An aptamer of heparin binding protein and its application and screening method

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to an aptamer of heparin binding protein and application thereof.The nucleotide sequence of the aptamer is at least one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.The aptamer of the heparin binding protein provided by the present application fills the blank in the field of the aptamer of the heparin binding protein, has good affinity to the HBP protein family, can be specifically combined, and has no combination with other proteins;the aptamer can be applied in a method for detecting the heparin binding protein or a corresponding kit, and specifically can be combined with the HBP protein family to form a molecular probe, be used as a detection reagent and the like for detection, separation and purification of the HBP protein and early diagnosis of human infection, and improves the accuracy of detection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to an aptamer of a heparin-binding protein and applications thereof. Background Art

[0002] Heparin-binding protein (HBP) is a multifunctional cationic antimicrobial protein released by neutrophils that can be rapidly mobilized from migrating polymorphonuclear leukocytes. HBP exhibits certain antimicrobial activity and chemotactic properties. As a chemoattractant, it acts as an activator of monocytes and macrophages, inducing vascular leakage and edema formation. HBP release is triggered by the ligation of the chemokine interleukin-8 (IL-8) with neutrophil β2-integrin. High levels of HBP have been shown in the plasma of patients with severe sepsis. Literature indicates that HBP is an important biomarker for vascular leakage, acute pancreatitis, urinary tract infection, acute respiratory distress syndrome, intracranial infection, and meningitis. Furthermore, studies have shown that HBP can induce acute lung injury by enhancing endothelial permeability during severe bacterial infections such as sepsis. In summary, this protein is closely associated with the pathophysiology of severe bacterial infections and may serve as a potential diagnostic marker and therapeutic target.

[0003] The enzyme-linked immunosorbent assay (ELISA) for the detection of HBP in blood or body fluids has become the most widely used method internationally for detecting early infection markers. However, due to the long testing time, the need for specialized laboratory technicians, and the complex preparation of reagents, it has not been widely adopted in clinical practice. The main technologies currently used for aptamer screening include magnetic bead screening (MB-SELEX), graphene screening (GO-SELEX), capillary tube screening (CE-SELEX), cell-based screening (CELL-SELEX), and microfluidic screening. Summary of the Invention

[0004] (1) Technical issues to be resolved

[0005] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides an aptamer for heparin-binding protein and a screening method, which has extremely strong affinity and specificity for heparin-binding protein and can be used for efficient detection of heparin-binding protein;

[0006] Accordingly, the present invention also provides a method for screening aptamers of heparin-binding proteins.

[0007] Accordingly, the present invention also provides a heparin-binding protein aptamer as a heparin-binding protein detection probe, and the use of the aptamer in an enzyme-linked immunosorbent assay method, a heparin-binding protein detection method in a corresponding detection kit, and a corresponding detection product.

[0008] (2) Technical solution

[0009] In order to achieve the above objectives, the main technical solutions adopted by the present invention include:

[0010] In a first aspect, the present invention provides an aptamer for a heparin-binding protein, the nucleotide sequence of which is shown in at least one of SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, wherein the direction in the nucleotide sequences is 5'-3'.

[0011] In a second aspect, the present invention provides a method for screening aptamers of the above-mentioned heparin-binding protein, comprising the following steps:

[0012] S1 designs upstream primers and downstream primers and synthesizes the corresponding random library;

[0013] The S2 anti-target protein was incubated and coupled with carboxyl magnetic beads to prepare the anti-screening magnetic beads;

[0014] The target protein is incubated and coupled with carboxyl magnetic beads to prepare positive screening magnetic beads;

[0015] S3 uses the random library as the initial library and performs 6 to 20 rounds of screening to obtain the nucleic acid aptamer;

[0016] In the first round, only positive screening of magnetic beads was performed with the initial library;

[0017] For the second round and above of screening, the library after the previous round of screening was treated to denature the double-stranded DNA into single-stranded DNA, and then reverse screening with reverse screening magnetic beads and positive screening with positive screening magnetic beads were performed in sequence.

[0018] In a third aspect, the present invention further provides the use of the aptamer described in any of the above solutions in a heparin-binding protein detection method and a corresponding detection product, wherein the corresponding detection product may be, but is not limited to, a detection kit or a detection reagent.

[0019] Optionally, in the applied technical solution, the probe is made into a probe for detecting heparin-binding protein.

[0020] Optionally, in the applied technical solution, the probe is formed by modifying the aptamer with a thiol group and then assembling it on the surface of the nano-gold.

[0021] Optionally, the probe assembly method is: mixing the aptamer modified with thiol group with nanogold solution, adding trisodium citrate for reaction, adjusting the pH value to 3, and centrifuging at low temperature to obtain a precipitate to obtain the probe.

[0022] Optionally, the characterization method of the probe includes: dissolving the aptamer in 1×TE buffer (pH 7.8-8.2), and measuring the absorbance using a spectrophotometer.

[0023] Optionally, the detection method is enzyme-linked immunosorbent assay (ELISA), and the corresponding detection product is an ELISA kit.

