucleotides, preferably at least three consecutive nucleotides, thereby disrupting its integrity, relieving its inhibitory effect on the TaVRN1 gene, and increasing the transcription level of the TaVRN1 gene in the target plant.

[0074] In a preferred embodiment, the Pooideae subfamily includes wheat, oats, rye, or barley; preferably, the wheat includes diploid wheat, tetraploid wheat, or hexaploid wheat; preferably, the hexaploid wheat includes common hexaploid wheat; preferably, the common hexaploid wheat includes Kenong wheat, more preferably Kenong 9204 wheat, Kenong 1002 wheat, or Kenong 8162 wheat.

[0075] Preferably, the aforementioned common hexaploid cultivated wheat refers to wheat with a chromosome number of hexaploid (6n), which is an allohexaploid formed through two natural hybridizations, containing three subgenomes: A, B, and D. Theoretically, each gene has homologous genes in subgenomes A, B, and D. The ancestral species of subgenome A is *Triticum urartu*, the ancestral species of subgenome B is *Aegilops spp.*, and the ancestral species of subgenome D is *Aegilops scabra*. The subgenomes A, B, and D are numbered using internationally recognized designations. *Kenong* wheat is a winter wheat variety that requires winter cooling (vernalization) to flower and bear fruit in the following spring and summer.

[0076] Commonly cultivated hexaploid wheat is actually wild hexaploid wheat that has undergone a long period of artificial selection and cultivation, retaining its superior traits (plant height, number of tillers, yield, or stress resistance, etc.) to form the various cultivated varieties commonly found in farmland today, making it one of the important food crops in agricultural production. Wild hexaploid wheat, on the other hand, refers to hexaploid wheat that grows in its natural wild environment. Due to its sparse growth, shorter height, upright plant type, and smaller ears of grain, it is less commonly cultivated.

[0077] All of the above-mentioned wheat varieties can be used in experiments to shorten the vernalization time of wheat using the TaVRN1pVRN-box nucleic acid molecules provided in this application. This can significantly shorten the wheat growth cycle and accelerate the wheat maturation process, and has important application value in wheat variety improvement and agricultural production.

[0078] In a second typical embodiment of this application, a biological material for regulating the transcription level of the plant VRN1 gene is provided. The biological material includes one or more of DNA, RNA, or protein for editing a target segment. The target segment includes a nucleotide sequence consisting of a 14bp upstream of the VRN1pVRN-box nucleic acid molecule, an VRN1pVRN-box nucleic acid molecule, and an 18bp downstream of the VRN1pVRN-box nucleic acid molecule connected in sequence. The VRN1pVRN-box nucleic acid molecule is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a polynucleotide having more than 70% homology with the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

[0079] In a preferred embodiment, the biological material comprises a first DNA capable of expressing a nuclease and / or a second DNA encoding a guide RNA for targeting a target segment; preferably, the second DNA comprises a third DNA encoding a crRNA and a fourth DNA encoding a tracrRNA, the crRNA being capable of complementary base pairing with all or part of the bases on the target segment; preferably, the target segment is a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0080] In a preferred embodiment, the guide RNA comprises a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0081] The aforementioned biomaterials are capable of gene editing of the target region containing the TaVRN1pVRN-box nucleic acid molecule in winter wheat, by disrupting the integrity of the target region containing the TaVRN1pVRN-box nucleic acid molecule. Those skilled in the art can flexibly choose existing methods and design corresponding biomaterials to achieve the editing of genetic information in winter wheat, including but not limited to biomaterials using CRISPR / Cas9, CRISPR / Cas12, or RED recombination systems.

[0082] In a preferred embodiment, the Pooideae subfamily includes wheat, oats, rye, or barley; preferably, the wheat includes diploid wheat, tetraploid wheat, or hexaploid wheat; preferably, the hexaploid wheat includes common hexaploid wheat; preferably, the common hexaploid wheat includes Kenong wheat, more preferably Kenong 9204 wheat, Kenong 1002 wheat, or Kenong 8162 wheat.

[0083] In a third typical embodiment of this application, a method for regulating the transcription level of the VRN1 gene of the Pooideae subfamily described above, or the application of any of the above-mentioned biological materials for regulating the transcription level of the VRN1 gene of the Pooideae subfamily, is provided in shortening the vernalization time of Pooideae plants, shortening the growth period of Pooideae plants, or in the breeding of Pooideae plants.

