RNA-responsive controlled-release DNA nanocarrier system

Abstract

The application discloses an RNA response controlled-release DNA nanocarrier system, which comprises a DNA nanotube, a drug effective component and a nanodevice lock; the DNA nanotube comprises a tube wall and the nanodevice lock; the tube wall is unfolded in a rectangular shape; the nanodevice lock comprises a plurality of sealing chains, each of which is composed of two partially complementary DNA single strands, and the two DNA single strands are connected to two long sides of the tube wall; the sealing chains can undergo an isothermal chain displacement reaction with target RNA, open the nanodevice lock and unfold the tube wall; and the drug effective component is loaded in the inside of the DNA nanotube. The DNA nanotube is not easy to be enzymatically hydrolyzed, has high biocompatibility and is easy to be endocytosed by cells, and is used for wrapping the RNA drug with poor stability, so that the RNA drug is completely and sufficiently delivered to a target position; under the action of high expression of the RNA at the target position, the nanodevice lock on the DNA nanotube is rapidly opened, and the RNA drug is released.

Description

Technical Field

[0001] This application relates to the field of biomedicine and medicine, specifically to an RNA-responsive controlled release DNA nanoparticle drug delivery system. Background Technology

[0002] Ovarian cancer is a highly fatal malignant tumor in gynecology. Modern clinical chemotherapy, using classic cytotoxic drugs and targeted molecular inhibitors, often fails when ovarian cancer cells become resistant, metastasize throughout the body, or become intolerable due to severe adverse reactions. With the rise of biomedical materials, small interfering RNA (SRNA) therapy is currently a promising treatment in the field of oncology. However, the instability of RNA and the lack of specific targets limit its application. Summary of the Invention

[0003] To address the issues of poor stability and lack of targets for RNA drugs, this application provides an RNA-responsive controlled-release DNA nanoparticle drug delivery system. This system utilizes DNA nanotubes, which are not easily enzymatically digested, have high biocompatibility, and are easily endocytosed by cells, to encapsulate unstable RNA drugs, thereby delivering the RNA drugs intact and fully to the target site. Under the influence of high RNA expression at the target site, the nanodevice locks on the DNA nanotubes are unlocked, releasing the RNA drugs.

[0004] The technical solution provided in this application is as follows:

[0005] This application provides an RNA-responsive controlled release DNA nanoparticle drug delivery system, which includes:

[0006] DNA nanotubes include a tube wall and a nanodevice lock; the tube wall unfolds into a rectangle, and the nanodevice lock includes several sealing strands, each sealing strand consisting of two partially complementary DNA single strands, which are respectively connected to the two long sides of the tube wall; the sealing strands can undergo an isothermal strand displacement reaction with the target RNA, opening the nanodevice lock and unfolding the tube wall.

[0007] The active ingredient of the drug is loaded inside DNA nanotubes.

[0008] Based on the above technical solution, the target RNA is RNA that is highly expressed in the target cells.

[0009] Based on the above technical solution, the target cell is a tumor cell, and the highly expressed target RNA is miR-21.

[0010] Based on the above technical solution, the active ingredient of the drug is siRNA, which is linked to the DNA that makes up the tube wall through partial base pairing.

[0011] Based on the above technical solution, siRNA and the DNA that makes up the tube wall have at least 20 consecutive complementary bases.

[0012] Based on the above technical solutions, the DNA nanotubes have a length of 18-20 nm and an inner diameter of 3-5 nm.

[0013] Based on the above technical solution, a sealing chain is set every 1 to 2 nm along the long side of both sides of the tube wall.

[0014] Based on the above technical solution, each end of the sealing chain has a single-stranded DNA segment, and the target RNA is composed of sequence 1, which is complementary to the single-stranded DNA, and sequence 2, which is complementary to the double-stranded portion of the sealing chain.

[0015] Based on the above technical solution, the drug delivery system further includes:

[0016] The aptamer is attached to the outer surface of the DNA nanotube by means of complementary base pairing.

[0017] Based on the above technical solution, the aptamer is a nucleolin aptamer.

[0018] Compared with existing technologies, the RNA-responsive controlled-release DNA nanoparticle drug delivery system provided in this application can deliver unstable drugs intact to the target location, be taken up by cells within half an hour, and release the drug by opening the DNA nanotube within half an hour. Attached Figure Description

[0019] Figure 1 Design a diagram using the CaDNAno sequence.