[0024] Specific enzyme-linked immunosorbent assay methods can be:

[0025] S1 heparin-binding protein antibody was coated as the stationary phase: the heparin-binding protein antibody was diluted to 1 μg / mL and coated in a 96-well ELISA plate at 100 μL / well at 4°C overnight. The liquid in the wells was patted dry and blocked with blocking solution (0.01 M TBS (8.5) containing 1% BSA) at 150 μL / well at room temperature for 4 hours. The liquid in the wells was discarded and the wells were shaken dry.

[0026] S2 sample addition reaction: Set up 7 sample wells to be tested, and add 100 μL of the sample at different concentrations (10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1.25 ng / mL, 0.625 ng / mL, 0.312 ng / mL, 0.156 ng / mL) in sequence. Cover the ELISA plate with film and incubate at 37°C for 1 hour (set up two replicate wells and a blank control, and add 100 μL of ultrapure water to the blank well); discard the liquid in the wells and spin dry.

[0027] Add 100 μL of biotinylated heparin-binding protein (HBP) aptamer that has been heat-activated (95°C for 10 min, 4°C for 10 min, and 25°C for 10 min) to S3, cover the plate with the membrane, incubate at 37°C for 1 hour, wash three times with phosphate buffer (pH 7.4), and spin dry.

[0028] S4: Add 100 μL of HRP-labeled streptavidin diluted 1:100 in phosphate buffer (pH 7.4) to each well, cover the plate, and incubate at 37°C for 30 minutes; discard the liquid in the well, wash the plate 5 times, and spin dry;

[0029] S5 Add 100uL of TMB substrate solution to each well and cover the plate. Develop color at 37℃ in the dark for 15 minutes. S6 Add 50uL of stop solution to each well to stop the reaction. + ) immediately turns yellow (TMB 2+ )S7 Immediately measure the optical density (OD value) of each well using a microplate reader at a wavelength of 450 nm.

[0030] The enzyme-linked immunosorbent assay kit may include a 96-well enzyme-linked plate, an HBP standard, a sample diluent, a biotinylated heparin-binding protein (HBP) aptamer, streptavidin-labeled HRP, a TMB substrate solution, a washing solution, and a stop solution.

[0031] (3) Beneficial effects

[0032] The heparin-binding protein aptamer provided by the present invention fills a gap in the field of heparin-binding protein aptamers. It has good affinity for the HBP protein family and can specifically bind to it without binding to other proteins. It can be used in methods for detecting heparin-binding proteins or corresponding kits. Specifically, it can be made into molecular probes with the HBP protein family and used as detection reagents for the detection, separation and purification of HBP proteins and early diagnosis of human infections, thereby improving the accuracy of detection.

[0033] Among them, the heparin-binding protein aptamer provided by the present invention can be artificially synthesized, has low cost, short production cycle, and is easy to chemically modify;

[0034] The screening method provided by the present invention is simple and convenient, and the screened library has a high retention rate.

[0035] The heparin-binding protein aptamer provided by the present invention has high sensitivity and accuracy in detecting HBP protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a flow chart of the aptamer screening method according to Example 4 of the present invention;

[0037] Figure 2 This is a graph showing the retention rate of each round of libraries measured in Example 5 of the present invention;

[0038] Figure 3 This is a graph showing the changes in the recognition ability of the secondary libraries obtained in the 2nd and 11th rounds of screening in Example 4 for the HBP protein as determined in Example 6 of the present invention;

[0039] Figure 4 The response values ​​of the three aptamers of Examples 1-3 and the HBP protein were measured for Example 7 of the present invention;

[0040] Figure 5 The dissociation constants between the three aptamers of Examples 1-3 and the HBP protein were determined for Example 8 of the present invention;

[0041] Figure 6 This is a simulation diagram of the spatial structure of three aptamers measured in Examples 1-3 in Example 9 of the present invention;

[0042] Figure 7 This is a diagram showing the characterization results of the probe made from the aptamer of SEQ.ID NO.1 in Example 11;

[0043] Figure 8 This is a diagram showing the characterization results of the probe made from the aptamer SEQ.ID NO.2 in Example 11;

[0044] Figure 9 This is a diagram showing the characterization results of the probe made from the aptamer SEQ.ID NO.3 in Example 11;

[0045] Figure 10 This is a graph showing the results of Example 12 determining the specificity of the aptamer of Example 1 for the HBP protein;

[0046] Figure 11 This is a graph showing the results of Example 12 measuring the specificity of the aptamer of Example 2 for HBP protein;

[0047] Figure 12 This is a graph showing the results of Example 12 determining the specificity of the aptamer of Example 3 for the HBP protein. DETAILED DESCRIPTION

[0048] In order to better explain the present invention, so that it is easy to understand, the present invention is described in detail below through specific embodiments. In order to better understand the above technical solutions, exemplary embodiments of the present invention will be described in more detail below. Although exemplary embodiments of the present invention are shown below, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a clearer and more thorough understanding of the present invention, and to enable the scope of the present invention to be fully conveyed to those skilled in the art.