[0084] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0085] Example 1: Construction of wheat TaVRN1pVRN-box editing vector and wheat transformation

[0086] 1. Two specific sgRNAs were designed based on the nucleotide sequence of the target region containing the TaVRN1pVRN-box nucleic acid molecule, as shown in Table 1.

[0087] Table 1

[0088] sgRNA Sequence (5'-3') sgRNA1 (SEQ ID NO: 17) AAAACCCTCCCCCCCTGCCGG sgRNA2 (SEQ ID NO: 18) CCCGGGGGGAGGGGGTTTTAAA

[0089] In this application, two sgRNAs were designed to edit the target region separately, in order to obtain materials with different editing forms of the target region.

[0090] The guide RNA in this application is designed primarily for the TaVRN1pVRN-box region. The design region is located 20 nucleotides upstream of the nearest PAM site (NGG) to the right of the TaVRN1pVRN-box region and 20 nucleotides downstream of the nearest PAM site (CCN) to the left of the TaVRN1pVRN-box region (N is any nucleotide, PAM stands for protospacer adjacent motif, which refers to a series of nucleotide sequences near the target site). The guide RNA recognizes the target fragment through the base complementary pairing principle and guides the Cas9 protease to cut between the third and fourth nucleotides upstream of the PAM site (the underlined part of the sequence shown in Table 1), causing a DNA double-strand break. The cell will then use an efficient non-homologous end ligation method to repair the broken DNA. During the repair process, random base insertion or deletion mismatches will occur, thereby achieving the formation of various gene editing techniques.

[0091] 2. The two specific sgRNAs were transferred into CRISPR / Cas9 vectors respectively, and the sgRNAs were transcribed by the TaU3 promoter.

[0092] 3. Transform the ligation product into DH5α competent cells, pick single colonies for sequencing, and extract plasmids from the correctly sequenced colonies.

[0093] 4. Mix 100 μL of EHA105 Agrobacterium with the plasmid extracted in the previous step, incubate on ice for 5 min, flash freeze in liquid nitrogen for 5 min, and then incubate in water at 37°C for 5 min.

[0094] Add 300 μL of antibiotic-free LB medium, activate the bacteria by shaking at 200 rpm for 2 hours at 28°C, spread them on LB solid medium with the corresponding resistance, and incubate for 3 days. Pick single colonies for PCR identification, and use the correctly identified colonies for subsequent transformation experiments.

[0095] 5. Perform initial shaking and expansion shaking on correctly identified Agrobacterium, centrifuge, and resuspend in suspension medium; approximately 14 days after flowering, peel off the scutellum of wheat embryos and place them in a suspension containing Agrobacterium, co-culturing at 23°C in the dark for 2 days; then transfer to recovery medium and culture at 28°C in the dark; after 5 days, transfer to the appropriate resistance differentiation medium and continuously culturate at 25°C under light (100 μmol / m²). 2 Cultured for 3 weeks; the differentiated seedlings were then transferred to rooting medium and kept under continuous light (100 μmol / m²) at 25°C. 2 / s) Cultured for 2 weeks; the mutant wheat seedlings were transferred into soil and cultured together with Kenong 9204 wild-type wheat and spring wheat, Chinese Spring (25℃ constant temperature culture, 16 hours light and 8 hours dark photocycle). The heading time of different wheat varieties was recorded until harvest. Among them, Chinese Spring wheat began to head 65 days after planting, the heading time of mutant wheat was similar to or even earlier than that of Chinese Spring wheat, while Kenong 9204 wild-type wheat began to head about 130 days after planting.

[0096] The statistical graph shows the heading time of wild-type Keno wheat and edited mutant wheat planted together under the same environmental conditions. Figure 2 As shown, KNWT is the wild-type wheat of Kenong 9204, and KN1 to KN4 are four different edited mutants of Kenong 9204 wheat after gene editing. It can be seen that the heading time of the gene-edited mutant wheat in this application is significantly shortened compared with that of wild-type wheat.

[0097] Example 2: Phenotypic Identification of Wheat TaVRN1pVRN-box Gene Editing Mutant

[0098] The mutation forms of the transgenic seedlings were identified. The primer sequences for identifying the mutation sites are shown in Table 2, and the PCR amplification system is shown in Table 3.