[0020] Figure 2 This is a schematic diagram of the RNA-responsive controlled release DNA nanodrug delivery system provided in this application.

[0021] Figure 3 The results are the characterization results of the target product; where (A) is the agarose gel electrophoresis image of the target product; and (B) is the atomic force microscopy characterization image of the target product.

[0022] Figure 4 The image shows the transmission electron microscopy (TEM) characterization of the target product.

[0023] Figure 5 The image shows the serum stability of the target product.

[0024] Figure 6 The graph shows the stability of the target product at room temperature.

[0025] Figure 7 Fluorescence comparison diagrams before and after adding miR-21 to the target product containing carboxyl fluorescein, showing the fluorescence before and after chain cleavage.

[0026] Figure 8 This is a diagram illustrating the process and principle of the target product entering the cell.

[0027] Figure 9 The flow cytometry uptake plot is for the target product.

[0028] Figure 10 The fluorescence image shows the cells after co-incubation with the target product containing carboxylated luciferin (50 nM) for 30 minutes.

[0029] Figure 11 Real-time imaging of the addition of the target product containing Cy3 to a cell culture dish until fluorescence appears. Detailed Implementation

[0030] Unless otherwise specified, the term "nano-device lock" in this application refers to an element that opens or closes a DNA nano-origami structure, such as double-stranded DNA, DNA-RNA complex, hairpin structure, etc.; the term "drug active ingredient" refers to a component that acts on the metabolism or chemical reaction of an organism, such as a compound, RNA, protein, etc. that has an actual therapeutic effect on a disease; the term "rectangle" refers to a near-rectangular shape, not a perfectly rectangular plane.

[0031] This application provides an RNA-responsive controlled-release DNA nanoparticle drug delivery system. This RNA-responsive controlled-release DNA nanoparticle drug delivery system has good stability and is easily taken up by cells, and can completely and fully deliver RNA drugs with poor stability and lack of targets to the target location.

[0032] This DNA nanoparticle drug delivery system includes a DNA nanotube comprising a tube wall and a nanodevice lock; the tube wall unfolds into a rectangle, and the nanodevice lock comprises several sealing strands, each consisting of two partially complementary DNA single strands, which are respectively connected to the two long sides of the tube wall; the sealing strands can undergo an isothermal strand displacement reaction with the target RNA, opening the nanodevice lock and unfolding the tube wall; it also includes an active drug ingredient loaded inside the DNA nanotube.

[0033] In this application, the unfolded state of the DNA nanotube origami is rectangular, and complementary DNA single strands are connected to both sides of its long side as sealing strands. During the annealing process, the sealing strands on both sides curl the origami into a tubular shape according to the base complementary pairing principle, forming a partially complementary double strand.

[0034] Based on the above technical solution, the target RNA is RNA highly expressed in the target cell, preferably mRNA. This application designs the DNA sequence at the sealing site of the DNA nanotube according to the highly expressed mRNA in the target tissue and / or target cell, forming complementary DNA double strands to seal the DNA nanotube.

[0035] In some embodiments, the target cells for drug delivery are tumor cells that highly express miR-21. Therefore, an RNA-responsive controlled-release DNA nanoparticle drug delivery system is designed with miR-21 as the target RNA. Upon contact with miR-21, this DNA nanoparticle drug delivery system initiates an isothermal chain displacement reaction, breaking the closure of the DNA nanotube and releasing siRNA and / or other drugs intracellularly to exert their effects. Because the isothermal chain displacement process is almost instantaneous and does not require enzymatic action, the RNA-responsive controlled-release DNA nanoparticle drug delivery system provided in this application can expose siRNA and / or other drugs upon contact with miR-21 after entering the cell.

[0036] In some embodiments, the active pharmaceutical ingredient is siRNA, which is linked to the DNA that makes up the tube wall through base pairing. Preferably, a portion of the siRNA bases are paired with the DNA that makes up the tube wall. Preferably, the complementary portion of the siRNA to the DNA that makes up the tube wall contains at least 20 consecutive bases, and the complementary siRNA to the DNA that makes up the tube wall forms a DNA-RNA linkage structure.

[0037] In some implementations, the DNA nanotubes have a length of 18–20 nm and an inner diameter of 3–5 nm.