[0049] Example 1

[0050] This embodiment provides a heparin binding protein aptamer, the nucleotide sequence of which is 5'-3',

[0051] SEQ ID NO.1:

[0052] TTCAGCACTCCACGCATAGCTTCACCTACCGCAATCCGTTGCTCAGTGCTACCGCACCTATGCGTGCTACCGTGAA.

[0053] This sequence is labeled: AP01-76

[0054] This embodiment also provides a probe for detecting heparin-binding protein aptamers, which is formed by assembling the following aptamers modified with thiol groups on the surface of nano-gold;

[0055] TTCAGCACTCCACGCATAGCTTCACCTACCGCAATCCGTTGCTC AGTGCTACCGCACCTATGCGTGCTACCGTGAA-A(10)-C6-SH.

[0056] Example 2

[0057] This embodiment provides a heparin binding protein aptamer, the nucleotide sequence of which is

[0058] SEQ ID NO.2:

[0059] TTCAGCACTCCACGCATAGCTTCACCTACCGCGCAGCTCAGTCGTTGCCCACACGACCTATGCGTGCTACCGTGAA;

[0060] This sequence is labeled: AP02-76

[0061] This embodiment also provides a probe for detecting heparin-binding protein aptamers, which is formed by assembling the following aptamers modified with thiol groups on a nano-gold interface;

[0062] TTCAGCACTCCACGCATAGCTTCACCTACCGCGCAGCTCAGTC GTTGCCCACACGACCTATGCGTGCTACCGTGAA-A(10)-C6-SH;

[0063] Example 3

[0064] This embodiment provides a heparin binding protein aptamer, the nucleotide sequence of which is

[0065] SEQ ID NO.3:

[0066] TTCAGCACTCCACGCATAGCTCATCGCCTGCGACATGCTAGCA TGCTTTACTACTGCCTATGCGTGCTACCGTGAA.

[0067] This sequence is labeled: AP13-76

[0068] This embodiment also provides a probe for detecting heparin-binding protein aptamers, which is formed by assembling the following aptamers modified with thiol groups on gold nanoparticles;

[0069] TTCAGCACTCCACGCATAGCTCATCGCCTGCGACATGCTAGCA TGCTTTACTACTGCCTATGCGTGCTACCGTGAA-A(10)-C6-SH.

[0070] Example 4

[0071] This example provides a method for screening the aptamers of Examples 1-3, such as Figure 1 As shown, specifically: S1 synthesizes random single-stranded DNA (ssDNA) library and primers:

[0072] Random single-stranded DNA (ssDNA) library:

[0073] 5'-TTCAGCACTCCACGCATAGC-N(36)-CCTATGCGTGCTACCGTGAA-3', where N(36) represents 36 random nucleotides. The library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0074] Forward primer (Lib76S1-FAM): 5'-FAM-TTCAGCACTCCACGCATAGC-3',

[0075] Reverse primer (Lib76A2-polyA):

[0076] 5'-ployA(19A)-Spacer 18-TTCACGGTAGCACGCATAGG-3',

[0077] ① In the reverse primer, 19A represents a polyA tail consisting of 19 adenosines (A);

[0078] ② “Spacer 18” indicates an 18-atom hexaethylene glycol spacer;

[0079] The above primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Each primer was prepared into a 100 μM stock solution in PBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C until use.

[0080] S2 carboxyl magnetic bead screening method

[0081] S21 magnetic bead activation:

[0082] Take 50 μL of carboxylated magnetic beads, wash them 4 times with 200 μL of ultrapure water, take 50 μL of 0.1 M N-hydroxysuccinimide (NHS) aqueous solution and 50 μL of 0.4 M 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) aqueous solution, thaw and mix at 4°C, quickly add them to the magnetic beads, and incubate on a shaker for 20 minutes; after activation, hang the magnetic beads on a magnet, remove the supernatant, and wash with 200 μL of ultrapure water.

[0083] Among them, EDC (Sigma, Catalog No.: E6383), NHS (Sigma, Catalog No.: 56480) S22 anti-screening protein coupling (MB-BSA):

[0084] Take 10 μL of bovine serum albumin (BSA) (concentration: 5 mg / mL) and add 90 μL of NaAc solution (pH 4.0), mix well, and add to the activated magnetic beads that have been washed once with ultrapure water. Incubate on a shaker for 60 minutes. After coupling, the beads are magnetized, the supernatant is removed, and 100 μL of 1 M ethanolamine (pH 8.5) is added. Incubate on a shaker for 10 minutes. The beads are magnetized, the supernatant is removed, and the beads are washed four times with 200 μL of DPBS. Store at 4°C until further use. MB-BSA serves as the target for counter-screening.