[0099] Table 2

[0100]

[0101]

[0102] Table 3

[0103] system volume 2xTaq PCR Mix (Kangwei, CW0690) 25μL Primer F 1.5μL Primer R 1.5μL gDNA 2μL sterile water 22μL total 50μL

[0104] PCR reaction system: 95℃, 3 min; (95℃, 20 s; 60℃, 20 s; 72℃, 20 s) × 32 cycles; 72℃, 2 min; 4℃, incubate at constant temperature. Sequencing was performed on the PCR products.

[0105] Nucleotide sequences containing target segments of TaVRN1pAVRN-box, TaVRN1pBVRN-box, and TaVRN1pDVRN-box were edited in the subgenome of the TaVRN1 gene in Kenong wheat 9204, including the promoter regions located upstream of the three subgenes TaVRN1A, TaVRN1B, and TaVRN1D. The edited wheat and wild-type wheat (Kenong 9204) were cultured in the same environment, and their growth was observed.

[0106] A schematic diagram illustrating the editing of target segments of the promoter regions of TaVRN1A, TaVRN1B, and TaVRN1D genes in the KeNong 9204 wheat gene using CRISPR / Cas9 technology is shown below. Figure 3 As shown; Figure 3 A is a schematic diagram of the first 240 to the first 1 nucleotide sequence (SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28) of the translation initiation sites of the TaVRN1A, TaVRN1B and TaVRN1D genes, and the binding of sgRNA1 and sgRNA2 to their gene promoter regions; Figure 3 Figure B is a schematic diagram of the target design using CRISPR / Cas9 technology.

[0107] The phenotypic identification results of the edited mutants of the TaVRN1A, TaVRN1B, and TaVRN1D genes in the Kenong 9204 wheat are shown in the figure below. Figure 4 The figure shows the growth morphology of wild-type Kenong 9204 wheat (KNWT) and edited mutant wheat (KN1, KN2, KN3 and KN4) on the same day after emergence.

[0108] Figure 5 China A Figure 5 China B and Figure 5 Image C represents the edited nucleic acid sequences of the target regions (SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31) on the promoter regions of the TaVRN1A, TaVRN1B, and TaVRN1D genes (SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31) at -222~-175, -215~-165, and -206~-159 bp, respectively. Figure 5 In section A, there are several mutant types after gene editing of the target segment on the promoter of TaVRN1A in KN1-KN4, including replacing the nucleotide sequence of the target segment with the nucleotide sequences shown in SEQ ID NO: 5 (KN1-1 PromoterVRN1A, KN2 PromoterVRN1A), SEQ ID NO: 6 (KN1-2 PromoterVRN1A), SEQ ID NO: 7 (KN3-1 PromoterVRN1A, KN4-1 PromoterVRN1A), SEQ ID NO: 8 (KN3-2 Promoter VRN1A), and SEQ ID NO: 9 (KN4-2 Promoter VRN1A). Figure 5B represents several mutant types resulting from gene editing of the target segment on the promoter of TaVRN1B in KN1-KN4, including replacing the nucleotide sequence of the target segment with the nucleotide sequence shown in SEQ ID NO: 10 (KN4 Promoter VRN1B) or SEQ ID NO: 11 (KN3 Promoter VRN1B). Figure 5 C represents several mutant types resulting from gene editing of the target region on the promoter of TaVRN1D in KN1-KN4, including replacing the nucleotide sequence of the target region with the nucleotide sequences shown in SEQ ID NO: 12 (KN2-1 Promoter VRN1D), SEQ ID NO: 13 (KN1 Promoter VRN1D), SEQ ID NO: 14 (KN2-2 Promoter VRN1D), SEQ ID NO: 15 (KN3 Promoter VRN1D), or SEQ ID NO: 16 (KN4 Promoter VRN1).

[0109] SEQ ID NO: 29: CGCTCGGGGCCAGATCCCTTTAAAAACCCCTCCCCCCCTGCCGGAATCCTCGTTTTGGCCTGGCCATCCTCCCT.

[0110] SEQ ID NO: 30: CGCTCGGGGCCAGATCCCTTTAAAAACCCCTCCCCCACTTGCCGGAAACCTCGTTTTGGCCTGGCCATCCTCCCT.