[0038] In some implementations, a sealing chain is provided every 1 to 2 nm along the long side of both sides of the tube wall.

[0039] In some embodiments, the sealing strand has a single-stranded DNA segment at each end, and the target RNA consists of a sequence 1 complementary to the single-stranded DNA and a sequence 2 complementary to the double-stranded portion of the sealing strand. The single-stranded DNA includes at least three consecutive bases for recognizing highly expressed mRNA in target tissues and / or target cells and initiating an isothermal strand displacement process.

[0040] In some embodiments, the drug delivery system further includes an aptamer, which is attached to the outer surface of the DNA nanotube by a base-complementary pairing principle. Based on the above technical solution, the aptamer is a nucleolin aptamer.

[0041] In selecting drugs and aptamers, this application determines meaningful siRNAs and / or other drugs and aptamers based on the targeted disease. This application uses siRNA (siP-gp) that silences P-glycoprotein (P-gp), as overexpression of P-gp is closely related to tumor drug resistance. The AS1411 aptamer is a guanine-rich DNA oligonucleotide produced using SELEX technology. It targets tumor cells by recognizing nucleolar proteins expressed on the cell membrane with high affinity for its guanine domain. Drugs for treating breast cancer can also be prepared using siPLK-1 and the AS1411 aptamer.

[0042] This application provides an RNA-responsive controlled-release DNA nanoparticle drug delivery system. The target RNA is miR-21, and the active drug component is siRNA. The process is as follows: When the drug delivery system encounters highly expressed miR-21 in tumor cells, the DNA nanotube is opened via strand displacement, releasing the embedded siRNA. After release, the siRNA unwinds into sense and antisense strands under the action of intracellular RNA helicases. Subsequently, the antisense siRNA binds to certain enzymes in vivo to form an RNA-induced silencing complex (RISC). The RISC specifically binds to the homologous region of the exogenous gene-expressed mRNA. The RISC functions as a nuclease, cleaving the mRNA at the binding site, which is complementary to the two ends of the antisense strand in the siRNA. The cleaved mRNA fragments are then degraded, thereby inducing a degradation response in the host cell against these mRNAs. siRNA can also act as a primer to bind to target RNA and synthesize more dsRNA under the action of RNA polymerase. The dsRNA is then cleaved by Dicer to produce a large number of secondary siRNAs, thereby further amplifying the effect of RNAi and completely degrading the target mRNA. The ultimate effect is the degradation and death of host cells (ovarian cancer tumor cells). For the process and mechanism of action, please refer to [link to relevant documentation]. Figure 8 .

[0043] The technical solutions provided in this application will be described in detail below with reference to the embodiments.

[0044] Unless otherwise specified, all oligonucleotides used in the examples were synthesized according to the sequences shown in Table 1. All DNA strands used in the examples were purchased from Sangon Biotech (Shanghai) Co., Ltd., purified by high affinity chromatography (HAP), and diluted to a final concentration of 100 μM in 1×TAE buffer containing 12.5 mM magnesium ions. FAM-modified DNA was purified by high performance liquid chromatography (HPLC). M13mp18 was purchased from New England Biolabs. Ultrafiltration centrifuge tubes were purchased from Milllipore (Burlington, Massachusetts, USA). Human ovarian cancer cell lines (SKOV3 / DDP, A2780, A2780 / DDP, COC1) and ovarian epithelial cell line (IOSE80) were purchased from the China Center for Type Culture Collection (Wuhan, China). Fetal bovine serum and RPMI1640 medium were purchased from Gibco (Shanghai, China). Total RNA was extracted using TRIzol (Beijing Solarbio), chloroform, and isopropanol. All RNA-related experiments used ribonuclease-free water and consumables.