[0085] Among them, 1M ethanolamine (Sigma, product number: 411000)

[0086] Conjugation of S23 positive sieve protein (MB-HBP):

[0087] Take 10μl HBP protein (purchased from Suzhou Jinan Protein Technology Co., Ltd., with a concentration of 1.95mg / ml), add 55μl of 10mM sodium acetate (pH5.5) aqueous solution and mix well, add it to the magnetic beads that have been activated and washed once with ultrapure water, and incubate on a shaker for 60min; after the coupling is completed, the magnetic beads are fished with a magnet, the supernatant is removed, 100μL of 1M ethanolamine (pH8.5) is added, and the beads are incubated on a shaker for 10min; the magnetic beads are fished with a magnet, the supernatant is removed, and the beads are washed four times with 200uL of DPBS and stored at 4°C for future use; MB-HBP is used as the positive screening target.

[0088] If the magnetic beads aggregate during incubation, they need to be shaken occasionally.

[0089] S24 screening: Using the random library as the initial library, 11 rounds of screening were performed.

[0090] In the first round, a random library (denatured and annealed before screening) was used for positive screening using only positive screening beads. The second and subsequent rounds of screening involved sequential reverse and positive screening. The library after each round of screening was treated to denature the double-stranded DNA into single-stranded DNA, creating a secondary library. This secondary library, after denaturation and annealing, served as the starting library for the next round of screening.

[0091] The denaturation and renaturation treatment method is as follows: dilute and dissolve the starting library (initial library) above 1OD with PBS to a specific concentration, denature at 95°C for 10 minutes in a PCR instrument, bathe in ice water for 5 minutes, centrifuge instantly, and store at room temperature for use.

[0092] The specific concentrations prepared during the renaturation treatment of the starting library in each screening are shown in Table 1.

[0093] Table 1 Concentration of the initial library preparation for each round of screening

[0094] Screening library Configuration Method concentration Round 1 Initial library + 140uL PBS 10uM Round 2 Starting library (65uL) + 35uL PBS 500nM Round 3 Starting library (73uL) + 27uL PBS 500nM Round 4 Starting library (49uL) + 51uL PBS 500nM Round 5 Starting library (43uL) + 57uL PBS 500nM Round 6 Starting library (28uL) + 72uL PBS 500nM Round 7 Starting library (84uL) + 16uL PBS 500nM Round 8 Starting library (34uL) + 66uL PBS 500nM Round 9 Starting library (53uL) + 47uL PBS 500nM Round 10 Starting library (48uL) + 52uL PBS 500nM Round 11 Starting library (34uL) + 66uL PBS 500nM

[0095] The secondary libraries obtained from the 1st to 11th rounds of screening were recorded as pool1, pool2, pool3, pool4, pool5, pool6, pool7, pool8, pool9, pool10, and pool11 after renaturation treatment.

[0096] Each round of screening includes reverse screening and forward screening in sequence:

[0097] The reverse screening method is as follows: the starting library is added to MB-BSA, and the mixture is mixed by slowly pipetting with a gun, and incubated on a shaker for 60 minutes; the magnetic beads are fished on a magnet, and the supernatant is recorded as pool-; the magnetic beads are rinsed four times with 200 μL DPBS, and the magnetic beads are fished on a magnet. The supernatants of the four rinses are recorded as wash1-, wash2-, wash3-, and wash4-, respectively; 200 μL DPBS is added to the magnetic beads again, and the beads are boiled in a water bath for 10 minutes. The magnetic beads are fished on a magnet, and the supernatant is recorded as elution-;

[0098] The positive screening method is as follows: add pool- to MB-HBP, mix thoroughly by slowly pipetting with a gun, and incubate on a shaker for 60 minutes; fish the beads with a magnet and discard the supernatant; add 200uL DPBS to rinse four times, fish the beads with a magnet, and the supernatants of the four rinses are recorded as wash1+, wash2+, wash3+, and wash4+ respectively; add 200uL DPBS to the beads again, boil them in a boiling water bath for 10 minutes, fish the beads with a magnet, and the supernatant is recorded as elution+;

[0099] The secondary library preparation method is as follows:

[0100] ePCR amplification to prepare double-stranded DNA: Add the library elution+ after reverse and forward screening to 2 mL of PCR mix, mix thoroughly, add 8 mL of ePCR microdroplet generator oil, vortex to mix thoroughly, and let stand for 3 minutes. If no separation occurs, add the mixed emulsion evenly to 8×12 PCR tubes, 100 μL per well, and perform PCR amplification. ePCR microdroplet generator oil was purchased from Anhui Aptamy Biotechnology Co., Ltd. (Cat. No. EPO100). The PCR amplification program was as follows: 95°C for 3 min, 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, 30 cycles, 72°C for 5 min, and 4°C forever.

[0101] The PCR mix formula is shown in Table 2:

[0102] Table 2: PCR mix recipe

[0103] Reagents Total volume 1000 μl ddH2O 866μ 10×pfu enzyme buffer 100 μl dNTPmix (10mM) 20 μl Lib76S1-FAM (100 μM) 5μl Lib76A2-polyA (100 μM) 5μl Pfu enzyme 4μl (20U)

[0104] PCR product concentration: Collect PCR products and divide them equally into two 15 mL centrifuge tubes. Add 8 mL of n-butanol to each tube, vortex mix, centrifuge at 7500 rpm for 10 min, discard the n-butanol in the upper phase, and recover the dsDNA product in the lower phase.