[0111] SEQ ID NO: 31: CGCTCGGGGCCAGATCCCTTTAAAAACCCCTCCCCCCCTGCCGGAACCCTCGTTTTGGCCTGGCCATCCTCCCT.

[0112] Samples were taken from the phenotypic identified wheat plants, and the gene expression of TaVRN1, a downstream gene controlled by the TaVRN1pVRN-box nucleic acid molecule, was detected. The statistical graphs of TaVRN1 gene expression at different heading times and tillering stages of different wheat species are shown below. Figure 6 As shown; Figure 6This is the qPCR result of the TaVRN1 gene in wheat during the tillering stage. KNWT represents the wild-type wheat KN9204, and KN1 to KN4 represent four different gene-edited mutants of KN9204 wheat. VRN1 / TUB refers to: VRN1 representing the TaVRN1 gene and TUB representing the TaTUB gene. The TaTUB gene serves as an internal reference gene; its transcriptional level is unaffected by the wheat's growth stage, environment, or expression site. Therefore, the transcriptional level of the TaVRN1 gene can be indirectly reflected by the transcriptional level of the TaTUB gene. VRN1 / TUB is calculated by dividing the transcriptional value of the TaVRN1 gene by the transcriptional value of the TaTUB gene. Figure 6 The results showed that when the TaVRN1pVRN-box nucleic acid sequence was partially deleted, its inhibitory function on the downstream TaVRN1 gene disappeared, leading to an upregulation of the transcription level of TaVRN1, which accelerated the flowering process of wheat. Therefore, the heading time of wheat could be significantly shortened, comparable to that of spring wheat cultivated in the same environment.

[0113] This application involves partially deleting the nucleotide sequence of the target segment of the TaVRN1pVRN-box nucleic acid molecule in wheat to form a promoter region that disrupts the integrity of the TaVRN1pVRN-box nucleic acid sequence. This releases the inhibition of downstream TaVRN1 gene expression by the TaVRN1pVRN-box nucleic acid sequence, thereby upregulating the transcriptional level of the TaVRN1 gene. As a result, winter wheat, which originally required vernalization to release the inhibition of the TaVRN1 gene, can quickly enter the reproductive growth stage without vernalization treatment, significantly shortening the growth cycle of winter wheat.

[0114] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects: By editing the nucleotide sequence region of the target segment containing the TaVRN1pVRN-box nucleic acid molecule in the promoter of the wheat TaVRN1 gene, the integrity of the nucleotide sequence of the TaVRN1pVRN-box nucleic acid molecule is disrupted, thereby relieving the inhibitory effect of the TaVRN1pVRN-box nucleic acid molecule on the TaVRN1 gene, increasing the transcription level of the TaVRN1 gene, and enabling winter wheat that originally required vernalization to quickly enter the reproductive growth stage without vernalization treatment, significantly shortening the wheat growth cycle and protecting this type of winter wheat from the effects of extreme weather. This further increases yield.

[0115] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method of modulating the level of transcription of a VRN1 gene in a plant of the subfamily Pooideae, characterized in that, The method comprises: editing a target segment in a promoter region upstream of a VRN1 gene of a subfamily of Pooideae plants by using a guide RNA targeting SEQ ID NO: 17 or SEQ ID NO: 18, the editing comprising deleting, replacing, or adding at least one nucleotide, thereby regulating the transcription level of the VRN1 gene of the subfamily of Pooideae plants; The target segment is a nucleotide sequence sequentially connected by 14 bp upstream of a VRN1pVRN-box nucleic acid molecule, the VRN1pVRN-box nucleic acid molecule, and 18 bp downstream of the VRN1pVRN-box nucleic acid molecule; The VRN1pVRN-box nucleic acid molecule is a polynucleotide as shown in SEQ ID NO: 1; The subfamily of Pooideae plants is winter wheat; The regulation is up-regulating the transcription level of the VRN1 gene; The target segment is edited by using a gene editing tool, and the gene editing tool is CRISPR / Cas9.

2. The method of claim 1, wherein, The nucleotide sequence of the target segment is: SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO:

4.

3. The method according to claim 1 or 2, characterized in that, The editing comprises any one or more of the following: a) inserting one or more nucleotides into the target segment; b) replacing one or more nucleotides in the target segment with other nucleotides different from the one or more nucleotides; or c) deleting one or more nucleotides in the target segment.