[0045] Example

[0046] This embodiment designs an RNA-responsive controlled-release DNA nanoparticle drug delivery system using siRNA as the active drug component and miR-21, which is highly expressed in tumor cells, as the target RNA. The method for preparing the drug delivery system in this embodiment includes the following steps:

[0047] 1. Oligonucleotide design

[0048] The design and synthesis of oligonucleotides required for drug delivery systems often involves using traditional origami designs to form rectangular structures, which can lead to irregular twisting of the rectangles and affect subsequent curling. This embodiment addresses this by adjusting the relative positions of the stapling strands between different helices to eliminate the torsional forces causing irregular curling: along the axis of a helix, an insertion or skip is added at a base site between each pair of adjacent intersections. If the sequence direction of the stapling strand at the left intersection is upward and the sequence direction of the stapling strand at the right intersection is downward, an insertion is added; otherwise, a skip is added. Since each turn contains approximately 10.5 base pairs, and one turn rotates 360°, the torsion of each base pair can be calculated to be approximately 34.3°. That is, when two helices form a 180° angle, the angle between the third helix and the second helix is ​​145.7°. Starting from helix number 3, two of every three helices undergo a coiling operation. Five out of the eight helices are either inserted, added, or skipped. Therefore, the total degree of twist from the top helix to the bottom helix is ​​5 × 34.3° = 171.5°, achieving the design of a natural semi-circular tubular structure. During the design process, the CanDo server (https: / / cando-dna-origami.org / ) was used to assist in the stability analysis of the structure. The sequences of the oligonucleotides designed in this application are shown in Table 1.

[0049] Table 1

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] Note: The underlined portions of the 26 DNA strands in Table 1 represent the sealing portions of the 13 sealing strands. To attach the siRNA to the inside of the DNA nanotube, the ends of the 20 DNA strands in Table 1 were designed to be complementary to the handle strand CATCCCTAACTCTCA (Seq_106). The underlined portions of the siRNA can pair with the portions within parentheses of the 20 DNA strands. The siRNA sense sequence is dTdTCGGAAGGCCUAAUGCCGAA. CAUCCCUAACUCUCA (Seq_107), Anti-sense sequence UUCGGCAUUAGGCCUUCCG dTdT (Seq_108). mimic miR-21 sequence TAGCTTATCAGACTGATGTTGA (Seq_109).

[0056] 2. Synthesis of the target product (see...) Figure 2 )

[0057] The oligonucleotides in Table 1 were treated with 1×TAE (containing 12.5 mM Mg). 2+ The solution was diluted, and M13 was used as a scaffold chain to be mixed with the staple chain at a final concentration of 1:10. The mixture was maintained at 95°C for 2 minutes, and then linearly annealed from 95°C to 4°C in a one-pot process over two hours. The oligonucleotides formed the target product according to the Watson-Crick base complementarity pairing principle.

[0058] 3. Purification and Concentration

[0059] The synthesized sample was purified and concentrated using a 100 kDa ultrafiltration tube (Millipore). The inner wall of the ultrafiltration tube was moistened with 1×TAE buffer for 2–3 hours. The sample was centrifuged in the ultrafiltration tube at 4°C and 12,000 rpm for 5 minutes to remove small free chains. The inner tube was then inverted and inserted into a new centrifuge tube, transferring the target product to the new tube.

[0060] 4. Characterization and stability of the target product

[0061] The morphological characteristics of the target product were detected by atomic force microscopy, and its serum stability was characterized by agarose gel electrophoresis.

[0062] Figure 3 In the image, A shows the results of agarose gel electrophoresis, where the formation of larger structural bands preliminarily indicates that DNA nanotubes have been formed; B shows the results of atomic force microscopy, illustrating the morphological characteristics of the DNA nanotubes. Figure 4 The electron microscopy characterization results demonstrate that the DNA nanotubes exhibit the expected structure under an electron microscope; Figure 5The stability of the target product in serum at 37°C was demonstrated, indicating that our target product began to degrade after 8 hours and was easily internalized by cells. Figure 6 The study demonstrated the stability of the target product at room temperature, indicating that our nanotubes are extremely stable at room temperature and remain undegraded even after 72 hours, showing promise for use in formulations.

[0063] 5. Target RNA test

[0064] Before synthesizing the target product in step 2, siRNA was modified with carboxyfluorescein (FAM) to obtain the target product containing carboxyfluorescein. Experimental samples were prepared: samples containing the target product with added mimic miR-21; control samples were prepared: samples containing only the target product without added mimic miR-21; quantitative polymerase chain reaction (PCR) analysis was performed on the experimental and control samples. Fluorescence intensity was measured at the presence or absence of mimic miR-21 after incubation at 25°C (room temperature) for 100 min. Figure 7 The fluorescence control results of the two samples are shown. Only the control sample of the target product has a very low fluorescence value, while the fluorescence of the experimental sample with added mimic miR-21 is significantly increased, showing a clear difference between the two. This indicates that miR-21 can significantly open DNA nanotubes.