[0105] Preparation of FAM-labeled single-stranded DNA (long-short chain method): Add the concentrated PCR product to an equal volume of 2×TBE / urea denaturation buffer (Anhui Anpu Tuomai Biotechnology Co., Ltd., Catalog No.: TLB-5) and denature at 100°C for 10 min in a PCR instrument. All samples were subjected to urea-denatured polyacrylamide gel electrophoresis at 300 V until bromophenol blue reached the bottom of the gel to separate the single-stranded DNA with Poly A from the FAM-labeled single-stranded DNA. The formula for 7 M urea-denatured polyacrylamide gel is shown in Table 3:

[0106] Table 3: Denaturing polyacrylamide gel recipe

[0107] Element Dosage urea 3.78g 40% polyacrylamide 1.8ml 5×TBE 1.8ml ddH2O 2.25ml 10% APS 40 μl TEMED 10 μl

[0108] Recover FAM-labeled chains: remove the PAGE gel and place it on a plastic film. Under ultraviolet light, a single target band of ssDNA labeled with FAM can be seen. Cut the fluorescent band with a clean blade, put it into a 0.5 mL crushed gel centrifuge tube, put it into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 2 minutes, discard the crushed gel centrifuge tube, add 1 mL of DPBS, boil it in boiling water for 60 minutes, centrifuge it at 12000 rpm for 2 minutes, transfer the supernatant to a 15 mL centrifuge tube, and take 1 mL again. Add DPBS buffer to the crushed gel, repeat boiling and centrifugation once, and transfer all the supernatant to the same 15ml centrifuge tube; add 5 volumes of n-butanol to the 15ml centrifuge tube to concentrate the single-stranded DNA, mix thoroughly by inversion, and centrifuge at 7500g for 5 minutes; the solution will separate into layers, remove the upper layer by aspiration, and recover the lower layer; then load the solution into a 3.5kD micro nucleic acid dialysis device and dialyze in PBS at 4℃ overnight. After measuring the nucleic acid concentration using a NanoDrop-2000c ultramicro spectrophotometer, the secondary library is prepared.

[0109] After 11 rounds of screening in this example, aptamers including those in Examples 1-3 were obtained through sequencing.

[0110] Example 5

[0111] This example provides a method for determining the enrichment level of the library in the screening method of Example 4, the steps of which are:

[0112] Thaw the QPCR mix at a low temperature (4-20°C) and centrifuge at 5000 rpm for 30 seconds. Add 28 μL of QPCR mix to each well of an eight-well QPCR tube strip. Add 2 μL of each wash and elution sample (Elution and washes 1-4) from both the positive and negative screens to the QPCR mix. Reserve one tube of blank QPCR mix and add 2 μL of screening buffer as a negative control. Cap the tube and briefly centrifuge to mix thoroughly. Start the quantitative PCR assay. Incubate at 95°C for 2 minutes, then at 95°C for 0.5 minutes, 60°C for 0.5 minutes, and 72°C for 0.5 minutes, for 25 cycles.

[0113] Different concentrations of the Lib76 initial library were prepared to draw a standard curve, and the retention rate of each round of library was calculated based on the Q-PCR results of this example. The results are shown in Figure 2. Figure 2 shown.

[0114] Figure 2 The retention rate of HBP protein in each round after magnetic bead selection. Figure 2 It can be seen that the retention rate of the positive screen gradually increased and gradually reached the enrichment plateau in the 8th round.

[0115] In order to obtain HBP aptamers with high specificity and affinity, the present invention performed three rounds of screening after reaching the plateau phase, and controlled the positive screening time from 60 min to 45 min. As shown in Table 4, the incubation time and elution times for each round of screening were shown.

[0116] Table 4: Incubation time and elution times for each round of screening

[0117]

[0118] The present invention combines positive screening and reverse screening and controls the time of each screening to improve the enrichment degree of the library.

[0119] Example 6

[0120] This embodiment provides a method for detecting the affinity between the library and the HBP target protein by surface plasmon resonance (SPR).

[0121] In this example, the secondary libraries obtained from the second and eleventh rounds of screening in Example 4 were tested for changes in their ability to recognize HBP protein. The specific testing steps were as follows:

[0122] Sample solution: Take pool 2 and pool 11, and dilute the library concentration to 500nM with PBS buffer (NaCl 137mM, KCl 2.67mM, Na2HPO4 10Mm, KH2PO4 2mM, pH=7.4), respectively, and add 20uL.

[0123] Preparation of activation solution: a mixture of equal volumes of a 0.4 M EDC aqueous solution and a 0.1 M NHS aqueous solution.

[0124] S1 (HBP protein coupling): Activate the chip with activation solution, activate channels 1 and 2, dilute HBP protein to 20 μg / ml with 10 mM sodium acetate (pH 4.5) and inject into channel 2. The HBP protein coupling amount is 4857 Ru.