4. The method of claim 3, wherein, The c) comprises deleting at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides in the target segment, and the deleted nucleotides include nucleotides in the VRN1pVRN-box nucleic acid molecule.

5. The method of claim 4, wherein, The editing of the target segment comprises any one of the following: replacing the nucleotide sequence of the target segment as shown in SEQ ID NO: 2 with any one of the nucleotide sequences as shown in SEQ ID NOs: 5-9; replacing the nucleotide sequence of the target segment as shown in SEQ ID NO: 3 with any one of the nucleotide sequences as shown in SEQ ID NOs: 10-11; replacing the target segment as shown in SEQ ID NO: 4 with any one of the nucleotide sequences as shown in SEQ ID NOs: 12-16.

6. The method of claim 3, wherein, The method of editing comprises: introducing genetic material for expressing a nuclease and / or for transcribing a guide RNA into cells or tissues of the subfamily of Pooideae plants to edit the target segment; culturing the introduced cells or tissues into a whole plant to obtain a subfamily of Pooideae plant with shortened vernalization time.

7. The method of claim 6, wherein, The genetic material comprises a DNA circular plasmid, a DNA linear fragment, or an in vitro transcribed RNA.

8. The method of claim 6, wherein, The genetic material for expressing the nuclease and the genetic material for transcribing the guide RNA are located in the same or different genetic materials.

9. The method of claim 8, wherein, The nuclease can specifically cleave a functional segment in the target segment.

10. The method of claim 9, wherein, The genetic material comprises a recombinant vector capable of transcribing a guide RNA and expressing a Cas protein.

11. The method of claim 10, wherein, The guide RNA is a palindromic RNA formed by partial base pairing of crRNA and tracrRNA.

12. The method of claim 11, wherein, The crRNA comprises an RNA segment capable of complementary binding to the functional segment.

13. The method of claim 6, wherein, The method for introducing the genetic material into the cells or tissues of the subfamily poeae plant comprises a gene gun method, an agrobacterium infection method, a PEG-induced protoplast method, an electrode method, a silicon carbide fiber-mediated method, or a vacuum infiltration method.

14. The method of claim 13, wherein, The cells of the subfamily poeae plant comprise protoplast cells or suspension cells.

15. The method of claim 13, wherein, The tissues of the subfamily poeae plant comprise callus, immature embryo, mature embryo, leaf, shoot tip, young ear, or hypocotyl.

16. The method of claim 1, wherein, The winter wheat comprises diploid wheat, tetraploid wheat, or hexaploid wheat.

17. The method of claim 16, wherein, The hexaploid wheat comprises common cultivated hexaploid wheat.

18. The method of claim 17, wherein, The common cultivated hexaploid wheat comprises triticum aestivum.

19. The method of claim 18, wherein, The triticum aestivum comprises triticum aestivum cv. kengen.

20. A biological material for regulating the transcription level of VRN1 gene of a Pooideae plant, characterized in that, The triticum aestivum comprises triticum aestivum cv. kengen 9204, triticum aestivum cv. kengen 1002, or triticum aestivum cv. kengen 8162. The biological material is one or more of DNA, RNA, or protein for editing a target segment. The target segment comprises a nucleotide sequence sequentially connected by 14 bp upstream of a VRN1 pVRN-box nucleic acid molecule, the VRN1 pVRN-box nucleic acid molecule, and 18 bp downstream of the VRN1 pVRN-box nucleic acid molecule. The VRN1 pVRN-box nucleic acid molecule is a polynucleotide of the nucleotide sequence shown in SEQ ID NO:

1. The biological material is a non-animal or plant variety. The subfamily poeae plant is winter wheat. The biological material comprises a first DNA capable of expressing a nuclease and / or a second DNA encoding a guide RNA for targeting the target segment.

21. The biomaterial of claim 20, wherein, The guide RNA targets SEQ ID NO: 17 or SEQ ID NO:

18. The target segment is a polynucleotide shown in SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO:

4.

22. The method for regulating the transcription level of a VRN1 gene of a subfamily poeae plant according to any one of claims 1-19 or the biological material for regulating the transcription level of a VRN1 gene of a subfamily poeae plant according to any one of claims 20-21, or the use in shortening the vernalization time of a subfamily poeae plant, shortening the growth period of a subfamily poeae plant, or breeding a subfamily poeae plant.

Images