[0065] 6. Flow cytometry uptake experiment

[0066] Ovarian cancer epithelial cell line A2780 / DDP, resistant to cisplatin, was seeded in 6-well plastic plates and cultured for 24 h. Then, the cells were co-incubated with the target product containing carboxyfluorescein, pre-diluted to 100 nM (600 μL) with RPMI 1640 for 0.5 h, 1 h, 2 h, and 3 h. After incubation, the cells were washed twice with phosphate-buffered saline (PFS), treated with trypsin, and collected, then gently resuspended in 200 μL PFS. The fluorescence intensity of PFS was measured using a Beckman CytoFLEX (Beckman Coulter, Indianapolis, IN, USA) by counting 15,000 cells in the FITC channel. Figure 9 The results, based on flow cytometry, show that the target product can be taken up by cells within 0.5 hours.

[0067] 7. Intracellular DNA Nanotube Opening Experiment

[0068] IOSE80, SKOV3 / DDP, and A2780 / DDP cells were seeded onto 14 mm round coverslips and cultured overnight in 12-well plates. Cells were washed three times with PBS before co-incubation with the target product containing carboxyfluorescein (50 nM). These cells were imaged at 40x magnification using a fluorescence microscope (BX53, Olympus, Tokyo, Japan). Figure 10The results of the experiment after co-incubating cells with the target product containing carboxyfluorescein (50 nM) for 30 minutes show that DNA nanotubes can be successfully opened inside cells.

[0069] 8. Real-time fluorescence detection experiment

[0070] Before synthesizing the target product in step 2, siRNA was modified with Cy3 dye to obtain the target product containing Cy3 (DTO-Cy3).

[0071] SKOV3 / DDP cells and A2780 / DDP cells were co-incubated with the target product (50 nM) containing Cy3 in 35 mm confocal culture dishes at 37 °C and 5% CO2 overnight. Real-time fluorescence detection was performed during the incubation period using a Zeiss LSM880 ultra-high resolution inverted laser confocal microscope (Zeiss, Oberkosch, Germany). Figure 11 The image shows the fluorescence just captured, demonstrating that the target product can be effectively taken up by cells under dynamic microscopic conditions.

Claims

1. An RNA-responsive controlled-release DNA nanodrug delivery system, characterized in that, This DNA nanoparticle drug delivery system includes: The DNA nanotube comprises a tube wall and a nanodevice lock. The tube wall unfolds into a rectangle, and the nanodevice lock comprises several sealing strands, each consisting of two partially complementary DNA single strands, which are respectively attached to the two long sides of the tube wall. The sealing strands can undergo an isothermal strand displacement reaction with the target RNA, opening the nanodevice lock and unfolding the tube wall. Each end of the sealing strand has a single-stranded DNA segment. The target RNA consists of sequence 1, which is complementary to the single-stranded DNA, and sequence 2, which is partially complementary to the double-stranded sealing strand. The target RNA is a highly expressed RNA in the target cell; the target cell is a tumor cell, and the highly expressed target RNA is miR-21. The active ingredient of the drug is loaded inside DNA nanotubes.

2. The RNA-responsive controlled-release DNA nanoparticle drug delivery system according to claim 1, characterized in that: The active ingredient of the drug is siRNA, which is linked to the DNA that makes up the tube wall through partial base pairing.

3. The RNA-responsive controlled-release DNA nanoparticle drug delivery system according to claim 2, characterized in that: The siRNA is complementary to the DNA that makes up the tube wall for at least 20 consecutive bases.

4. The RNA-responsive controlled-release DNA nanoparticle drug delivery system according to claim 1, characterized in that: DNA nanotubes have a length of 18-20 nm and an inner diameter of 3-5 nm.

5. The RNA-responsive controlled-release DNA nanoparticle drug delivery system according to claim 1, characterized in that: A sealing chain is set every 1~2nm along the long side of both sides of the tube wall.

6. The RNA-responsive controlled-release DNA nanodrug delivery system according to claim 1, characterized in that: The drug delivery system also includes: The aptamer is attached to the outer surface of the DNA nanotube by means of complementary base pairing.

7. The RNA-responsive controlled-release DNA nanodrug delivery system according to claim 6, characterized in that: The aptamer is a nucleolin aptamer.

Images