[0125] S2: After the injection is completed, ethanolamine is injected to block channels 1 and 2, with a flow rate of 10 μL / min and injection for 10 min;

[0126] S3 (detection): Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore T200) to set the kinetic detection parameters. Take the library in a PCR instrument for rapid renaturation (95°C for 10 min; 4°C for 5 min; 25°C for 2 min) and then inject it into channels 1 and 2 in sequence. The injection flow rate is 20 μL / min, the time is 2 min, the dissociation flow rate is 20 μL / min, the time is 2 min, and each library sample is regenerated with 1 M NaCl at a flow rate of 20 μL / min for 1 min.

[0127] The above test results are as follows Figure 3 As shown, Figure 3 This is the binding status of the library in the 2nd and 11th rounds obtained during screening with the HBP target protein. Each curve is the curve obtained by subtracting the channel 1 test result from the channel 2 test result.

[0128] from Figure 3 It can be seen that the affinity of the 2nd and 11th round libraries to the HBP protein showed an upward trend, and the affinity of the 11th round library was much higher than that of the 2nd round library, meeting the sequencing requirements.

[0129] For high-throughput sequencing, the concentration of each ssDNA library was measured using a NanoDrop 2000c ultramicro-spectrophotometer. The sample was diluted to 500 nM in 20 μL and sent to Anhui Anpu Tuomai Biotechnology Co., Ltd. for high-throughput sequencing. The top 48 sequences (76 nt in length) were selected from the highest to the lowest repetition rate and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Surface plasmon resonance (SPR) was used to measure the affinity of each sequence for HBP. Aptamers with high affinity were then selected for further dissociation constant determination of the HBP protein.

[0130] Example 7

[0131] In this example, surface plasmon resonance (SPR) was used to detect the affinity between the first 48 nucleic acid sequences screened in Example 7 and the HBP protein.

[0132] In this example, the changes in the recognition ability of the first 48 nucleic acid sequences obtained by screening for HBP protein were detected. The specific detection steps are as follows:

[0133] Sample solution: The aptamer dry powder was centrifuged at 4000 rpm for 10 min and then diluted with PBS to a stock solution with a final concentration of 20 uM.

[0134] Activation solution: a mixture of equal volumes of a 0.4 M EDC aqueous solution and a 0.1 M NHS aqueous solution.

[0135] Step 1 (HBP protein coupling): Activate the chip with activation solution, activating channels 3 and 4. Dilute HBP protein to 40 μg / ml with 10 mM sodium acetate (pH 4.5) and inject into channel 4. The HBP protein coupling amount is 8700 Ru.

[0136] Step 2: After the injection is completed, ethanolamine is injected to block channels 3 and 4 at a flow rate of 10 μL / min and the injection time is 10 min.

[0137] Step 3 (detection): Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore T200) to set the kinetic detection parameters. Take the HBP aptamer diluted with PBS to a final concentration of 1 uM and then inject it into channels 3 and 4 in sequence. The injection flow rate is 30 μL / min, the time is 2 min, the dissociation flow rate is 30 μL / min, and the time is 2 min. Each library sample is regenerated with 1 M NaCl at a flow rate of 30 μL / min and a time of 1 min.

[0138] The test results of this embodiment are as follows Figure 4 As shown, Figure 4 The curves are obtained by subtracting the results of channel 3 (blank response value) from the results of channel 4 (the response value of the aptamer and the HBP target protein). Figure 4 It can be seen that the three sequences screened out in Examples 1-3 have high response values ​​to the HBP protein.

[0139] Example 8

[0140] This example provides the dissociation constants of the three sequences of Examples 1-3 and the HBP protein detected by surface plasmon resonance (SPR).

[0141] Aptamer solutions with different concentration gradients: Take three nucleic acid aptamers and dilute them with PBS to final concentrations of 1uM, 0.5uM, 0.25uM, 0.125uM, 0.0625uM, and 0uM.

[0142] Activation solution: a mixture of equal volumes of a 0.4 M EDC aqueous solution and a 0.1 M NHS aqueous solution.

[0143] Step 1 (HBP protein coupling): Activate the chip with activation solution, activating channels 1 and 2. Dilute HBP protein to 4 μg / ml with 10 mM sodium acetate (pH 4.5) and inject into channel 2. The HBP protein coupling amount is 815 Ru.

[0144] Step 2: After the injection is completed, ethanolamine is injected to block channels 1 and 2 at a flow rate of 10 μL / min and the injection time is 10 min.

[0145] Step 3 (detection): Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore T200) to set the kinetic detection parameters, take HBP monoclonal diluted with PBS to a final concentration of 4uM, 2uM, 1uM, 0.5uM, 0.25uM, 0.125uM, 0.0625uM, and then inject it into channels 1 and 2 in sequence, with an injection flow rate of 30μL / min, a time of 150s, a dissociation flow rate of 30μL / min, a time of 10min, and each sample was regenerated with 4M NaCl at a flow rate of 30μL / min for 130s.

[0146] Test results such as Figure 5 As shown, Figure 5 The results of SPR detection of the binding force between three nucleic acid aptamers and HBP protein are shown in Figure 2. Each curve is the curve obtained by subtracting channel 1 from channel 2. Figure 5 It can be seen that the three nucleic acid aptamers detected by the SPR instrument all have strong binding to the HBP target protein. The KD values ​​of each sequence given by the instrument are shown in Table 6.

[0147] Table 6

[0148] Aptamer name Affinity KD (nM) AP 01-76 3.48nM AP 02-76 1.44nM AP 13-76 1.04nM

[0149] From Table 6 and Figure 5 It can be seen that the affinity of the nucleic acid aptamer to the HBP protein is extremely high.

[0150] Example 9

[0151] This example provides examples 1-3, three aptamers spatial structure simulation, using Mfold to simulate the three aptamers spatial structure, the results are as follows Figure 5 shown.

[0152] At 25°C, [Na + ]=137mM, [Mg 2+ ]=0.85mM, the spatial structure of the folded three aptamers was simulated, such as Figure 6 As shown, all three aptamers have stable stem-loop structures.

[0153] Example 10

[0154] This embodiment provides a method for preparing the probe of Embodiments 1-3:

[0155] S1: 1 OD of heparin-binding protein aptamer dry powder was centrifuged at 4°C, 4000 rpm / min for 1 min, and ultrapure water was added to dissolve it into a 100 μM aptamer solution;

[0156] S2: reacting the aptamer solution with a phosphoramidite containing a thiol group and a hydroxyl group to prepare a thiol-modified aptamer;

[0157] S3 took 100uL of thiol-modified aptamer (10uM) and evenly mixed with 500uL of nanogold solution, added trisodium citrate solution to make the final concentration of trisodium citrate in the system 10mM, incubated on a shaker at room temperature overnight, adjusted the pH of the solution to about 3, and then centrifuged at 4°C and 12000rpm / min for 20min. Repeated centrifugation and washing with PBS buffer twice, and the precipitate was redissolved in 500uL 1×TE buffer (pH7.8-8.2) to prepare the probe.

[0158] The thiol-modified aptamer in the probe prepared in this example is chemically bound to the surface of AuNPs via a gold-sulfur bond (Au-S). The probe prepared in this example is stored at 4° C. in the dark until use.

[0159] Example 11

[0160] This embodiment provides the characterization method of the probe in Examples 1-3 as follows:

[0161] The absorbance and UV-visible spectra of AuNPs and probes were measured using a UV-visible spectrophotometer (model: Evolution350). Figure 7-9 As shown in the figure, the probes are respectively labeled with corresponding nucleic acid aptamers, such as 01-76 represents the probe after the aptamer of SEQ ID NO.1 is combined with nanogold.

[0162] from Figure 7-9 It can be obtained that the probes made by combining various thiol-modified aptamers with gold nanoparticles have a slight red shift in the absorption peak at 520nm compared to AuNPs (gold nanoparticles) without aptamers. The absorption peak is around 530nm, and there is a small absorption peak at 260nm. Therefore, the surface of AuNPs can successfully bind to various thiol-modified aptamers.

[0163] In summary, the method of the present invention utilizes the systematic evolution of ligands by exponential enrichment (SELEX) technique, using magnetic beads as the separation medium and HBP as the target protein. Through 11 rounds of screening, three aptamers that specifically bind to the target were obtained with extremely high affinity, with dissociation constants reaching the nanomolar range. The resulting nucleic acid aptamers exhibit excellent affinity and specificity, can be synthesized artificially with low cost, short production cycles, and are easily chemically modified. These aptamers can be prepared into molecular probes and detection reagents for the detection, isolation and purification of HBP protein, and early diagnosis of human infection.

[0164] Example 12

[0165] This example provides a method for specific detection of HBP protein by the aptamer in Examples 1-3, the steps of which are as follows:

[0166] Step 1: Preparation of aptamer solution: The aptamers in Examples 1-3 were diluted to a concentration of 1 μM using PBS buffer (137 mM NaCl, 2.67 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4);

[0167] Step 2, preparation of magnetic bead-coupled protein detection solution: Activate the magnetic beads according to the method of step S21 in Example 4, and couple the activated magnetic beads to the following different inflammatory proteins according to the method of step S22 in Example 4: heparin binding protein (HBP), procalcitonin (PCT), C-reactive protein (CRP), interleukin-6 (IL-6), serum amyloid protein-1 (SAA1), and each protein is diluted to 300 ug / ml to obtain the corresponding magnetic bead-coupled protein detection solution, and the same volume of simple magnetic beads (MB) solution without protein coupling is used as the magnetic bead detection solution, and the same volume of distilled water is used as the blank detection solution;

[0168] Step 3, reaction: denature the aptamer solution in step 1 at 95°C for 5 minutes, add 60uL of each into 5 parts of the corresponding magnetic bead-coupled protein detection solution, magnetic bead detection solution, and blank detection solution, and incubate on a shaker at room temperature for 60 minutes; after the reaction is completed, suspend the magnetic beads on a magnet and rinse them twice with 200uL DPBS; resuspend them in 500uL PBS screening buffer and detect them using flow cytometry to obtain the following results: Figure 7-9 The result graph is shown; the horizontal axis is the fluorescence intensity and the vertical axis is the number of particles.

[0169] In step 1, the aptamer of Example 1 is used to prepare an aptamer solution, and the following is obtained: Figure 10 The figure shown;

[0170] In step 1, the aptamer of Example 2 is used to prepare an aptamer solution, and the following is obtained: Figure 11The figure shown;

[0171] In step 1, the aptamer of Example 3 is used to prepare an aptamer solution, and the following is obtained: Figure 12 The figure shown.

[0172] Figure 10-12 middle,

[0173] MB represents the result obtained by measuring with magnetic bead detection solution;

[0174] HBP represents the result obtained by measuring with blank test solution;

[0175] HBP (01-76), HBP (02-76), and HBP (13-76) respectively represent the results of the reaction between HBP magnetic bead-coupled protein and the aptamer represented by the corresponding marker; the same explanation applies to PCT, CRP, IL-6, and SAA1, which will not be repeated here.

[0176] from Figure 10-12 It can be seen that the HBP magnetic bead-coupled protein and the aptamers obtained in Examples 1-3 all have extremely high affinity and specificity, but the other proteins have no affinity and specificity with the aptamers. This proves that the nucleic acid aptamers of the present invention have extremely strong specific binding ability with HBP.

[0177] Example 13

[0178] This example provides a method for detecting HBP protein using the aptamers in Examples 1-3 in an enzyme-linked immunosorbent assay, the steps of which are as follows:

[0179] S1 heparin-binding protein antibody was coated as the stationary phase: the heparin-binding protein antibody was diluted to 1 μg / mL and coated in a 96-well ELISA plate at 100 μL / well at 4°C overnight. The liquid in the wells was patted dry and blocked with blocking solution (0.01 M TBS (8.5) containing 1% BSA) at 150 μL / well at room temperature for 4 hours. The liquid in the wells was discarded and the wells were shaken dry.

[0180] S2 sample addition reaction: Set up 7 sample wells to be tested, and add 100 μL of the sample at different concentrations (10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1.25 ng / mL, 0.625 ng / mL, 0.312 ng / mL, 0.156 ng / mL) in sequence. Cover the ELISA plate with film and incubate at 37°C for 1 hour (set up two replicate wells and a blank control, and add 100 μL of ultrapure water to the blank well); discard the liquid in the wells and spin dry.

[0181] Add 100 μL of biotinylated heparin-binding protein (HBP) aptamer that has been heat-activated (95°C for 10 min, 4°C for 10 min, and 25°C for 10 min) to S3, cover the plate with the membrane, incubate at 37°C for 1 hour, wash three times with phosphate buffer (pH 7.4), and spin dry.

[0182] S4: Add 100 μL of HRP-labeled streptavidin diluted 1:100 in phosphate buffer (pH 7.4) to each well, cover the plate, and incubate at 37°C for 30 minutes; discard the liquid in the well, wash the plate 5 times, and spin dry;

[0183] S5 Add 100uL of TMB substrate solution to each well and cover the plate. Develop color at 37℃ in the dark for 15 minutes. S6 Add 50uL of stop solution to each well to stop the reaction. + ) immediately turns yellow (TMB 2+ )S7 Immediately measure the optical density (OD value) of each well using a microplate reader at a wavelength of 450 nm.

[0184] Among them, the corresponding biotinylated heparin binding protein (HBP) aptamers (all in the 5'-3' direction) are:

[0185] A01-76:Biotin-A(5)

[0186] -TTCAGCACTCCACGCATAGCTTCACCTACCGCAATCCGTTGCTCAGTGCTACCGCACCTATGCGTGCTACCGTGAA;

[0187] A02-76:Biotin-A(5)

[0188] -TTCAGCACTCCACGCATAGCTTCACCTACCGCGCAGCTCAGTCGTTGCCCACACGACCTATGCGTGCTACCGTGAA;

[0189] A13-76:Biotin-A(5)

[0190] -TTCAGCACTCCACGCATAGCTCATCGCCTGCGACATGCTAGCATGCTTTACTACTGCCTATGCGTGCTACCGTGAA.

[0191] The detection method of this embodiment can sensitively detect heparin binding protein (HBP) using the aptamers in Examples 1-3.

[0192] When two or more aptamers described in Examples 1-3 are used in combination in the detection method of this example, it has significantly better sensitivity.

[0193] The aptamer of the present invention is not only applicable to the detection method of enzyme-linked immunosorbent assay, but the combination of two or more aptamers has higher sensitivity and is also suitable for other detection methods.

[0194] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A heparin-binding protein aptamer, characterized in that Its nucleotide sequence is shown as at least one of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3.

Images